Search

The efficacy of ALOSCA®, coated and peat seed inoculant treatments on the nodulation of lucerne sown in two soils in Canterbury, New Zealand was investigated. The commercial inoculant wasSinorhizobium melilotistrain RRI128. It was recovered from the nodules of lucerne plants grown from ALOSCA®, peat and coated seed at both sites. Coated seed had the highest nodule occupancy with 45% and 47% of nodules containingS. melilotistrain RRI128 at the Ashley Dene and Lincoln University field sites, respectively. ALOSCA®had only 9% and 16% of nodules from the Ashley Dene and Lincoln University field sites, respectively, containingS. melilotistrain RRI128. NaturalisedRhizobiumstrains were also recovered from the nodules of lucerne plants grown from ALOSCA®, coated and peat seed inoculant treatments. A single genotype (genotype A) of aRhizobiumsp. was recovered more frequently than the inoculatedS. melilotistrain in the nodules of plants grown from peat treated seed at Lincoln University (30% vs 22%) and in the nodules of ALOSCA®treated seed at Ashley Dene (54% vs 9%). Bare seed was also nodulated by theRhizobiumsp. genotype A with 57% and 28% of nodules from plants grown from uninoculated seed at Ashley Dene and Lincoln University, respectively, containing this strain. This research shows delivery by an appropriate inoculation treatment is required to maximise occupancy by the commercial strain. [ABSTRACT FROM AUTHOR]

The genotype of nodule occupants in four annual clovers – balansa (Trifolium michelianum), Persian (Trifolium resupinatum), gland (Trifolium glanduliferum) and arrowleaf (Trifolium vesiculosum) – was investigated. The clovers were inoculated with the ALOSCA® group C granule preparation of strain WSM1325. A total of 224 strains were recovered from root nodules with between 55 and 58 strains for each clover species. Genotyping showed that no strains had fingerprints identical to strain WSM1325. The nodule occupants were diverse with 26, 35, 31 and 32 genotypes identified on arrowleaf, balansa, gland and Persian clovers, respectively. Arrowleaf clover had some specificity for genotype A with 43% of nodules occupied by this strain. The most dominant strain for the other three clovers ranged between 13%–18% occupancy. This work demonstrates a high diversity of naturalized rhizobia strains in New Zealand soils that had the ability to nodulate these top flowering annual clover species. [ABSTRACT FROM AUTHOR]

Aims: Arbuscular mycorrhizal fungi (AMF) can perform significant functions within sustainable agricultural ecosystems, including vineyards. Increased AMF diversity can be beneficial in promoting plant growth and increasing resilience to environmental changes. To effectively utilize AMF communities and their benefits in vineyard ecosystems, a better understanding of how management systems influence AMF community composition is needed. Moreover, it is unknown whether AMF communities in organically managed vineyards are distinct from those in conventionally managed vineyards., Methods and Results: In this study, vineyards were surveyed across the Marlborough region, New Zealand to identify the AMF communities colonizing the roots of different rootstocks grafted with Sauvignon Blanc and Pinot Noir in both conventional and organic systems. The AMF communities were identified based on spores isolated from trap cultures established with the collected grapevine roots, and by next-generation sequencing technologies (Illumina MiSeq). The identified AMF species/genera belonged to Glomeraceae, Entrophosporaceae, and Diversisporaceae. The results revealed a significant difference in AMF community composition between rootstocks and in their interaction with management systems., Conclusions: These outcomes indicated that vineyard management systems influence AMF recruitment by rootstocks and some rootstocks may therefore be more suited to organic systems due to the AMF communities they support. This could provide an increased benefit to organic systems by supporting higher biodiversity., (© The Author(s) 2024. Published by Oxford University Press on behalf of Applied Microbiology International.)

Grapevine trunk diseases (GTDs) are a substantial challenge to viticulture, especially with a lack of available control measures. The lack of approved fungicides necessitates the exploration of alternative controls. One promising approach is the investigation of disease escape plants, which remain healthy under high disease pressure, likely due to their microbiome function. This study explored the microbiome of grapevines with the disease escape phenotype. DNA metabarcoding of the ribosomal internal transcribed spacer 1 (ITS1) and 16S ribosomal RNA gene was applied to trunk tissues of GTD escape and adjacent diseased vines. Our findings showed that the GTD escape vines had a significantly different microbiome compared with diseased vines. The GTD escape vines consistently harbored a higher relative abundance of the bacterial taxa Pseudomonas and Hymenobacter . Among fungi, Aureobasidium and Rhodotorula were differentially associated with GTD escape vines, while the GTD pathogen, Eutypa , was associated with the diseased vines. This is the first report of the link between the GTD escape phenotype and the grapevine microbiome., Competing Interests: HR, DM, and SB are employed by The New Zealand Institute for Plant and Food Research Limited. BV was employed by The New Zealand Institute for Plant and Food Research Limited and is currently employed by Bragato Research Institute. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Adejoro, Jones, Ridgway, Mundy, Vanga and Bulman.)

Arbuscular mycorrhizal fungi (AMF) deliver potentially significant services in sustainable agricultural ecosystems, yet we still lack evidence showing how AMF abundance and/or community composition can benefit crops. In this study, we manipulated AMF communities in grapevine rootstock and measured plant growth and physiological responses. Glasshouse experiments were set up to determine the interaction between rootstock variety and different AMF communities, using AMF communities originating under their own (i.e., "home") soil and other rootstocks' (i.e., "away") soil. The results revealed that specific AMF communities had differential effects on grapevine rootstock growth and nutrient uptake. It was demonstrated that a rootstock generally performed better in the presence of its own AMF community. This study also showed that AMF spore diversity and the relative abundance of certain species is an important factor as, when present in equal abundance, competition between species was indicated to occur, resulting in a reduction in the positive growth outcomes. Moreover, there was a significant difference between the communities with some AMF communities increasing plant growth and nutrient uptake compared with others. The outcomes also demonstrated that some AMF communities indirectly influenced the chlorophyll content in grapevine leaves through the increase of specific nutrients such as K, Mn, and Zn. The findings also indicated that some AMF species may deliver particular benefits to grapevine plants. This work has provided an improved understanding of community level AMF-grapevine interaction and delivered an increased knowledge of the ecosystem services they provide which will benefit the wine growers and the viticulture industry., (© 2022. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

Plant root systems rely on a functionally diverse range of arbuscular mycorrhizal fungi to, among other benefits, extend their nutrient foraging. Extended nutrient foraging is likely of greatest importance to coarse-rooted plants, yet few studies have examined the link between root traits and arbuscular mycorrhizal fungal community composition. Here, we examine the relationship between root diameter and the composition of arbuscular mycorrhizal fungal communities in a range of native and exotic plant species. We characterized the arbuscular mycorrhizal fungal communities of 30 co-occurring native and exotic montane grassland/shrubland plant species in New Zealand. We found that plant root diameter and native/exotic status both strongly correlated with arbuscular mycorrhizal fungal community composition. Coarse-rooted plants had a lower diversity of mycorrhizal fungi compared with fine-rooted plants and associated less with generalist fungal partners. Exotic plants had a lower diversity of fungi and fewer associations with nondominant families of arbuscular mycorrhizal fungi compared with native plants. These observational patterns suggest that plants may differentially associate with fungal partners based on their root traits, with coarse-rooted plants being more specific in their associations. Furthermore, exotic plants may associate with dominant arbuscular mycorrhizal fungal taxa as a strategy in invasion., (© 2023 The Authors. New Phytologist © 2023 New Phytologist Foundation.)

Flowers are an important niche for microbes, and microbes in turn influence plant fitness. As flower morphology and biology change rapidly over time, dynamic niches for microbes are formed and lost. Floral physiology at each life stage can therefore influence arrival, persistence and loss of microbial species; however, this remains little understood despite its potential consequences for host reproductive success. Through internal transcribed spacer 1 (ITS1) community profiling, we characterized the effect of transitioning through five floral stages of mānuka (Leptospermum scoparium), from immature bud to spent flower, and subsequent allocation to seed, on the flower-inhabiting fungal community. We found nectar-consuming yeasts from Aureobasidium and Vishniacozyma genera and functionally diverse filamentous fungi from the Cladosporium genus dominated the anthosphere. The candidate core microbiota persisted across this dynamic niche despite high microbial turnover, as observed in shifts in community composition and diversity as flowers matured and senesced. The results demonstrated that floral stages are strong drivers of anthosphere fungal community assembly and dynamics. This study represents the first detailed exploration of fungi through floral development, building on fundamental knowledge in microbial ecology of healthy flowers., (© 2022 The Authors. Environmental Microbiology published by Applied Microbiology International and John Wiley & Sons Ltd.)

Grapevine trunk diseases (GTDs) are a threat to grape production worldwide, with a diverse collection of fungal species implicated in disease onset. Due to the long-term and complex nature of GTDs, simultaneous detection of multiple microbial species can enhance understanding of disease development. We used DNA metabarcoding of ribosomal internal transcribed spacer 1 (ITS1) sequences, supported by specific PCR and microbial isolation, to establish the presence of trunk pathogens across 11 vineyards (11-26 years old) over three years in Marlborough, the largest wine producing region in New Zealand. Using a reference database of trunk pathogen sequences, species previously associated with GTD, such as Cadophora luteo-olivacea, Diplodia seriata, Diplodia mutila, Neofusicoccum australe, and Seimatosporium vitis, were identified as highly represented across the vineyard region. The well-known pathogens Phaeomoniella chlamydospora and Eutypa lata had especially high relative abundance across the dataset, with P. chlamydospora reads present between 22 and 84% (average 52%) across the vineyards. Screening of sequences against broader, publicly available databases revealed further fungal species within families and orders known to contain pathogens, many of which appeared to be endemic to New Zealand. The presence of several wood-rotting basidiomycetes (mostly Hymenochaetales) was detected for the first time in the Marlborough vineyard region, notably, the native Inonotus nothofagii which was present at 1-2% relative abundance in two vineyards., (© 2022. The Author(s).)

Aim: Botryosphaeriaceae causing stem blight and dieback of blueberry are important pathogens limiting economic production worldwide. This study investigated the pathogenicity and relative virulence of isolates from the Neofusicoccum species commonly associated with blueberries in New Zealand on different tissues and cultivars of blueberries., Methods and Results: Both wounded and non-wounded fruit and flower buds and wounded attached soft green and hard green shoots were susceptible to infection by conidia of Neofusicoccum australe, Neofusicoccum parvum and Neofusicoccum ribis. N. ribis was generally most virulent, followed by N. parvum and then N. australe. Inoculation of potting mixture with N. australe or N. ribis conidia showed that potting mixtures were not a source of inoculum for infection of blueberry roots. Wounded and non-wounded leaf buds, fruit and wounded soft green shoots and hard green shoots of the different cultivars tested were susceptible to infection by N. parvum and N. ribis. Whilst the fruit of all cultivars were similarly infected, infection incidence in inoculated leaf buds was lowest in "Blue Bayou" and "Ocean Blue". Cultivar susceptibility differed when tested on soft green shoots compared with hard green shoots, with shortest lesions developed on "Maru" on soft green shoots, and "Centra Blue" and "Ocean Blue" on hard green shoots., Conclusions: All tested above-ground blueberry tissues, including non-wounded tissue, were susceptible to Neofusicoccum spp. All the cultivars assessed were susceptible to infection, although they varied in their relative susceptibility depending on the tissue assessed., Significance and Impact of the Study: The potential for non-wounded tissue to become infected indicate that fungicides may need to be applied to protect all tissue, not just wounds., (© 2022 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.)

The purpose of developing this high throughput assay was to determine whether there was evidence of pH adaptation in strains of rhizobia which nodulate subterranean clover (SC) and white clover (WC), and whether this was related to the pH of the soil of origin. pH is a first-order factor influencing the niche preferences of soil microorganisms and has been convincingly shown to be a key driver of soil bacterial communities. Naturalised strains of Rhizobium spp. that are pH-adapted may have the potential to better compete and/or persist in acidic or alkaline soils compared with introduced commercial strains. Three pilot studies were conducted to design the optimised bioassay. This bioassay tested the effect of pH-amended yeast mannitol broth (seven pH values from pH 4.5-9.0), across three time points, on the in vitro growth of 299 Rhizobium strains isolated from the nodules of SC and WC. The media pH where strains demonstrated fastest growth was related to the pH of the soil that strains were isolated from. However, the correlation between media pH and soil pH was strongly influenced by the growth of strains from alkaline soils (alkaline adaptation), especially in strains isolated from SC nodules., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Black foot disease is one of the main grapevine root diseases observed worldwide and is especially problematic in New Zealand. Arbuscular mycorrhizal fungi (AMF) have been shown to reduce infection and mitigate the effect of black foot disease on grapevine rootstocks. In contrast to prior studies, which have limited their focus to the effect of one, two or a combination of only a small number of AMF species, this study used whole AMF communities identified from 101-14, 5C and Schwarzmann rootstocks sampled from New Zealand vineyards. The effect of AMF on black foot disease was investigated in a 'home' and 'away' experiment using three commercial grapevine rootstocks. The study produced some evidence that AMF treatments lowered disease incidence at 5 cm and disease severity in vines by 40% to 50% compared to the vines inoculated with the pathogen only. This work also showed that the presence of high disease incidence may have limited the potential disease protective effect of AMF community. However, despite the high disease incidence and severity, AMF inoculation increased vine growth parameters by 60% to 80% compared to the vines inoculated with the pathogen only. This study is the first to provide an understanding on how young grapevine rootstocks inoculated with their 'home' and 'away' AMF communities would respond to challenge with a black foot pathogen species mixture. Further research is required to understand the mechanistic effect of AMF colonization on the increase of grapevine growth parameters under high black foot disease pressure.

Aim: Arbuscular mycorrhizal fungi (AMF) are often regarded as non-specific symbionts, but some AMF communities show host preference in various ecosystems including vineyards. Grapevine plants are very responsive to AMF colonization. Although these fungi have potentially significant applications for sustainable agricultural ecosystems, there is a gap in knowledge regarding AMF-grapevine interactions worldwide and especially in New Zealand. This study focused on identifying AMF taxa colonizing grapevines in New Zealand vineyards and investigated the effect of grapevine rootstocks on AMF community diversity and composition., Methods and Results: Denaturing gradient gel electrophoresis (DGGE) and trap cultures were used to characterize the AMF communities. Grapevine roots from three vineyards and nine rootstocks were analysed by DGGE and used in trap cultures for AMF recovery. Trap cultures allowed the recovery of six AMF spore morphotypes that belonged to Ambispora sp., Claroideoglomus sp., Funneliformis sp. and Glomus sp. Bands excised, reamplified and sequenced from the DGGE were assigned to Glomus sp., Rhizophagus sp. and Claroideoglomus sp. The AMF community analyses demonstrated that rootstock significantly (P < 0·05) influenced the AMF community composition in all sites., Conclusions: The study showed that for a comprehensive identification of AMF, both results from trap culture and molecular work were needed and that the rootstock cultivar was the main driver of the arbuscular mycorrhizal community colonizing the roots., Significance and Impact of the Study: This study provides a firm foundation for future research exploring the beneficial use of AMF in enhancing grapevine production and sustainability., (© 2021 The Society for Applied Microbiology.)

Aims: The influence of soil edaphic factors on recruitment and composition of bacteria in the legume nodule is unknown. Typically, low (acidic) pH soils have a negative effect on the plant-rhizobia symbiosis and thereby reduce clover growth. However, the specific relationship between soil pH and the ecology of rhizobia is unknown, in either their free-living or nodule-inhabiting states. We used New Zealand pasture systems with soils of different pH, and white (WC) and subterranean (SC) clovers, to examine the relationship between soil pH and the diversity of bacteria that inhabit the nodules., Methods and Results: Amplicon sequencing (16S rRNA) assessed the bacterial community in 5299 nodules recovered from both legume species grown in 47 soils of different edaphic (including pH) properties. Fewer nodules were formed on both clovers at low soil pH. As expected, rhizobia comprised ∼ 92% of the total reads in both clovers, however 28 non-rhizobia genera were also present. Soil pH influenced the community structure of bacteria within the nodule, and this was more evident in non-Rhizobium taxa than Rhizobium. Host strongly influenced the diversity of bacteria in the nodules. The alpha diversity of nodule microbiome in SC nodules was higher than in WC nodules and SC nodules also harbored a higher relative abundance of non-Rhizobium bacteria than WC. Beta diversity of Rhizobium and non-Rhizobium bacteria was influenced more by clover species rather than edaphic factors., Conclusions: The results indicate that these clover species modified their nodule biomes in response to pH-stress., Significance and Impact of the Study: The non-Rhizobium bacteria may have some functional significance (such as improved clover persistence in low pH soils) in legume nodules., (© 2021 The Society for Applied Microbiology.)

Aims: This research aimed to identify factors influencing endophyte community structure in apple shoots and the bioactivity of cultured representatives against the fungal pathogen Neonectria ditissima., Methods and Results: The endophyte community in leaves and stems of the apple cultivars 'Royal Gala' and 'Braeburn' were analysed by a cultivation-independent method (PCR-DGGE) which showed that tissue type, cultivar and site were determinant factors, with the endophyte taxa in 'Royal Gala' more variable than that in 'Braeburn', with leaf endophyte communities typically differing from stems in both cultivars. Seasonal (spring vs autumn) and regional (Nelson vs Hawke's Bay) variations were not obvious in woody stems. A collection of 783 bacterial and 87 fungal endophytes were recovered from leaves and stems of 'Royal Gala', 'Braeburn', 'Scilate' and/or 'Scifresh' from Nelson (nine sites) and Hawke's Bay (five sites) in spring and from Nelson (three sites) in autumn. A dual culture plating assay was used to test their ability to inhibit the mycelial growth of N. ditissima. Thirteen bacterial (mean of percent inhibition ≥20%) and 17 fungal isolates were antagonistic towards N. ditissima. These isolates belonged to the bacterial genera Bacillus and Pseudomonas, and fungal genera Chaetomium, Epicoccum, Biscogniauxia, Penicillium, Diaporthe, Phlyctema and two unidentified fungal isolates., Conclusions: Endophyte communities in apple shoots were determined by tissue type, cultivar and site. Endophytic bacterial and fungal isolates inhibiting N. ditissima growth in vitro were found., Significance and Impact of the Study: These results provided new evidence of factors influencing apple endophyte community in New Zealand. Endophytes with potential to reduce N. ditissima infection were identified, with the potential to be developed into a biocontrol strategy for European canker., (© 2020 The Society for Applied Microbiology.)

A better understanding of the ecology of the insect pathogenic fungus, Beauveria bassiana, in soil is needed to identify reasons behind the variable efficacy often seen after field application. A transformed strain of a candidate commercial strain of B. bassiana (F418 gfp tr3), expressing the green fluorescent protein and the hygromycin B resistance gene, was used to assess the effects of the larvae of a host insect, Tenebrio molitor L. (Coleoptera: Tenebrionidae), a non-host, Costelytra zealandica (Coleoptera: Scarabaeidae) and the absence of larvae on the persistence of F418 gfp tr3 in pasteurised and non-sterile soil over 4 months. In the presence of a T. molitor larvae, F418 gfp tr3 populations increased significantly in pasteurised and non-sterile soil; however, populations increased less in non-sterile soil than in pasteurised soil. Lower populations of F418 gfp tr3 were recovered in pasteurised soil in the presence of C. zealandica larvae than in pasteurised soil without larvae. No difference was observed between F418 gfp tr3 populations in non-sterile soil with a non-host larvae or without larvae. Accompanying studies showed that F418 gfp tr3 conidia germinated and produced appressoria on live and excised cuticle of non-host (C. zealandica) larvae but infection did not occur, leading to a net loss of viable conidia in the soil. Conidia administrated orally to C. zealandica larvae were viable on recovery from faecal samples, suggesting that ingestion of the fungus by the larvae had little impact on the viable fungal population. Soil bacterial and fungal community patterns were analysed using Single-Strand Conformation Polymorphism (SSCP) and showed a correlation between changes in F418 gfp tr3 persistence in pasteurised and non-sterile soil and changes in soil communities in the presence of a host insect, non-host insect or in the absence of insect. In pasteurised soil, non-specific germination of F418 gfp tr3 conidia on the non-host larval cuticle and the presence of antagonistic bacteria introduced with the field-collected larvae are most likely responsible for the differences observed. The more complex microbial community structures in non-sterile soil could lead to fungistasis, preventing potentially antagonistic bacteria degrading conidia or inhibiting attachment and germination on the non-host larval cuticle, resulting in the observed lack of difference between non-host and no larval treatments., (Copyright © 2018 Elsevier Inc. All rights reserved.)

Entomopathogenic fungi from the genus Beauveria (Vuillemin) play an important role in controlling insect populations and have been increasingly utilized for the biological control of insect pests. Various studies have reported that Beauveria bassiana (Bals.), Vuill. also has the ability to colonize a broad range of plant hosts as endophytes without causing disease but while still maintaining the capacity to infect insects. Beauveria is often applied as an inundative spore application, but little research has considered how plant colonization may alter the ability to persist in the environment. The aim of this study was to investigate potential interactions between B. bassiana and Zea mays L. (maize) in the rhizosphere following inoculation, in order to understand the factors that may affect environmental persistence of the fungi. The hypothesis was that different isolates of B. bassiana have the ability to colonize maize roots and/or rhizosphere soil, resulting in effects to the plant microbiome. To test this hypothesis, a two-step nested PCR protocol was developed to find and amplify Beauveria in planta or in soil; based on the translation elongation factor 1-alpha ( ef1α ) gene. The nested protocol was also designed to enable Beauveria species differentiation by sequence analysis. The impact of three selected B. bassiana isolates applied topically to roots on the rhizosphere soil community structure and function were consequently assessed using denaturing gradient gel electrophoresis (DGGE) and MicroResp TM techniques. The microbial community structure and function were not significantly affected by the presence of the isolates, however, retention of the inocula in the rhizosphere at 30 days after inoculation was enhanced when plants were subjected to intensive wounding of foliage to crudely simulate herbivory. The plant defense response likely changed under wound stress resulting in the apparent recruitment of Beauveria in the rhizosphere, which may be an indirect defensive strategy against herbivory and/or the result of induced systemic susceptibility in maize enabling plant colonization.

Leptospermum scoparium or mānuka is a New Zealand native medicinal plant that produces an essential oil with antimicrobial properties. This is the first study to investigate the structure and bioactivity of endophytic bacteria in mānuka by using a combination of cultivation-independent (DGGE) and dependent approaches. A total of 23 plants were sampled across three sites. Plants were considered either immature (3-8 years) or mature (>20 years). The endophyte community structure and richness was affected by plant tissue and bacterial communities became more stable and uniform as plant maturity increased. A total of 192 culturable bacteria were recovered from leaves, stems and roots. Some bacterial isolates showed in vitro biocontrol activity against two fungal pathogens, Ilyonectria liriodendri and Neofusicoccum luteum and a bacterial pathogen, Pseudomonas syringae pv. actinidiae. A high proportion of bacterial endophytes could produce siderophores and solubilise phosphate in vitro. Gammaproteobacteria was the most variable class, representing the majority of cultivated bacteria with bioactivity., Competing Interests: The authors have declared that no competing interests exist.

Aim: The aim of this work was to develop a tool to investigate the influence of soil factors on carbon utilization activity of single micro-organisms., Methods and Results: The assay for Rhizobium leguminosarum bv. trifolii in γ-irradiated soil, using the MicroResp(™) system, was optimized for sterility, incubation time, and moisture level. The optimized method was validated with experiments that assessed (i) differences in C utilization of different rhizobia strains and (ii) how this was affected by soil type. Carbon utilization differed among strains of the same species (and symbiovar), but some strains were more responsive to the soil environment than others., Conclusions: This novel modification of the MicroResp(™) has enabled the scope of carbon-utilization patterns of single strains of bacteria, such as Rh. leguminosarum bv. trifolii, to be studied in soil., Significance and Impact of the Study: The system is a new tool with applications in microbial ecology adaptable to the study of many culturable bacterial and fungal soil-borne taxa. It will allow measurement of a micro-organism's ability to utilize common C sources released in rhizosphere exudates to be measured in a physical soil background. This knowledge may improve selection efficiency and deployment of commercial microbial inoculants., (© 2016 The Society for Applied Microbiology.)

The South African invasive legume Dipogon lignosus (Phaseoleae) produces nodules with both determinate and indeterminate characteristics in New Zealand (NZ) soils. Ten bacterial isolates produced functional nodules on D. lignosus. The 16S ribosomal RNA (rRNA) gene sequences identified one isolate as Bradyrhizobium sp., one isolate as Rhizobium sp. and eight isolates as Burkholderia sp. The Bradyrhizobium sp. and Rhizobium sp. 16S rRNA sequences were identical to those of strains previously isolated from crop plants and may have originated from inocula used on crops. Both 16S rRNA and DNA recombinase A (recA) gene sequences placed the eight Burkholderia isolates separate from previously described Burkholderia rhizobial species. However, the isolates showed a very close relationship to Burkholderia rhizobial strains isolated from South African plants with respect to their nitrogenase iron protein (nifH), N-acyltransferase nodulation protein A (nodA) and N-acetylglucosaminyl transferase nodulation protein C (nodC) gene sequences. Gene sequences and enterobacterial repetitive intergenic consensus (ERIC) PCR and repetitive element palindromic PCR (rep-PCR) banding patterns indicated that the eight Burkholderia isolates separated into five clones of one strain and three of another. One strain was tested and shown to produce functional nodules on a range of South African plants previously reported to be nodulated by Burkholderia tuberum STM678(T) which was isolated from the Cape Region. Thus, evidence is strong that the Burkholderia strains isolated here originated in South Africa and were somehow transported with the plants from their native habitat to NZ. It is possible that the strains are of a new species capable of nodulating legumes.

The role of species' interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran's eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners' genetic variation. Different lichen taxa showed some variation in their phylogenetic congruence and spatial genetic patterns and where greater sample replication was used, the amount of variation explained by partner genetic variation increased. Our results suggest that the phylogenetic congruence pattern, at least at small spatial scales, is likely due to reciprocal co-adaptation or co-dispersal. However, the detection of these patterns varies among different lichen taxa, across spatial scales and with different levels of sample replication. This work provides insight into the complexities faced in determining how evolutionary and ecological processes may interact to generate diversity in symbiotic association patterns at the population and community levels. Further, it highlights the critical importance of considering sample replication, taxonomic diversity and spatial scale in designing studies of co-diversification.

Phoma black leg or stem canker, caused by Leptosphaeria maculans or L. biglobosa, is an important disease of brassicas, causing significant crop losses in areas such as Europe, Australia, and North America (1). Samples collected in 2011 from canola and forage brassica (swede, kale, and turnip) crops in the main New Zealand growing regions (Southland, Central Otago, Canterbury, Hawkes Bay, and Manawatu) to identify the causal agent(s) of the characteristic stem cankers, found many isolates of L. maculans, which has been reported previously in New Zealand (2), and three isolates identified by colony characteristics as L. biglobosa. Of the latter, two isolates were from canola (Brassica napus) stem cankers from Darfield and Lincoln, Canterbury, and one was from a kale (B. oleracea) stem canker from Lincoln. An isolate (ICMP10665) of similar morphology, from the International Collection of Microorganisms from Plants (ICMP), obtained from a basal rot lesion on a cauliflower (B. oleracea var. botrytis) plant in Levin, New Zealand in 1979, was also evaluated. The initial, incorrect identification of the latter isolate as L. maculans predates the reclassification of L. maculans group B isolates as a new species, L. biglobosa (1). These four isolates produced fluffy white mycelium and a yellow pigment on potato dextrose agar (PDA) after 5 days' growth, and abundant black-brown, globose pycnidia containing cylindrical hyaline conidia after 7 days. In contrast, L. maculans isolates had slower growth and no pigment production (4). Amplification of genomic DNA using species-specific primers LmacR, LmacF, and LbigF (1) generated a PCR product of 444 bp that is typical of L. biglobosa isolates. Sequencing of the PCR product from each of the four isolates showed they were 100% identical to a sequence of L. biglobosa 'brassicae' in GenBank (JF740198). To confirm the species identity of the isolates, the rDNA, actin, and β-tubulin gene regions were amplified (1,3). Sequences for the rDNA (568 bp), actin (941 bp), and β-tubulin (410 bp) gene regions were 99% identical to sequences of the same regions of isolates in GenBank for L. biglobosa 'brassicae' (AY48997, AY748949.1, and AY748997.1, respectively). The four L. biglobosa isolates were tested for pathogenicity on a canola cultivar commonly grown in New Zealand (Flash). Cotyledons of 10-day-old seedlings (n = 12 seedlings/isolate or control treatment) grown in a potting mix in pots were pricked with a sewing needle, and each wound inoculated with 10 μl of the appropriate conidial suspension (10 6 conidia/ml) or 10 μl sterilized distilled water for the control treatment. Leaf lesions that developed on the inoculated cotyledons were characteristic of those caused by L. biglobosa, i.e., small and dark with a distinct margin. No pycnidia were produced on the lesions. No lesions developed on the cotyledons of the non-inoculated control plants. The causal agents were confirmed as L. biglobosa by the colony morphology of isolates that grew from surface-sterilized, inoculated leaf lesions plated on PDA amended with 100 μg/ml ampicillin. The fungus was not isolated from control leaf tissue. To our knowledge, this is the first report of L. biglobosa as a pathogen of canola and kale in New Zealand. This finding shows that both causal agents of black leg are present in New Zealand's brassica cropping areas. References: (1) S. Y. Liu et al. Plant Pathol. 55:401, 2006. (2) H. C. Smith and B. C. Sutton. Trans. Brit. Mycol. Soc. 47:159, 1964. (3) L. Vincenot et al. Phytopathology 98:321, 2008. (4) R. H. Williams and B. D. L. Fitt. Plant Pathol. 48:161, 1999.

In planta the enzymatic activity of apoplastic and vacuolar invertases is controlled by inhibitory proteins. Although these invertase inhibitors (apoplastic and vacuolar forms) have been implicated as contributing to resistance to cold-induced sweetening (CIS) in tubers of potato (Solanum tuberosum L.), there is a lack of information on the structure and allelic diversity of the apoplastic invertase inhibitor genes. We have PCR-isolated and sequenced the alleles of the apoplastic invertase inhibitor gene (Stinh1) from three tetraploid potato genotypes: 1021/1 (a genotype with very high tolerance to CIS), 'Karaka' and 'Summer Delight' (two cultivars that are highly susceptible to CIS). In total, five alleles were identified in these genotypes, of which four (Stinh1-c, Stinh1-d, Stinh1-e, Stinh1-f) were novel. An analysis of allele diversity was conducted by incorporating previously published sequences of apoplastic invertase inhibitors from potato. Eight alleles were assessed for sequence polymorphism in the two exons and the single hypervariable intron. Contrary to the hypervariable intron, only 65 single nucleotide polymorphisms were observed in the exons, of which 42 confer amino acid substitutions. Phylogenetic analysis of amino acid sequences indicates that the alleles of the invertase inhibitor are highly conserved amongst members of the Solanaceae family.

Background: A range of botryosphaeriaceous species can cause dieback and cankers in grapevines; however, different species most commonly affect the grapevines in different grape-growing regions and countries. They infect through wounds and sporulate on woody stems and green shoots throughout the year, so wound protection is the recommended control strategy. This research evaluated fungicides for their ability to reduce mycelial growth and conidial germination of three botryosphaeriaceous species and to protect pruning wounds against infection., Results: In vitro experiments showed that nine out of 16 tested fungicides were effective at reducing mycelial growth and/or conidial germination of three isolates each of Neofusicoccum australe, N. luteum and Diplodia mutila. The species differed in their response to the fungicides, although N. luteum was usually the least sensitive. When nine selected fungicides were sprayed on cane pruning wounds on potted and field grapevines and subsequently inoculated with N. luteum conidia, some effectively protected them from infection. The most effective fungicides were flusilazole, carbendazim, tebuconazole, thiophanate-methyl and mancozeb, as they prevented the inoculated pathogen from infecting healthy wood in 100, 93, 87, 83 and 80% of field vines, respectively., Conclusion: This research has demonstrated that fungicides applied after winter pruning can protect vines from infection by conidia of three botryosphaeriaceous species., (Copyright © 2012 Society of Chemical Industry.)

Genetic diversity of 50 isolates of Neofusicoccum parvum, the predominant species of the Botryosphaeriaceae recovered from grapevines displaying symptoms of dieback and decline in New Zealand, was compared to that of isolates from Australia, South Africa, and California. The eight universally primed polymerase chain reaction (UP-PCR) primers distinguished 56 genotypes, with only four clonal pairs found. Seven main groups were identified in a neighbour-joining (NJ) tree with isolates from different regions and vineyards of New Zealand, Australia, and California distributed in different groups, indicating a high level of intra and intervineyard genetic variation. All of the South African isolates were positioned in a separate UP-PCR group, indicating that these isolates were less related to the other N. parvum isolates. When compared to fungi that reproduce sexually the genetic diversity and Shannon diversity indices were low (0.076-0.249; 0.109-0.367, respectively), genetic identity levels were high (0.76-0.95), and genetic distance levels were low (0.04-0.27). The large number of genotypes and the low number of clones in the New Zealand N. parvum populations may be explained by parasexual recombination as anastomosis was observed between nonself pairings. Pathogenicity tests using isolates from different UP-PCR groups inoculated onto either green shoots or 1-y-old grapevines detected virulence diversity, indicating intra and intervineyard variation between isolates, however, no correlation was detected between UP-PCR group and virulence., (Copyright © 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.)

New Zealand became geographically isolated about 80 million years ago and this separation gave rise to a unique native flora including four genera of legume, Carmichaelia, Clianthus and Montigena in the Carmichaelinae clade, tribe Galegeae, and Sophora, tribe Sophoreae, sub-family Papilionoideae. Ten bacterial strains isolated from NZ Carmichaelinae growing in natural ecosystems grouped close to the Mesorhizobium huakuii type strain in relation to their 16S rRNA and nifH gene sequences. However, the ten strains separated into four groups on the basis of their recA and glnII sequences: all groups were clearly distinct from all Mesorhizobium type strains. The ten strains separated into two groups on the basis of their nodA sequences but grouped closely together in relation to nodC sequences; all nodA and nodC sequences were novel. Seven strains selected and the M. huakuii type strain (isolated from Astragalus sinicus) produced functional nodules on Carmichaelia spp., Clianthus puniceus and A. sinicus but did not nodulate two Sophora species. We conclude that rhizobia closely related to M. huakuii on the basis of 16S rRNA and nifH gene sequences, but with variable recA and glnII genes and novel nodA and nodC genes, are common symbionts of NZ Carmichaelinae.

Isolates morphologically identified as Cylindrocladiella parva were isolated from characteristic black foot symptoms on a grapevine (Vitis vinifera) rooted on 101-14 rootstock from Central Otago in 2005 and 101-14 rootstocks from a nursery in the Auckland Region in 2007 and 2008. On potato dextrose agar, the isolates initially produced cottony, white mycelia that turned grayish cream or golden cream within 10 days, the initially tawny colony undersides becoming dark brown with age. Conidia (0 to 1 septate; 16.4 to 17.0 [16.7] × 2.3 to 2.6 [2.5] μm) and abundant chlamydospores were produced. To confirm identity of the isolates, genomic DNA was extracted and the ribosomal DNA (rDNA) and β-tubulin gene were amplified and sequenced (3,4). Sequences of the PCR products were compared with sequences in GenBank. The rDNA (535 bp) and β-tubulin (297 bp) sequences of the four isolates were 100 and 99% identical, respectively, to reported sequences of C. parva in GenBank (AY793454, grapevine isolate (4)/AY793455 for rDNA; AY793486/AY793488, grapevine isolate (4)/AY793489/HM034822 for β-tubulin). Although C. parva was previously isolated from grapevines in New Zealand (2) and rootstocks of mature grapevines, cuttings, and graft unions of grafted young grapevines in South Africa (4), its role as a pathogen of Vitis spp. has not been confirmed (2,4). However, it has been reported as a pathogen of Eucalyptus spp. (1) and was also isolated from Telopea speciosissima and Macadamia integrifolia in New Zealand (2,4). The C. parva isolates were tested as a mixed inoculum (four isolates) for pathogenicity on roots of 10 grapevine rootstock plants each of cvs. 101-14 and Schwarzmann (Sch). The rootstocks were grown in potting mix for 4 months, after which the root systems of all vines were wounded with an asparagus knife with a sharp, square tip, driven vertically down into the soil at four equidistant locations approximately 8 cm from the trunk. Each plant was inoculated with 50 ml of the mixed-isolate conidial suspension (10 6 /ml), or 50 ml water (controls), followed by 50 ml of water. After 7 months of growth, the plants were harvested. For C. parva-inoculated plants, internal blackening of the stem base tissue was observed. Isolations from surface-sterilized trunk bases recovered C. parva from four and nine plants of 101-14 and Sch, respectively, with C. parva infections in 25 and 48%, respectively, of the four wood pieces taken per plant. Plants inoculated with water had no blackening and no C. parva was isolated from their stem bases. Mean shoot dry weights of inoculated plants (17.9 and 15.0 g for 101-14 and Sch, respectively) were significantly lower (P = 0.035) than noninoculated controls (26.5 and 20.0 g for 101-14 and Sch, respectively). Mean root dry weights were reduced by C. parva inoculation, although not significantly (32.7 and 27.0 g for C. parva inoculated 101-14 and Sch, respectively, and 36.2 and 27.4 g for control 101-14 and Sch, respectively). To our knowledge, this is the first report of C. parva as a pathogen of grapevines (2,4) and suggests that along with Cylindrocarpon spp., C. parva is part of the pathogen complex responsible for black foot of grapevines. References: (1) P. W. Crous et al. Plant Pathol. 42:302, 1993. (2) P. D. Gadgil et al. Fungi on Trees and Shrubs in New Zealand. Fungal Diversity Press, Hong Kong, 2005. (3) N. L. Glass and G. C. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (4) G. J. van Coller et al. Australas. Plant Pathol. 34:489, 2005.

In a 2008 survey, 120 isolates of the Botryosphaeriaceae were recovered from a representative subsample of Vitis vinifera plants and propagation materials collected in nine New Zealand grapevine nurseries. Isolates were identified by amplified ribosomal DNA restriction analysis (ARDRA) (1) as Neofusicoccum luteum (56%), N. parvum (18%), N. australe (8%), Diplodia mutila (7%), Botryosphaeria dothidea (5%), D. seriata (3%), and N. ribis (2%). One isolate (M353) from 1 cm below the graft union of a nonsymptomatic 1-year-old grafted plant from the Nelson Region was not identified by ARDRA and was morphologically distinct from all others. Mycelium produced by the novel isolate on potato dextrose agar (PDA) was initially moderately dense, flat, and white and turned olivaceous brown within 10 days. The isolate did not produce pycnidia in PDA or prune extract agar, but when grown in water agar with sterile pine needles for 8 weeks at 25°C and a 12-h light/dark regimen, small, black pycnidia covered with mycelium were produced but no conidia were observed. To identify the novel fungus, genomic DNA was extracted and the ribosomal DNA (rDNA), β-tubulin gene, and elongation factor α-1 gene were amplified and sequenced (4). The sequences of the PCR products were compared with sequences present on GenBank. The rDNA (503 bp), β-tubulin (371 bp), and elongation factor α-1 gene (227 bp) sequences of M353 were 100% identical to reported sequences of N. macroclavatum on GenBank (Accession No. DQ093199/198/196 for rDNA, DQ093207/206 for β-tubulin, and DQ093219/217 for elongation factor α-1). These genes differed from the same genes in other Neofusicoccum species by at least 11, 2, and 3 base pairs, respectively. The N. macroclavatum isolate was tested for pathogenicity on wounded grapevine (Sauvignon blanc) green shoots and 1-year-old rooted canes (n = 4 per plant type) using mycelium plugs from a 4-day-old PDA culture. Sterile agar was used for the negative control. Green shoots inoculated with N. macroclavatum developed brown lesions with an average length of 40.5 mm 6 days after inoculation. Bark from inoculated 1-year-old canes was peeled off 28 days after inoculation and brown-to-black lesions on the wood, with an average length of 52 mm, were observed. Control plants produced no lesions. The pathogen was consistently reisolated from the inoculated plants while none were found in negative control plants. To our knowledge, this is the first report of N. macroclavatum as a pathogen of grapevines and the first report of its presence in New Zealand (3). N. macroclavatum was first reported as a pathogen of Eucalyptus globulus in Western Australia in 2005 and has not been reported as a pathogen of grapevines (2). References: (1) A. Alves et al. FEMS Microbiol. Lett. 245:221, 2005. (2) T. T. Burgess et al. Australas. Plant Pathol. 34:557, 2005. (3) J. Sammonds et al. N. Z. Plant Prot. 62:248, 2009. (4) B. Slippers et al. Mycologia 96:83, 2004.

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5' TTCCCCCGTCTCCACTTCTTCATG 3') and Bt1b (5' GACGAGATCGTTCATGTTGAACTC 3') (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 10 6 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Ectomycorrhizal (ECM) associates of the exotic plantation species Pinus radiata were investigated above and below ground over two years in the North Island of New Zealand. ECM species were identified using morphological and molecular (restriction fragment length polymorphism and DNA sequencing) analysis. Eighteen ECM species were observed fruiting above ground; 19 ECM species were identified below ground. In the above ground study, Wilcoxina mikolae, Rhizopogon pseudoroseolus and Inocybe sindonia were noted for the first time as ECM associates of P. radiata in New Zealand. Below ground, the species W. mikolae, R. pseudoroseolus, Rhizopogon luteorubescens, Pseudotomentella sp., Pseudotomentella tristis and Tomentella sp. were found as new associates of P. radiata in New Zealand. Additionally, six ECM types were found that could not be identified with molecular analysis. The putative ECM taxa Tricholoma pessundatum, Laccaria laccata and Hebeloma crustuliniforme were examined by molecular analysis, and species identifications were proposed to be changed to Tricholoma sp., L. laccata and Hebeloma sp. for specimens associated with P. radiata in New Zealand. The species identity of I. sindonia, previously unidentified to species level, was determined with direct sequencing.

A monooxygenase gene was isolated from a biocontrol strain of Trichoderma hamatum and its role in biocontrol was investigated. The gene had homologues in other fungal genomes, but was not closely related to any fully characterised gene. The T. hamatum monooxygenase gene was expressed specifically in response to the plant pathogens Sclerotinia sclerotiorum, Sclerotinia minor and Sclerotium cepivorum, but not in response to Botrytis cinerea or T. hamatum. Expression of the gene did not occur until contact had been made between the two fungal species. Homologues in T. atroviride and T. virens showed similar expression patterns. Expression of the gene in response to S. sclerotiorum was influenced by pH, with a peak of expression at pH 4, and was subject to nitrogen catabolite repression. Disruption of the monooxygenase gene did not affect the growth or morphology of T. hamatum, but caused a decrease in its ability to inhibit the growth and sclerotial production of S. sclerotiorum. The monooxygenase gene had a role in the antagonistic activity of Trichoderma species against specific fungal plant pathogens and is therefore a potentially important factor in biocontrol by Trichoderma species.

The conidiation of the entomopathogenic fungus Beauveria bassiana (Hyphomycete) is a complex process that involves the stage- and cell-type-specific expression of hundreds of genes. The suppression subtractive hybridization method was used to target genes involved in conidiation. Seventeen genes were cloned that potentially were involved in conidia formation. Six of them demonstrated differential expression between conidial and vegetative cultures. Sequence analysis showed three cDNA fragments had similarity to known genes involved in either cellular metabolism or cell regulatory processes. The other cDNA fragments showed low or no similarity to any genes previously described. The full-length cDNA and genomic sequence of a gene designated A43 was isolated. The A43 protein is composed of 180 amino acids and has 34% identity to a RNA-binding region-containing protein. The temporal expression pattern was consistent with the gene being involved in conidiation. The colony morphology of the A43 knock-out mutant had more floccus mycelium than the wild-type and also produced fewer conidia, indicating the A43 gene is involved in B. bassiana conidiation.

Plasmodiophora brassicae, a pathogen of Brassicaceae plants, is grouped within the eukaryotic supergroup, the Rhizaria. Although a large diversity of protists is found in the Rhizaria, genomes of organisms within the group have barely been examined. In this study, we identified DNA sequences spanning or flanking 24 P. brassicae genes, eventually sequencing close to 44 kb of genomic DNA. Evidence from this preliminary genome survey suggested that splicing is an important feature of P. brassicae gene expression; the P. brassicae genes were rich in spliceosomal introns and two mini-exons of less than 20 bp were identified. Consensus splice sites and branch-point sequences in P. brassicae introns were similar to those found in other eukaryotes. Examination of the promoter and transcription start sites of genes indicated that P. brassicae transcription is likely to begin from initiator elements rather than TATA-box containing promoters. Where neighbouring genes were confirmed, intergenic distances were short, ranging from 44 to 470 bp, but a number of larger DNA fragments containing no obvious genes were also sequenced.