Search

Performance of an inter-specific hybrid Fremont mandarin was assessed on different rootstocks in the hot arid regions of India as a potential scion species to expand citrus fruit availability in an arid region. Fremont scion attained superior growth and yield characteristics on Karna khatta rootstock by displaying the greatest plant canopy parameters followed by Rough lemon rootstock. However, the Pectinifera as well as the Troyer citrange resulted in dwarfness of the scion. The scion-rootstock compatibility indicators such as scion rootstock ratio, stionic difference and TCSA which were greatest in the Fremont/Pectinifera combination, confirm that the inhibited tree growth on Pectinifera rootstock was caused by intrinsic features of the rootstock rather than an incompatibility reaction. Furthermore, Karna khatta rootstock resulted in highest fruit yield and related traits followed by Rough lemon and Pectinifera rootstocks. The Pectinifera rootstock resulted in a similar response to all fruit physical attributes i.e., fruit weight, fruit diameter, fruit index and fruiting density, except fruit number. The fruit maturity of Fremont was obtained earliest on Pectinifera, while it was most delayed on Karna khatta and Rough lemon rootstocks. Fruit quality parameters on Pectinifera rootstock were superior to those of common rootstock species (Rough lemon or Karna khatta) including fruit juice content as well as its nutritional constituents like TSS, ascorbic acid, pH, total sugar, organoleptic taste, ripening index, lower content of acidity and rind thickness. The total AAE, total flavonoids, total phenol contents were also noticeably higher than those obtained on other rootstocks, except Troyer citrange. Overall, Fremont mandarin can be considered a promising scion in arid regions to extend the harvesting period of superior quality fruits, especially on dwarfing Pectinifera rootstock. It would further ease harvesting operations vis-a-vis possible attainment of a better micro-climate due to small tree stature and high-density orcharding.

Rootstocks have a significant influence on adaptation to biotic and abiotic stress conditions and quality of fruit. So, choice of rootstock for a specific growing region is an important decision for a grower to make when establishing a commercial citrus orchard. This study was undertaken to assess effects of rootstock and location on quality of orange fruit. The study was conducted over two consecutive years (2017/18 and 2018/19). Scions from the Gunda Gundo orange grove were grafted on rough lemon and sour orange rootstocks and planted in Tigray and Afar, Ethiopia at four sites (Abala, Agulae, Adiha and Rama). The experiment was laid out in Randomized Complete Block Design (RCBD) with four replications. Data on different physico-chemical and bioactive compounds were collected and analyzed using R software (version 4). Compared to sour orange, rough lemon rootstock revealed higher fruit mass (151.96 g, 195.38 g), fruit length (62.27 mm, 68.88 mm) and fruit diameter (65.58 mm, 71.3 mm), in 2017/18, 2018/19, respectively. Among the four locations (Abala, Agulae, Adiha and Rama), higher juice percentage was found in Adiha (43.47% in 2017/18) and Abala (49.87%, in 2018/19). In 2017/18 higher total soluble solid (TSS, 13.87%), TSS/acid ratio (19.18) and fruit rag (32.77%), were obtained at the Rama site. On the one hand, higher vitamin C (826.6 mg • kg−1) and total phenolic content (208 mg • kg−1GAE) were recorded at Agulae than Abala, Adiha and Rama sites from sour orange rootstock. High TSS, TSS/acid ratio and antioxidant were recorded from orange fruits at Rama site. This was expected to have resulted from hot climate conditions at the site. Besides, at a relatively cooler condition of the Agulae site, high phenolic, reduced ferric power and high vitamin C were recorded. Rough lemon rootstock improved fruit size, while rootstock did not affect the contents of TSS, TSS/acid ratio across the sites in both harvesting years.

One of the most destructive beetles attacking stored grain products in the tropics is red flour beetle, Tribolium castaneum Herbst (Coleoptera: Tenebrionidae). The ecological problems associated with using synthetic chemical insecticides have strongly necessitated the need to search for biorational alternatives. The aim of this experiment was to evaluate the chemical composition and the insecticidal potentials of rough lemon (Citrus jambhiri Lush.) fruit rind essential oil (EO) against the pest. The EO obtained via hydrodistillation was assayed against T. castaneum at 27, 53, 80 and 107 mL/L air. Chlorpyrifos was used as a positive control. The EO was subjected to Gas chromatography-Mass spectrometry. A total of 51 compounds, predominated by oxygenated monoterpenes, were identified. The predominant ones included α-Terpineol (8.03%), Lemonol (7.67%) Citral (7.00%), 4-Terpineol (6.52%), n-hexadecanoic acid (4.70%), Caryophellene (4.58%), Citronellol (4.38%) and β-Bisabolene (4.01%), α-Bergamotene (3.74%), and Precocene I (3.33%). Application of the EO at 80–107 mL/L air evoked toxicity (53.75–100.00%) which compared with what was observed in insects treated with Chlorpyrifos (70.00–100.00%). The median lethal time (LT50) observed when the EO was applied at the rate of 80 μL/L air [1.11 (0.00–2.48 h)] was not significantly different from 0.70 (0.16–1.12) h observed when the EO was applied at 107 μL/L air and 0.62 (0.39–1.39) h observed when Chlorpyrifos was applied. The results of this study indicate the potential of the EO as an alternative to over-dependence on synthetic pesticides in the management of red flour beetle.

Citrus holds the key position in horticulture sector of Pakistan in terms of area and production. Kinnow is considered as the trademark of Pakistan’s citriculture industry. Cultivation experiment was conducted to evaluate the endogenous plant hormones, leaf gas exchange, photosynthetic pigments, vegetative performance, and yield of Kinnow mandarin grafted on nine rootstocks (Rough lemon, cox mandarin, Fraser hybrid, Troyer citrange, Cleopatra mandarin, Poncirus trifoliata, Benton, C-35, and Carrizo citrange). Maximum indole acetic acid (IAA), gibberellic acid (GA3), and zeatin (ZT) levels were recorded in scion and rootstock of Poncirus trifoliata followed by Fraser hybrid. Troyer citrange rootstock depicted maximum amount of abscisic acid in scion and rootstock. Maximum leaf gas exchange in Kinnow mandarin was recorded on Fraser hybrid rootstock. Kinnow grafted on Troyer citrange rootstock had minimum stomatal conductance and photosynthetic activity because of high ABA level. Photosynthetic pigments of Kinnow mandarin were maximum on Poncirus trifoliata and minimum on Troyer citrange. A positive correlation was observed among the levels of IAA, GA, ZT, and vegetative growth of Kinnow mandarin. It is concluded that endogenous hormones modulated the growth of Kinnow mandarin. Poncirus trifoliata and Fraser hybrid rootstocks could be an alternate rootstocks of traditional Rough lemon for Kinnow mandarin.

Many species of Citrus and compatible sexual relatives are being used to develop biotic and abiotic tolerant rootstocks and their ability to confer positive stionic effects. Citrus jambhiri is the commercial citrus rootstock in India, deep-rooted well adapted to the diverse agro-climatic conditions. It ensures high yield with large size fruits in most of the scion cultivars and at the same time is resistant to most of the viruses. For in vitro mutagenesis, leaf and epicotyl calli derived shoots were used as explant material. In-vitro mutagenesis is a valuable tool for improvement of a crop, especially when there is a need to add one or two easily identifiable characters in an otherwise well adapted variety, without disturbing its basic genotype. The alkylating agent methyl methane sulphonate (MMS) and ethyl methane sulphonate (EMS) at 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6%, were used for mutagenesis. The mutagenic calli derived shoots were regenerated on MS medium augmented with BAP (3.0 mg/l), followed by rooting in MS medium containing NAA (2.0 mg/l). Percent rooting (29.50-8.33%), (27.11-07.72%), number of roots per shoot (3.11-1.18), (3.12-1.04) and root length (4.13-2.22), (4.15-2.17) decreased with increasing doses of MMS and EMS treatments, respectively. Effect of increasing age of callus showed that callus retained regeneration capacity (3.55%) even after 210 days of culture by repeated sub-culturing. The plantlets were successfully acclimatized in different potting mixtures and highest survival rate (90.35%) was achieved in potting mixture containing garden soil with sand and farmyard manure (1:1:1).

This study aimed to investigate the possibility of enhanced germination attributes upon rough lemon’s seeds treated with plant growth regulators and chemicals. The experiment was laid out in Completely Randomized Design (CRD) with thirteen treatments replicated thrice. Before the sowing, the seeds were soaked with different concentrations of GA3, NAA, KNO3 and thiourea for 12 hours, while the distilled water were taken as control. The study revealed that the earliest germination (10.33 days), highest percentage of germination (88.83%), Survival percentage (90.47%) and total chlorophyll content in leaves (3.50 mg/g) were recorded with soaking seeds in GA3 at 150 ppm concentration which were superior to other treatments. However, all treatments have not shown significant effect on accumulation of proline in the seedling leaves.

This study evaluated oviposition of citrus leaf miner (CLM), Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae), in different Citrus genotypes and related genera to search for resistance sources of type antixenosis or no preference for oviposition. Initially, we screened 23 genotypes and we used lime ‘Rugoso’ (Citrus jambhiri Lush.) as the susceptibility standard. Based on the number of eggs and pupae found on the plants, five genotypes were most promising to significantly reduce pest population: trifoliata ‘Limeira’ (Poncirus trifoliata), hybrids M x P222 [Citrus sinensis × Tangor Murcott (Citrus sinensis × C. reticulata)], C x R4 (Citrus sunki × P. trifoliata) and C x R315 (C. sunki × P. trifoliata) and tangerine ‘Sunki’ (C. sunki). In the preference test for oviposition with choice, trifoliata ‘Limeira’ and hybrid C x R315 were the least preferred genotypes by CLM, while in the no choice test, the effect of the genotypes was less evident, with a difference only between trifoliata ‘Limeira’ (less oviposited) and lime ‘Rugoso’ (more oviposited). Thus, trifoliata ‘Limeira’ and hybrid C x R315 are potential sources of antixenosis resistance and could be used in breeding programs to incorporate CLM resistance factors in improved genotypes.

‘Candidatus Liberibacter spp.’ are associated with the most devastating disease of citrus Huanglongbing (HLB). In previous work, we established an in situ tissue print method for the detection of ‘Ca. L. asiaticus’ (CLas) in sweet orange. We optimized the protocol by preincubation of the anti-Omp antibody with 5% (w/v) extract of healthy rough lemon. This simple process eliminated cross reactions between citrus and the antibody. The optimized protocol enhanced the application of the polyclonal antibody, and we demonstrate detection of CLas from all parts of the world, including isolates from Japan, Thailand, Vietnam, Pakistan, Saudi Arabia, Brazil, the United States, and a selection of strains from China representative of the diversity extant there. The assay also was used to detect four isolates of ‘Ca. L. africanus’ (CLaf) representative of the diversity present in South Africa. The corresponding outer membrane genes of representative isolates were cloned and sequenced. The coding sequences were highly conserved, and isolates of CLas and CLaf shared 53.8 to 55.9% identity between species at the amino acid level. The optimized protocol is efficient for recognition of both CLas and CLaf in phloem cells of different citrus tissues regardless of geographic origin of the HLB samples. The method is simple and scales well to match the urgent need for accurate, sensitive, and high-throughput screening of HLB bacteria, and may play an important role especially for plant inspection and quarantine programs.

Biotechnological tools are useful for true-to-type propagation. Shoot tips encapsulation is potential for plant development from pre-existing meristematic tissue. MS medium fortified with 1 and 2 mg/L of BAP (6-bezylaminopurine) was found to be suitable for in vitro mass-multiplication of plantlets (10.18 and 13.05 plantlets/explant, respectively) of Citrus jambhiri from nodal segments. Nodal segments were more appropriate than the shoot tips for in vitro multiplication of plantlets. Synthetic seeds were prepared using 2.5% sodium alginate dropping into 3.0% CaCl2 solution. Maximum germination was recorded when beaded shoot tips were cultured on MS medium fortified with 1 and 2 mg/L of BAP (96.67 and 100.00%, respectively). However, the germination of synthetic seeds was found to be comparatively high than the earlier findings. The results support the use of encapsulated unipolar explants for synthetic seed preparation. These type of capsules could be useful in exchange of sterile material between laboratories, germplasm conservation and direct plant propagation.

Rough lemon (Citrus × jambhiri Lush.) is one of the important species largely used as a rootstock for commercial plantations of Citrus across the world. In the present study, thirty-eight accessions of C. jambhiri were characterized using morphological and SSR markers for diversity analysis and population structure studies. Morphological characterization of 27 qualitative and 14 quantitative characters indicated the existence of moderate to sufficiently high amount of variability as revealed from the pair-wise similarity analysis value of 0.36. Molecular diversity analysis using 17 SSR primers detected 85.29% polymorphism indicating existence of moderately high amount of variability between the accessions in terms of studied loci. A total of 60 bands were generated, of which all the 60 were polymorphic (100%). The total number of alleles produced varied from 1 to 5 alleles with an average of 3.52 alleles per locus. Although the correlation between the morphological and molecular data was low in the analysed accessions of C. jambhiri, both methods allowed the clustering of accessions based on the analysed traits. Population genetic analysis by SSR markers revealed that accessions collected from North Eastern India were most diverse in terms of genetic diversity parameters and genetic distance analysis of populations showed that the accessions from North East and Himachal Pradesh were most similar genetically while population collected from Himachal Pradesh and Karnataka were the most distinct genetically. Structure analysis of different populations revealed that there is no genetic differentiation happening between the populations.

Diversity in fruit genetic resources in Nepal is contributed by wild, indigenous and exotic sources. This study was carried out to bring together the available fruit species and cultivars at various stations of Department of Agriculture (DoA), Nepal Agricultural Research Council (NARC), Agriculture and Forest University (AFU) and private farms until the Fiscal Year 2017/2018. Altogather there were 47 species of fruits from tropical zone of Terai (Tarahara, Janakpur, Sarlahi, Parwanipur and Khajura) to cold temperature zone of high hills (Marpha, Rajikot and Satbanj) across the country. Apple diversity was found at Horticulture Research Station, Rajikot, Jumla and has introduced 25 spur type cultivars. National Citrus Research Programme (NCRP), Dhankuta was citrus most diversity areas and has maintained 130 exotic and indigenous germplasms of citrus species followed by NCFD, Kirtipur. Mango diversity was noted at RARS, Tarahara (16 cultivars), RARS, Parwanipur (25 cultivars), Farm of DoA-Sarlahi (30 cultivars), Farms of DoA-Janakpur (18 cultivars), AFU-Rampur (17 cultivars). Some of the private nurseries like Everything Organic Nursery, Patlekhet, Kavre and international organization like Technology Demonstration Centre of ICIMOD, Godawari, Lalitpur were also found to be a diversity centre of many exotic and indigenous germplasms of fruit species. These indigenous fruit genetic resources were also used to develop varieties such as Sunkagati-1 and Sunkagati-2 and Tehrathum Local of acid lime, Khoku Local of mandarin orange, 'Malbhog' of banana which were notified by the National Seed Board, SQCC. The unique fruit genetic resources were ‘Pharping Local’ (Asian sand pear), ‘Sindhuli Junar’ (sweet orange), ‘Dhankuta Local’ and ‘Manakamana Local’ (mandarin), Local Malbhog (banana), Bhaktapure Lapsi (Nepalese hog plum) etc. which have superior traits than exotic fruits. Unique and wild fruit species were yellow, black and red raspberries (Rubus ellipticus, R. foliolosus and R. acuminatus respectively), bale (Aegle marmelos), pummelo (Citrus grandis), citron (Citrus medica), sweet lime (Citrus limettoides), butter tree or chiuri (Basia buttyacea), tamarind (Tamarindus indica), black plum (Syzygium cumini), wild apple (Mallus baccata), rough lemon (Citrus jambhiri), bayberry (Myrica esculanta), edimayal (Pyrus pashia), black and white ebony (Diospyrus malbarica), wild species of olive (Olea ferruginea and O. glandulifera), wild kiwifruit (Actinidia callosa) etc. Most of the diversity studies were based on phenotypic descriptions. We believe that the number of species and genotypes listed in this article would be increased if detail survey is further carried out. Way forward to utilize these valuable genetic resources has also been discussed in this manuscript.

Salinity is a commonly occurring abiotic stress and poses as a major impediment in citrus production as the crop has less tolerance ability to this stress. It causes severe osmotic stress restraining overall performance of the plant. One month old seedlings of Rangpur lime, Rough lemon and Indian wild orange were established in sand media and later exposed to stress for 48 hrs in a low cost polyhouse. The different levels of sodium chloride (0 mM, 75 mM and 100 mM) was used for simulating salt stress. The morpho-physiological parameters viz., shoot and root length, fresh and dry weight of shoot and root and Relative water content (RWC) were reduced on exposing to stress with severity being in 100 mM NaCl. On comparing citrus species, Rangpur lime performed better at both stress levels than Rough lemon and Indian wild orange exhibiting its tolerance towards salinity.

Biological indexing is based upon the ability of certain plants, referred to as indicator plants or indicators, to produce specific symptoms when inoculated with a pathogen using mechanical means or grafting. In the case of citrus viroids, clonal indicators are grafted on to vigorous rootstocks such as rough lemon (Citrus × granulata Raf.). The 'Arizona-861-S-1' citron clonal indicator (C. medica L.) can detect and bioamplify all citrus viroids; however, for specific citrus variants of the hop stunt viroid (i.e., CVd-IIb and CVd-IIc), the clonal indicator 'Parson's special # 9' mandarin (C. reticulata Blanco) is preferred. Inoculation techniques and symptom expression are described in detail. Other supporting elements, such as greenhouse conditions and propagation techniques, are also presented.

The objective of this work was to determine the influence of eight rootstocks on the yield, fruit quality, and survival of 'Pêra CNPMF D6' sweet orange (Citrus sinensis) trees grown under rainfed conditions in a cohesive soil of the Brazilian Northeast. In 2014-2018, the yield, fruits, and survival of trees planted in 1997 were evaluated in a randomized complete block design. Yield was assessed using annual fruit production, yield efficiency, and the alternate bearing index. Tree survival was considered the percentage of plants that remained alive until 2018. Fruit quality was evaluated by physicochemical attributes. 'Cravo' confirmed its good yield performance. Despite the lower number of trees, the 'Mazoe' rough lemon rootstock induced the highest fruit yield. The 'Cravo' x 'Cleópatra' hybrid and 'Volkameriano' lemon favored the highest trees survival, whereas 'Indio' citrandarin and 'Cravo' lime resulted in intermediate levels. The 'San Diego' and 'Riverside' citrandarins induced shorter tree with a high yield efficiency and a higher alternate bearing index, respectively. Fruits with less juice and mass were induced, respectively, by 'Riverside' citrandarin and 'Volkameriano' lemon. It can be concluded that the 'Mazoe' rootstock induces a higher fruit yield and 'Cravo' x 'Cleópatra' and 'Volkameriano', a greater survival. In addition, all rootstocks, except 'Riverside' and 'Volkameriano', induce fruit that meet the minimum quality requirements. Resumo: O objetivo deste trabalho foi determinar a influência de oito porta-enxertos no rendimento, na qualidade do fruto e na sobrevivência de laranjeiras (Citrus sinensis) 'Pêra CNPMF D6' cultivadas, em regime de sequeiro, em solo coeso do Nordeste brasileiro. Em 2014-2018, foram avaliados, no delineamento de blocos ao acaso, o rendimento, os frutos e a sobrevivência de árvores plantadas em 1997. O rendimento foi avaliado a partir da produção anual de frutos, da eficiência produtiva e do índice de alternância produtiva. A sobrevivência das árvores foi considerada a percentagem de plantas que permaneceram vivas até 2018. A qualidade dos frutos foi avaliada por meio de atributos físico-químicos. 'Cravo' confirmou seu bom desempenho produtivo. Apesar do menor número de árvores, o porta-enxerto limoeiro rugoso 'Mazoe' induziu a maior produtividade de frutos. O híbrido 'Cravo' x 'Cleópatra' e o limoeiro 'Volkameriano' favoreceram a maior sobrevivência das árvores, enquanto o citrandarin 'Indio' e o limoeiro 'Cravo' resultaram em níveis intermediários. Os citrandarins 'San Diego' e 'Riverside' induziram, respectivamente, árvores menores, com alta eficiência de produção e maior índice de alternância produtiva, respectivamente. Frutos com menos suco e massa foram induzidos, respectivamente, pelo citrandarin 'Riverside' e o limoeiro 'Volkameriano'. Conclui-se que o porta-enxerto 'Mazoe' induz maior rendimento de frutos e 'Cravo' x 'Cleópatra' e 'Volkameriano' maior sobrevivência. Além disso, todos os porta-enxertos, exceto 'Riverside' e 'Volkameriano', induzem frutos que atendem os requerimentos mínimos de qualidade.

Rootstock can improve tree vigor, bloom period, fruit quality and yield of kinnow mandarin. The use of rootstock is a choice for improving the productivity. The aim of this two year study to find out the effect of rootstocks (Rough lemon, Carrizo citrange, Volkamer lemon, CRH-12, NRCC-1, NRCC-2, NRCC-3, NRCC-4, NRCC-5 and NRCC-6) on the flowering period, pollen viability and number of segment of kinnow mandarin. Kinnow started flowering 13th March on almost all rootstocks. However, trees on NRCC-1, NRCC-5 started flowering from 14th March. The earliest full bloom period was recorded on Carrizo, CRH-12 (17th -22th March). None of the rootstocks affects pollen viability significantly during the period of study.

The African citrus triozid, Trioza erytreae Del Guercio (Hemiptera: Triozidae) is one of the primary vectors of the bacterium Candidatus Liberibacter spp. which causes citrus greening, a disease of global economic importance in citrus production. Despite its economic importance, little is known about its chemical ecology. Here, we used behavioral assays and chemical analysis to study the chemical basis of interaction between T. erytreae and one of its preferred host plants, Citrus jambhiri. In dual choice Y-tube olfactometer assays, lemon leaf odors attracted females but not males compared to plain air or solvent controls. However, in a petri dish arena assay, both sexes were arrested by lemon leaf odors. Coupled gas chromatography-mass spectrometry (GC/MS) analysis revealed quantitative differences in the odors of flushing and mature leaves, dominated by terpenes. Twenty-six terpenes were identified and quantified. In Petri dish arena assays, synthetic blends of the most abundant terpenes mimicking lemon flushing leaf odors elicited varying behavioral responses from both sexes of T. erytreae. A nine-component blend and a blend of the three most abundant terpenes; limonene, sabinene and β-ocimene arrested both sexes of T. erytreae. In contrast, a six-component blend lacking in these three components elicited an avoidance response in both sexes. Furthermore, both sexes of T. erytreae preferred the three-component synthetic blend to lemon crude volatile extract. These results suggest that lemon terpenes might be used in the management of T. erytreae.

The chemical profiles of the stem, root and fruit peel essential oils of Citrus jambhiri were investigated. Pulverized plant samples (500 g) each was hydrodistilled using all-glass Clevenge...

The isolation of rough lemon (Citrus jambhiri Lush) rind essential oil has been done by using hydrodistillation method and paper disk diffusion test for antibacterial activity test. 2.3 gram (1.51%) of essential oil was obtained from 450 gram of dried rough lemon rind powder. Based on the analysis using GC-MS, the essential oil from rough lemon rind contains 5 chemical compounds, but only 4 of them can be interpreted. They are Limonene (71.88%), 1,4-cyclohexadiene (13.93%), β-Pinene (10.57%) and β-Ocimene (2.37%). Antibacterial activity was tested to Bacillus cereus and Escherichia coli at 40% concentration (v/v) with 12.7 mm and 12.9 mm of clear zones respectively.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-ST where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Citrus (Rutaceae) species have a relevant role in the culture of the Mediterranean countries, not only for their gastronomic or medicinal value, but especially for their ornamental and symbolic importance. The interest on Citrus diversity led to collect and cultivate numerous cultivars around the Mediterranean Sea, at least since the Roman period. Their image is documented in mosaics, paintings, sculptures and coins since the first millennium BC. Among these, sweet and sour limettas Citrus × limon var. limetta (Risso) Ollitrault, Curk & R.Krueger stand for their history and conservation status. Presently sour limetta is cultivated in Morocco, especially in Marrakesh, and in the Valle de Ricote (Murcia, Spain). Our work has three main objectives: to characterize sour limetta on the basis of Spanish and Moroccan populations, as well as its cultural relevance throughout history, especially in painting, gastronomy, agriculture and gardening, to determine their relationships with limes and lemons and to evaluate the availability and state of conservation of that legacy. We analyze and illustrate the morphology of the plant, flowers and fruits of sour limetta and their differences with other related citrus species and cultivars: sweet limetta, lemon, common lime, Persian lime, bergamot, mellarosa, Meyer lemon, rough lemon, Pursha Romana lime, Palestine sweet lime, Pomum Adami lemon and Rangpur lime. The above species and cultivars were selected on the base of their known ancestry and pomological characters. The distinctive characters are useful for the identification of sour limetta in the field but also for the identifying images of this plant in paintings. We analyzed the ancestry of the different taxa involved and compared the classification based on phenotypes with the classification based on the proportion of ancestors’ genomes in each individual taxa. The image of sour limetta appears in different paintings, from the van Eyck's Ghent Polyptych (early 15th century), and numerous still life works by Italian and Spanish authors of the 16th to 18th centuries. A peculiar type of evidence is provided by presence of limetta in the pictorial catalogues of the Medici's fruit collections displayed in a series of paintings by Bartolomeo Bimbi. This distinctly sour limetta is sold in the markets of Rabat (and other cities of Morocco), either fresh, candied or brined and canned. It is an important ingredient of traditional Moroccan cuisine. Although sour lime was a widely used ingredient in Italian cuisine during the 17th century, its state of preservation is deplorable outside of Morocco, and even there it is gradually replaced by lemons. We recommend its cultivation as a resource both for obtaining rootstocks as well as for its fruits, both for Moroccan cuisine and that of other parts of the world for the excellent aromas and flavors that they contribute to the dishes. In this way, by promoting its crop, we will prevent it from disappearing. It is also important to preserve sour lime in germplasm banks.

A protocol for high-frequency direct organogenesis from root explants of Citrus jambhiri Lush. was developed. Full-length roots (~3cm) were isolated from the in vitro grown seedlings and cultured on Murashige and Skoog basal medium supplemented with Nitsch vitamin (MSN) with different concentrations of cytokinin [6-benzylaminopurine, (BAP)] and gibberellic acid (GA3). The frequency of multiple shoot proliferation was very high, with an average of 34.3 shoots per root explant when inoculated on the MSN medium supplemented with BAP (1.0 mg L–1) and GA3 (1.0 mg L–1). Optimal rooting was induced in the plantlets under half strength MSN medium supplemented with indole-3-acetic acid (IAA, 0.5-1.0 mg L–1). IAA induced better root structure than 1-naphthaleneacetic acid (NAA), which was evident from the result of scanning electron microscopy (SEM). The expressions of growth-regulating factor genes (GRF1 and GRF5) and GA3 signaling genes (GA2OX1 and KO1) were high in the regenerants obtained using MSN+BAP (1.0 mg/L)+GA3 (1.0 mg/L). The expressions of auxin regulating genes were high in roots obtained in ½ MSN+IAA1.0 mg L-1. Furthermore, the virus indexing of the regenerants confirmed that there were no virus amplicons detected for Huanglongbing and Citrus tristezavirus. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeat (ISSR) markers detected no polymorphic bands amongst the regenerated plants. The high-frequency direct regeneration protocol in the present study provides an enormous significance in Citrus organogenesis, it’s commercial cultivation and genetic conservation.

The present study was conducted to determine the mineral profile of some selected Citrus fruits collected from different localities of district Sargodha i.e. Silanwali, Sargodha, Bhalwal. Plants include Citrus reticulata early mandarin (feutrell’s early), Citrus paradisi (Grapefruit), Citrus reticulata mandarin (Kinnow), Citrus jambhiri (Khatti) and Citrus sinensis (Musambi). Results of the mineral analysis showed that the maximum concentration of Fe (6.52±0.12 mg/100g), Mn (0.98±0.08 mg/100g), Cr (0.46±0.03 mg/100g) and Zn (1.88±0.10 mg/100g) were analyzed in Citrus sinensis collected from Sargodha and Bhalwal respectively while the highest concentration of PO4 (8.10±0.09 mg/100g), Cu (33.59±0.05 mg/100g) and Ca (50.71±0.07 mg/100g) were noted in Citrus jambhiri and Citrus reticulata early mandarin collected from Bhalwal and Silanwali respectively. A highly significant variation in the mineral profile of all selected plants were observed which may be attributed to different environmental factors i.e. soil composition, water, temperature or may be linked to spatial variations. Keywords: Citrus fruits; District Sargodha; Mineral profile; Pakistan http://dx.doi.org/10.19045/bspab.2020.90265

Mal secco is one of the most severe diseases of citrus, caused by the necrotrophic fungus Plenodomus tracheiphilus. With the main aim of identifying candidate genes involved in the response of citrus plants to “Mal secco”, we performed a de novo transcriptome analysis of rough lemon seedlings subjected to inoculation of P. tracheiphilus. The analysis of differential expressed genes (DEGs) highlighted a sharp response triggered by the pathogen as a total of 4986 significant DEGs (2865 genes up-regulated and 2121 down-regulated) have been revealed. The analysis of the most significantly enriched KEGG pathways indicated that a crucial role is played by genes involved in “Plant hormone signal transduction”, “Phenylpropanoid biosynthesis”, and “Carbon metabolism”. The main findings of this work are that under fungus challenge, the rough lemon genes involved both in the light harvesting and the photosynthetic electron flow were significantly down-regulated, thus probably inducing a shortage of energy for cellular functions. Moreover, the systemic acquired resistance (SAR) was activated through the induced salicylic acid cascade. Interestingly, RPM1 interacting protein 4, an essential positive regulator of plant defense, and BIR2, which is a negative regulator of basal level of immunity, have been identified thus representing useful targets for molecular breeding.