Search

The emergence of tick resistance against synthetic and eco-toxic chemical acaricides has stressed the need to find target-specific, non-toxic, and more potent alternatives such as botanicals. The current study was designed to investigate the acaricidal and repellent potential of ethyl acetate extract of Moringa oleifera seeds against Rhipicephalus microplus cattle ticks. Adult immersion test, larval immersion test, and tick climbing repellent assay were carried out to evaluate the acaricidal and repellent potential of M. oleifera extract. Five different concentrations (20, 10, 5, 2.5, and 1.25 %) of the ethyl acetate extract of M. oleifera were prepared to evaluate the acaricidal and repellent potential. Different parameters like adult tick mortality, larval mortality, egg hatchability, inhibition of egg hatchability, oviposition reduction, reproductive index, reproductive efficiency index, tick repellency, and product effectiveness were determined. Ethyl acetate extract of M. oleifera showed 70% adult mortality after 24 h treatment when 20% concentration was used. Similarly, 73% larval tick mortality was observed at 20% concentration. The results also showed the dose-dependent response of ethyl acetate extract of M. oleifera seeds against egg hatchability, inhibition of egg hatchability, oviposition reduction, reproductive index, reproductive efficiency index, and tick repellency, confirming that 20% concentration is effective as an acaricide and repellent against R. microplus. Therefore, the tested extract can be considered a possible candidate for controlling R. microplus in cattle. [ABSTRACT FROM AUTHOR]

Background: Acaricide resistance in cattle ticks is a significant concern in (sub)tropical regions, particularly Brazil. The Larval Packet Test (LPT) is the standard laboratory bioassay for resistance diagnosis, which requires triplicates of seven acaricidal dilutions plus controls to cover larval mortalities ranging between 0 and 100%. The value of the LPT lies in providing resistance ratios based on the ratio between the LC50 calculated with potentially resistant and susceptible ticks. However, LC50 ratios are difficult to translate into practical advice for farmers. Moreover, LPT requires laboratory facilities to maintain susceptible tick colonies, and it takes 6 weeks to obtain the larvae to be tested by LPT derived from engorged female ticks collected from cattle in the field. Our novel approach was twofold: first, we upgraded the LPT to the Resistance Intensity Test (RIT) by adopting the latest WHO guidelines for resistance detection in mosquitoes, which combines a 1 × recommended dose with 5 × and 10 × concentrated doses to reveal low, moderate and high resistance intensity, respectively. This reduced the number of test papers and tick larvae and, more importantly, provided relevant information on the resistance level. Our second innovative step was to abolish testing larvae entirely and expose partly engorged adult ticks to the same acaricidal doses immediately after removing them from cattle in the field. This resulted in the Rapid Tick exposure Test (RaTexT®), wherein partly engorged adult ticks were exposed to an acaricide-impregnated, specially designed matrix providing test results within 24 h. This approach directly compared resistance detection in tick larvae in the RIT with resistance in adult ticks in RaTexT®. Methods: Laboratory validation was conducted in Brazil with resistant and susceptible colonies of Rhipicephalus microplus ticks. For field validation, adult R. microplus ticks collected from different cattle farms in Brazil were evaluated for resistance to RaTexT®, and the results regarding their larval progenies were compared with those for the RIT. Partly engorged adult ticks derived from cattle infested with laboratory and field strains of R. microplus were exposed to deltamethrin in RaTexT® containers, which contained six rows of four interconnected compartments, accommodating five to eight semi-engorged female ticks with a preferred size ranging between 5 and 8 mm. The corresponding larvae of each strain were exposed in the RIT to the same deltamethrin concentrations in filter papers. Results: In RaTexT®, mortality in adult ticks from a resistant strain of R. microplus from Seropédica in Brazil was 38.4%, 54.2% and 75.0% at the 1 ×, 5 × and 10 × doses of deltamethrin, respectively. In RIT, mortality of larvae from the same resistant strain was 2.0%, 4.9% and 19.5% at 1 ×, 5 × and 10 × doses, respectively. The results of RaTexT® and RIT agreed since both tests identified a high level of resistance based on a cut-off of 90% mortality. In RaTexT®, mortality of adult ticks from a susceptible strain originating from Porto Alegre was 73.8%, 92.9% and 97.6% at the 1 ×, 5 × and 10 × doses, respectively. In RIT, mortality of larvae from the susceptible strain was 95.2%, 95.2% and 96.8% at the 1 ×, 5 × and 10 × doses, respectively. Interestingly, both tests identified a low number of unexpected resistant individuals in the susceptible strain since the mortality of neither larvae nor adults reached 100%. This effect remained unnoticed in the LPT, wherein a resistance ratio of 159.5 was found based on the LC50 of the resistant strain divided by the LC50 of the susceptible strain. Next, RaTexT® was compared with RIT using adult and larval ticks derived from three field strains of R. microplus in Brazil. RaTexT® detected high levels of resistance to deltamethrin in adult ticks in all strains, which was confirmed in larvae tested by the RIT. Both tests agreed on the same resistance level with significantly lower mortality rates in larvae than in adult ticks. Conclusions: RaTexT® is a novel rapid pen-site test for detecting acaricide resistance in adult livestock ticks. It potentially replaces laborious tests using larval ticks and provides results within 24 h relevant to acaricide resistance management of livestock ticks. [ABSTRACT FROM AUTHOR]

Background: Pyrethroid chemicals are one of the main acaricides used against ticks. Resistance to these chemicals has been reported to be associated with mutations in the voltage-gated sodium channel (VGSC) gene of the Rhipicephalus microplus. This study investigates R. microplus resistance to pyrethroids in Guangxi region of China, marking one of the first research efforts in this area. The findings are intended to provide vital baseline for the effective implementation of localized tick control strategies. Methods: From March to July 2021, 447 R. microplus tick samples were collected from five prefecture-level cities in Guangxi. Allele-specific polymerase chain reaction (AS-PCR) was used to amplify segments C190A and G215T of the domain II S4-5 linker and T2134A of domain III S6 in the VGSC, to detect nucleotide mutations associated with resistance to pyrethroid acaricides. Subsequent analyses were conducted to ascertain the prevalence, types of mutations, and genotypic distributions within the sampled populations. Results: Mutations within VGSC gene were identified across all five studied populations of R. microplus, although the mutation rates remained generally low. Specifically, the most prevalent mutation was C190A, observed in 4.9% of the samples (22/447), followed by G215T at 4.0% (18/447), and T2134A at 1.3% (6/447). The distribution of mutations across three critical sites of the VGSC gene revealed four distinct mutation types: C190A, G215T, C190A + G215T, and T2134A. Notably, the single mutation C190A had the highest mutation frequency, accounting for 4.3%, and the C190A + G215T combination had the lowest, at only 0.7%. The analysis further identified seven genotypic combinations, with the wild-type combination C/C + G/G + T/T predominating at a frequency of 90.4%. Subsequently, the C/A + G/G + T/T combination was observed at a frequency of 4.3%, whereas the C/C + T/T + T/T combination exhibited the lowest frequency (0.2%). Additionally, no instances of simultaneous mutations at all three sites were detected. Geographical differences in mutation types were apparent. Both samples from Hechi to Chongzuo cities exhibited the same three mutation types; however, C190A was the most prevalent in Hechi, while G215T dominated in Chongzuo. In contrast, samples from Beihai to Guilin each exhibited only one mutation type: G215T occurred in 12.5% (4/32) of Beihai samples, and C190A in 7.5% (4/53) of Guilin samples. Conclusions: These findings underscore the relatively low frequency of VGSC gene mutations in R. microplus associated with pyrethroid resistance in the Guangxi, China. Moreover, the variation in mutation types and genotypic distributions across different locales highlights the need for regionalized strategies in monitoring and managing pyrethroid resistance in tick populations. This molecular surveillance is crucial for informing targeted control measures and mitigating the risk of widespread resistance emergence. [ABSTRACT FROM AUTHOR]

Copyright of Acta Agriculturae Zhejiangensis is the property of Acta Agriculturae Zhejiangensis Editorial Office and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Rhipicephalus microplus poses a significant economic threat due to its role in transmitting Babesia bigemina, B. bovis and Anaplasma marginale. Chemical control methods, commonly employed, encounter challenges like resistance, high costs, and environmental concerns. Emerging as an alternative, entomopathogenic fungi, particularly Beauveria bassiana, present a promising avenue for biological control. Molecular identification using the internal transcribed spacer (ITS1-5.8-ITS4) region ensures accurate species identification. This study investigated two B. bassiana strains, assessing their molecular characterization, impact on R. microplus mortality, and reproductive effects on adult females. The Reproductive Aptitude Index (RAI) is employed to evaluate tick egg viability post-treatment, providing insights into the potential of these fungi for tick control. Results indicate the BbLn2021-1 strain causes 96% mortality, and BbSf2021-1 induces 100% mortality. The commercial strain exhibited 28% mortality, while the control treatment showed 12%. Statistical analysis reveals a significant difference between treatments (p < 0.01). The Reproductive Efficiency Index (REI) underscores BbSf2021-1is superiority, yielding lower egg weights than other treatments. Regarding the RAI, BbLn2021-1 and BbSf2021-1 show no significant differences but differ significantly from the commercial and control (p < 0.01). These findings suggest that strains isolated and characterized from the natural environment could have potential applications in field trials, serving as a biocontrol alternative for R. microplus ticks. [ABSTRACT FROM AUTHOR]

The emergence of tick resistance against synthetic and eco-toxic chemical acaricides has stressed the need to find target-specific, non-toxic, and more potent alternatives such as botanicals. The current study was designed to investigate the acaricidal and repellent potential of ethyl acetate extract of Moringa oleifera seeds against Rhipicephalus microplus cattle ticks. Adult immersion test, larval immersion test, and tick climbing repellent assay were carried out to evaluate the acaricidal and repellent potential of M. oleifera extract. Five different concentrations (20, 10, 5, 2.5, and 1.25 %) of the ethyl acetate extract of M. oleifera were prepared to evaluate the acaricidal and repellent potential. Different parameters like adult tick mortality, larval mortality, egg hatchability, inhibition of egg hatchability, oviposition reduction, reproductive index, reproductive efficiency index, tick repellency, and product effectiveness were determined. Ethyl acetate extract of M. oleifera showed 70% adult mortality after 24 h treatment when 20% concentration was used. Similarly, 73% larval tick mortality was observed at 20% concentration. The results also showed the dose-dependent response of ethyl acetate extract of M. oleifera seeds against egg hatchability, inhibition of egg hatchability, oviposition reduction, reproductive index, reproductive efficiency index, and tick repellency, confirming that 20% concentration is effective as an acaricide and repellent against R. microplus. Therefore, the tested extract can be considered a possible candidate for controlling R. microplus in cattle.

Abstract Background Acaricide resistance in cattle ticks is a significant concern in (sub)tropical regions, particularly Brazil. The Larval Packet Test (LPT) is the standard laboratory bioassay for resistance diagnosis, which requires triplicates of seven acaricidal dilutions plus controls to cover larval mortalities ranging between 0 and 100%. The value of the LPT lies in providing resistance ratios based on the ratio between the LC50 calculated with potentially resistant and susceptible ticks. However, LC50 ratios are difficult to translate into practical advice for farmers. Moreover, LPT requires laboratory facilities to maintain susceptible tick colonies, and it takes 6 weeks to obtain the larvae to be tested by LPT derived from engorged female ticks collected from cattle in the field. Our novel approach was twofold: first, we upgraded the LPT to the Resistance Intensity Test (RIT) by adopting the latest WHO guidelines for resistance detection in mosquitoes, which combines a 1 × recommended dose with 5 × and 10 × concentrated doses to reveal low, moderate and high resistance intensity, respectively. This reduced the number of test papers and tick larvae and, more importantly, provided relevant information on the resistance level. Our second innovative step was to abolish testing larvae entirely and expose partly engorged adult ticks to the same acaricidal doses immediately after removing them from cattle in the field. This resulted in the Rapid Tick exposure Test (RaTexT®), wherein partly engorged adult ticks were exposed to an acaricide-impregnated, specially designed matrix providing test results within 24 h. This approach directly compared resistance detection in tick larvae in the RIT with resistance in adult ticks in RaTexT®. Methods Laboratory validation was conducted in Brazil with resistant and susceptible colonies of Rhipicephalus microplus ticks. For field validation, adult R. microplus ticks collected from different cattle farms in Brazil were evaluated for resistance to RaTexT®, and the results regarding their larval progenies were compared with those for the RIT. Partly engorged adult ticks derived from cattle infested with laboratory and field strains of R. microplus were exposed to deltamethrin in RaTexT® containers, which contained six rows of four interconnected compartments, accommodating five to eight semi-engorged female ticks with a preferred size ranging between 5 and 8 mm. The corresponding larvae of each strain were exposed in the RIT to the same deltamethrin concentrations in filter papers. Results In RaTexT®, mortality in adult ticks from a resistant strain of R. microplus from Seropédica in Brazil was 38.4%, 54.2% and 75.0% at the 1 ×, 5 × and 10 × doses of deltamethrin, respectively. In RIT, mortality of larvae from the same resistant strain was 2.0%, 4.9% and 19.5% at 1 ×, 5 × and 10 × doses, respectively. The results of RaTexT® and RIT agreed since both tests identified a high level of resistance based on a cut-off of 90% mortality. In RaTexT®, mortality of adult ticks from a susceptible strain originating from Porto Alegre was 73.8%, 92.9% and 97.6% at the 1 ×, 5 × and 10 × doses, respectively. In RIT, mortality of larvae from the susceptible strain was 95.2%, 95.2% and 96.8% at the 1 ×, 5 × and 10 × doses, respectively. Interestingly, both tests identified a low number of unexpected resistant individuals in the susceptible strain since the mortality of neither larvae nor adults reached 100%. This effect remained unnoticed in the LPT, wherein a resistance ratio of 159.5 was found based on the LC50 of the resistant strain divided by the LC50 of the susceptible strain. Next, RaTexT® was compared with RIT using adult and larval ticks derived from three field strains of R. microplus in Brazil. RaTexT® detected high levels of resistance to deltamethrin in adult ticks in all strains, which was confirmed in larvae tested by the RIT. Both tests agreed on the same resistance level with significantly lower mortality rates in larvae than in adult ticks. Conclusions RaTexT® is a novel rapid pen-site test for detecting acaricide resistance in adult livestock ticks. It potentially replaces laborious tests using larval ticks and provides results within 24 h relevant to acaricide resistance management of livestock ticks. Graphical Abstract

Abstract Background Southeast Asia is regarded as a hotspot for the diversity of ixodid ticks. In this geographical region, Vietnam extends through both temperate and tropical climate zones and therefore has a broad range of tick habitats. However, molecular-phylogenetic studies on ixodid tick species have not been reported from this country. Methods In this study, 1788 ixodid ticks were collected from cattle, buffalos and a dog at 10 locations in three provinces of northern Vietnam. Tick species were identified morphologically, and representative specimens were molecularly analyzed based on the cytochrome c oxidase subunit I (cox1) and 16S rRNA genes. Fifty-nine tick species that are indigenous in Vietnam were also reviewed in the context of their typical hosts in the region. Results Most ticks removed from cattle and buffalos were identified as Rhipicephalus microplus, including all developmental stages. Larvae and nymphs were found between January and July but adults until December. Further species identified from cattle were Rhipicephalus linnaei, Rhipicephalus haemaphysaloides, Amblyomma integrum and Haemaphysalis cornigera. Interestingly, the latter three species were represented only by adults, collected in one province: Son La. The dog was infested with nymphs and adults of R. linnaei in July. Phylogenetically, R. microplus from Vietnam belonged to clade A of this species, and R. haemaphysaloides clustered separately from ticks identified under this name in China, Taiwan and Pakistan. Amblyomma integrum from Vietnam belonged to the phylogenetic group of haplotypes of an Amblyomma sp. reported from Myanmar. The separate clustering of H. cornigera from Haemaphysalis shimoga received moderate support. Conclusions Three tick species (R. linnaei, A. integrum and H. cornigera) are reported here for the first time in Vietnam, thus increasing the number of indigenous tick species to 62. Clade A of R. microplus and at least R. linnaei from the group of Rhipicephalus sanguineus sensu lato occur in the country. There is multiple phylogenetic evidence that different species might exist among the ticks that are reported under the name R. haemaphysaloides in South and East Asia. This is the first report of A. integrum in Southeastern Asia. Graphical Abstract

Abstract Background Pyrethroid chemicals are one of the main acaricides used against ticks. Resistance to these chemicals has been reported to be associated with mutations in the voltage-gated sodium channel (VGSC) gene of the Rhipicephalus microplus. This study investigates R. microplus resistance to pyrethroids in Guangxi region of China, marking one of the first research efforts in this area. The findings are intended to provide vital baseline for the effective implementation of localized tick control strategies. Methods From March to July 2021, 447 R. microplus tick samples were collected from five prefecture-level cities in Guangxi. Allele-specific polymerase chain reaction (AS-PCR) was used to amplify segments C190A and G215T of the domain II S4-5 linker and T2134A of domain III S6 in the VGSC, to detect nucleotide mutations associated with resistance to pyrethroid acaricides. Subsequent analyses were conducted to ascertain the prevalence, types of mutations, and genotypic distributions within the sampled populations. Results Mutations within VGSC gene were identified across all five studied populations of R. microplus, although the mutation rates remained generally low. Specifically, the most prevalent mutation was C190A, observed in 4.9% of the samples (22/447), followed by G215T at 4.0% (18/447), and T2134A at 1.3% (6/447). The distribution of mutations across three critical sites of the VGSC gene revealed four distinct mutation types: C190A, G215T, C190A + G215T, and T2134A. Notably, the single mutation C190A had the highest mutation frequency, accounting for 4.3%, and the C190A + G215T combination had the lowest, at only 0.7%. The analysis further identified seven genotypic combinations, with the wild-type combination C/C + G/G + T/T predominating at a frequency of 90.4%. Subsequently, the C/A + G/G + T/T combination was observed at a frequency of 4.3%, whereas the C/C + T/T + T/T combination exhibited the lowest frequency (0.2%). Additionally, no instances of simultaneous mutations at all three sites were detected. Geographical differences in mutation types were apparent. Both samples from Hechi to Chongzuo cities exhibited the same three mutation types; however, C190A was the most prevalent in Hechi, while G215T dominated in Chongzuo. In contrast, samples from Beihai to Guilin each exhibited only one mutation type: G215T occurred in 12.5% (4/32) of Beihai samples, and C190A in 7.5% (4/53) of Guilin samples. Conclusions These findings underscore the relatively low frequency of VGSC gene mutations in R. microplus associated with pyrethroid resistance in the Guangxi, China. Moreover, the variation in mutation types and genotypic distributions across different locales highlights the need for regionalized strategies in monitoring and managing pyrethroid resistance in tick populations. This molecular surveillance is crucial for informing targeted control measures and mitigating the risk of widespread resistance emergence. Graphical Abstract

Abstract Babesia spp. and Theileria spp. are tick-borne protozoan parasites with veterinary importance. In China, epidemiological and genetic investigations on many Babesia and Theileria species were still absent in many areas and many tick species. From Aug 2021 to May 2023, 645 ticks were collected from the body surface of domestic animals (camels, goats, sheep, and cattle) using tweezers in seven counties in three provinces including Xinjiang (Qitai, Mulei, Hutubi, and Shihezi counties), Chongqing (Youyang and Yunyang counties), and Qinghai (Huangzhong county). Three tick species were morphologically and molecularly identified (334 Hyalomma asiaticum from Xinjiang, 245 Rhipicephalus microplus from Chongqing, and 66 Haemaphysalis qinghaiensis from Qinghai). A total of three Babesia species and two Theileria species were detected targeting the 18S gene. The COI and cytb sequences were also recovered from Babesia strains for further identification. In R. microplus from Chongqing, Babesia bigemina, the agent of bovine babesiosis, was detected. Notably, in H. asiaticum ticks from Xinjiang, a putative novel genotype of Babesia caballi was identified (0.90%, 3/334), whose COI and cytb genes have as low as 85.82% and 90.64–90.91% nucleotide identities to currently available sequences. It is noteworthy whether the sequence differences of its cytb contribute to the drug resistance of this variant due to the involvement of cytb in the drug resistance of Babesia. In addition, Theileria orientalis and Theileria annulata were detected in R. microplus from Chongqing (12.20%, 31/245) and H. asiaticum from Xinjiang (1.50%, 5/334), respectively. These results suggest that these protozoan parasites may be circulating in domestic animals in these areas. The pathogenicity of the novel genotype of B. caballi also warrants further investigation.

Abstract Background Ticks are obligate hematophagous ectoparasites involved in transmitting viruses of public health importance. The objective of this work was to identify the Jingmen tick virus in hard ticks from the Colombian Caribbean, an arbovirus of importance for public health. Methods Ticks were collected in rural areas of Córdoba and Cesar, Colombia. Taxonomic identification of ticks was carried out, and pools of 13 individuals were formed. RNA extraction was performed. Library preparation was performed with the MGIEasy kit, and next-generation sequencing (NGS) with MGI equipment. Bioinformatic analyses and taxonomic assignments were performed using the Galaxy platform, and phylogenetic analyses were done using IQ-TREE2. Results A total of 766 ticks were collected, of which 87.33% (669/766) were Rhipicephalus microplus, 5.4% (42/766) Dermacentor nitens, 4.2% (32/766) Rhipicephalus linnaei, and 3.0% (23/766) Amblyomma dissimile. Complete and partial segments 1, 2, 3, and 4 of Jingmen tick virus (JMTV) were detected in the metatranscriptome of the species R. microplus, D. nitens, and A. dissimile. The JMTVs detected are phylogenetically related to JMTVs detected in Aedes albopictus in France, JMTVs detected in R. microplus in Trinidad and Tobago, JMTVs in R. microplus and A. variegatum in the French Antilles, and JMTVs detected in R. microplus in Colombia. Interestingly, our sequences clustered closely with JMTV detected in humans from Kosovo. Conclusions JMTV was detected in R. microplus, D. nitens, and A. dissimile. JMTV could pose a risk to humans. Therefore, it is vital to establish epidemiological surveillance measures to better understand the possible role of JMTV in tropical diseases. Graphical Abstract

Background: Southeast Asia is regarded as a hotspot for the diversity of ixodid ticks. In this geographical region, Vietnam extends through both temperate and tropical climate zones and therefore has a broad range of tick habitats. However, molecular-phylogenetic studies on ixodid tick species have not been reported from this country. Methods: In this study, 1788 ixodid ticks were collected from cattle, buffalos and a dog at 10 locations in three provinces of northern Vietnam. Tick species were identified morphologically, and representative specimens were molecularly analyzed based on the cytochrome c oxidase subunit I (cox1) and 16S rRNA genes. Fifty-nine tick species that are indigenous in Vietnam were also reviewed in the context of their typical hosts in the region. Results: Most ticks removed from cattle and buffalos were identified as Rhipicephalus microplus, including all developmental stages. Larvae and nymphs were found between January and July but adults until December. Further species identified from cattle were Rhipicephalus linnaei, Rhipicephalus haemaphysaloides, Amblyomma integrum and Haemaphysalis cornigera. Interestingly, the latter three species were represented only by adults, collected in one province: Son La. The dog was infested with nymphs and adults of R. linnaei in July. Phylogenetically, R. microplus from Vietnam belonged to clade A of this species, and R. haemaphysaloides clustered separately from ticks identified under this name in China, Taiwan and Pakistan. Amblyomma integrum from Vietnam belonged to the phylogenetic group of haplotypes of an Amblyomma sp. reported from Myanmar. The separate clustering of H. cornigera from Haemaphysalis shimoga received moderate support. Conclusions: Three tick species (R. linnaei, A. integrum and H. cornigera) are reported here for the first time in Vietnam, thus increasing the number of indigenous tick species to 62. Clade A of R. microplus and at least R. linnaei from the group of Rhipicephalus sanguineus sensu lato occur in the country. There is multiple phylogenetic evidence that different species might exist among the ticks that are reported under the name R. haemaphysaloides in South and East Asia. This is the first report of A. integrum in Southeastern Asia. [ABSTRACT FROM AUTHOR]

Babesia spp. and Theileria spp. are tick-borne protozoan parasites with veterinary importance. In China, epidemiological and genetic investigations on many Babesia and Theileria species were still absent in many areas and many tick species. From Aug 2021 to May 2023, 645 ticks were collected from the body surface of domestic animals (camels, goats, sheep, and cattle) using tweezers in seven counties in three provinces including Xinjiang (Qitai, Mulei, Hutubi, and Shihezi counties), Chongqing (Youyang and Yunyang counties), and Qinghai (Huangzhong county). Three tick species were morphologically and molecularly identified (334 Hyalomma asiaticum from Xinjiang, 245 Rhipicephalus microplus from Chongqing, and 66 Haemaphysalis qinghaiensis from Qinghai). A total of three Babesia species and two Theileria species were detected targeting the 18S gene. The COI and cytb sequences were also recovered from Babesia strains for further identification. In R. microplus from Chongqing, Babesia bigemina, the agent of bovine babesiosis, was detected. Notably, in H. asiaticum ticks from Xinjiang, a putative novel genotype of Babesia caballi was identified (0.90%, 3/334), whose COI and cytb genes have as low as 85.82% and 90.64–90.91% nucleotide identities to currently available sequences. It is noteworthy whether the sequence differences of its cytb contribute to the drug resistance of this variant due to the involvement of cytb in the drug resistance of Babesia. In addition, Theileria orientalis and Theileria annulata were detected in R. microplus from Chongqing (12.20%, 31/245) and H. asiaticum from Xinjiang (1.50%, 5/334), respectively. These results suggest that these protozoan parasites may be circulating in domestic animals in these areas. The pathogenicity of the novel genotype of B. caballi also warrants further investigation. [ABSTRACT FROM AUTHOR]

This study examined the pattern of resistance to widely applied synthetic pyrethroids, i.e., cypermethrin and deltamethrin, against larvae of Rhipicephalus microplus ticks sampled from Marathwada region in Maharashtra, India. The study also examined the role of α- and β-esterases and glutathione-S-transferase (GST) in resistance development. All eight R. microplus isolates tested were resistant to deltamethrin (RL IV), having RR50 values from 6.88 to 131.26. LPT analysis exhibited the resistance level II deltamethrin resistance in Beed and Hingoli, III in Dharashiv, and IV in Sambhajinagar, Parbhani, Latur, Jalna, and Nanded isolates. The LIT analysis showed that Dharashiv field isolates had the lowest LC50 value of 229.09 ppm against cypermethrin, while Sambhajinagar field isolates had the highest at 489.78 ppm. The RR50 ranged from 1145.45 to 2448.9. Seven isolates were level I resistant to cypermethrin while the Jalna isolate was level II resistant. In larvae treated with deltamethrin and cypermethrin, the activity of α- and β-esterase enzymes increased significantly compared to control groups. The enzyme ratios in treated larvae ranged from 0.7533 to 1.7023 for α-esterase and 0.7434 to 3.2054 for β-esterase. The Hingoli isolate treated with cypermethrin exhibited the highest α-esterase activity (903.261), whereas Sambhajinagar isolate had the highest GST enzyme ratio (2.8224) after deltamethrin exposure. When exposed to cypermethrin, the Hingoli isolate showed the highest GST enzyme ratio, 2.0832. The present study provides the current resistance status in tick populations from Marathwada region indicating deltamethrin and cypermethrin to be ineffective for tick control. The results also suggest that SP compounds should be regulated in this region and alternative control strategies should be introduced. [ABSTRACT FROM AUTHOR]

Background: Ticks are obligate hematophagous ectoparasites involved in transmitting viruses of public health importance. The objective of this work was to identify the Jingmen tick virus in hard ticks from the Colombian Caribbean, an arbovirus of importance for public health. Methods: Ticks were collected in rural areas of Córdoba and Cesar, Colombia. Taxonomic identification of ticks was carried out, and pools of 13 individuals were formed. RNA extraction was performed. Library preparation was performed with the MGIEasy kit, and next-generation sequencing (NGS) with MGI equipment. Bioinformatic analyses and taxonomic assignments were performed using the Galaxy platform, and phylogenetic analyses were done using IQ-TREE2. Results: A total of 766 ticks were collected, of which 87.33% (669/766) were Rhipicephalus microplus, 5.4% (42/766) Dermacentor nitens, 4.2% (32/766) Rhipicephalus linnaei, and 3.0% (23/766) Amblyomma dissimile. Complete and partial segments 1, 2, 3, and 4 of Jingmen tick virus (JMTV) were detected in the metatranscriptome of the species R. microplus, D. nitens, and A. dissimile. The JMTVs detected are phylogenetically related to JMTVs detected in Aedes albopictus in France, JMTVs detected in R. microplus in Trinidad and Tobago, JMTVs in R. microplus and A. variegatum in the French Antilles, and JMTVs detected in R. microplus in Colombia. Interestingly, our sequences clustered closely with JMTV detected in humans from Kosovo. Conclusions: JMTV was detected in R. microplus, D. nitens, and A. dissimile. JMTV could pose a risk to humans. Therefore, it is vital to establish epidemiological surveillance measures to better understand the possible role of JMTV in tropical diseases. [ABSTRACT FROM AUTHOR]

Over nearly 12 years, we collected ticks from free-ranging jaguars (Panthera onca) and performed statistical analyses to comprehend the vector-host relationship throughout the seasons. We evaluated the presence and number of ticks, as well as their association with weight, age, and gender of captured jaguars in the Pantanal and Amazon biomes. Out of 100 captured jaguars (comprising 72 initial captures and 28 recaptures, with 41 females and 31 males), 77 were found to be infested by different tick species. We gathered a total of 1,002 ticks, categorized by the following species in descending order of abundance: Amblyomma sculptum, Amblyomma ovale, Rhipicephalus microplus, Amblyomma triste, Amblyomma cajennense sensu stricto, Amblyomma incisum, and Amblyomma spp. larvae. Apart from weight, statistical analysis indicated that age, gender and seasonality does not significantly affect the presence of different tick species in free ranging jaguars. Notably, A. sculptum adults were more abundant in the first semester, while A. sculptum nymphs and Amblyomma spp. larvae were mainly found during dry months, aligning with their expected life cycle stages. This is the first long-term study in jaguars to correlate seasonality and host factors and also the first time an adult of A. incisum is reported infesting a jaguar. [ABSTRACT FROM AUTHOR]

Rhipicephalus microplus poses a substantial threat to livestock health and agricultural economies worldwide. Its remarkable adaptability to diverse environments and hosts is a testament to its extensive genetic diversity. This review delves into the genetic diversity of R. microplus, employing three pivotal genetic markers: the cytochrome c oxidase I (COX1) gene, ribosomal genes, and microsatellites. The COX1 gene, a crucial tool for genetic characterization and phylogenetic clustering, provides insights into the adaptability of ticks. Ribosomal genes, such as internal transcribed spacer regions (ITS-1 and2) as well as 18S and 28S, are routinely utilized for species differentiation. However, their use is limited due to indels (insertions and deletions). Microsatellites and minisatellites, known for their high polymorphism, have been successfully employed to study populations and genetic diversity across various tick species. Despite their effectiveness, challenges such as null alleles and marker variations warrant careful consideration. Bm86, a well-studied vaccine candidate, exhibits substantial genetic diversity. This diversity directly influences vaccine efficacy, posing challenges for developing a universally effective Bm86-based vaccine. Moreover, the review emphasizes the prevalence of genes associated with synthetic pyrethroid resistance. Identifying single nucleotide polymorphisms in the acaricide-resistant genes of R. microplus has facilitated the development of molecular markers for detecting and monitoring resistance against synthetic pyrethroids. However, mutations in sodium channels, the target site for synthetic pyrethroid, correlate well with the resistance status of R. microplus, which is not the case with other acaricide target genes. This study underscores the importance of understanding genetic diversity in developing effective tick management strategies. The choice of genetic marker should be tailored based on the level of taxonomic resolution and the group of ticks under investigation. A holistic approach combining multiple markers and integrating additional molecular and morphological data may offer a more comprehensive understanding of tick diversity and relationships. This research has far-reaching implications in formulating breeding programs and the development of vaccine against ticks and tick-borne diseases (TTBDs) as well as strategies for the management of resistant ticks. [ABSTRACT FROM AUTHOR]

total of 140 fully engorged adult female ticks were included for the present study. Out of this, 20 ticks were used for performing larval packet test (LPT) and remaining 120 ticks were used in adult immersion test (AIT). Polyherbal aqueous formulation consisting of paste of 10 gm each of Garlic pearls (Allium sativum), Tobacco leaves (Nicotiana tabacum), Tulsi leaves (Ocimum tenuiflorum), Lantana camara leaves (Shrub verbena), Sweet flag rhizome (Acorus calamus), and 20 gm each of Neem leaves (Azadirachta indica) and Turmeric powder (Curcuma longa) was used as acaricidal agent in the present study. The paste was dissolved in one liter of water and strained. In AIT, polyherbal formulation exhibited notable inhibition of oviposition and adult tick mortality. Furthermore, In LPT, it demonstrated increased effectiveness on R. microplus larvae from the Mhow region, resulting in a higher mean percent mortality. These findings highlight the promising potential of the polyherbal formulation as a potent acaricidal agent in tick control strategies. [ABSTRACT FROM AUTHOR]

Copyright of Revista Colombiana de Ciencias Hortícolas is the property of Revista Colombiana de Ciencias Horticolas and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Objective:To study the species of ticks found on cattle in Hainan and the prevalence of Anaplasma carried by these ticks. Methods:This study selected nine counties and cities in the central and northern parts of Hainan as sampling points to collect tick samples from cattle. Tick species were identified through morphological observation and molecular biological techniques. The presence of Anaplasma pathogens was detected using PCR with 16S rRNA, groEL, and gltA as target genes. Phylogenetic analysis methods were further employed to reveal the interspecies relationships of Anaplasma carried by ticks on cattle in Hainan. Results:A total of 335 ticks were collected in this study, including 44 Rhipicephalus sanguineus and 291 Rhipicephalus microplus. PCR results indicated the presence of Candidatus Anaplasma boleense and Anaplasma marginale in the ticks, with positivity rates of 0.60% (2/335) and 0.90% (3/335), respectively. Phylogenetic analysis showed that the Anaplasma obtained in this experiment were homologous to known Anaplasma species. Conclusion:The dominant tick species on cattle in Hainan is Rhipicephalus microplus. The ticks were found to carry Anaplasma pathogens, and this study provides important data support for the prevention and treatment of Anaplasma diseases in the region. [ABSTRACT FROM AUTHOR]

This study aimed to investigate seven outbreaks of A. marginale infection in two regions of Brazil, affecting taurine, zebu, and crossbred cattle. We assessed the possible causes, treatment measures, and genetic diversity of A. marginale. These outbreaks occurred in two states (Goiás: outbreaks 1–7; Mato Grosso do Sul: outbreak 3), breeds (Holstein, Nellore, and crossbreed), age groups (beef cattle: 18–25 days old and 7–8 months; dairy cattle: 18–25 days old, 13–14 months, and cow after the first birth) and rearing systems (feedlot, pasture, pen in a wood shaving bedding system and compost bedded-pack barns). Metaphylactic or prophylactic treatments varied according to outbreak (imidocarb dipropionate: outbreaks 1–4 and 6; enrofloxacin: outbreaks 5 and 7; diminazene diaceturate: outbreak 5). In outbreaks 6 and 7, the packed cell volume was monitored. In all outbreaks, the practice of needle/syringe sharing was discontinued. For outbreaks 1–3, clinical signs and mortality (range, 4.8–13.3%) occurred 36–45 days after entry into the feedlot. In outbreak 4, A. marginale was diagnosed in 66.2% of the calves (bacteremia, 0-4.5%), with a mortality of 8.6%. Among nursing calves aged 60 days during outbreak 5, 53.8% were infected with A. marginale, with average bacteremia of 2.7% (range, 0-21.3%), and a mortality of 13.8%. In dairy heifers aged 14 months, raised in paddocks lacking vegetation cover and infested with R. microplus, then transitioned to a rotational grazing system also infested with R. microplus, the A. marginale bacteremia ranged from 3.2 to 6.7%, with a mortality of 20%. Before monitoring during outbreak 7, the mortality was 17.9%, but no further deaths were observed after monitoring initiation. In conclusion, possible causes triggering the outbreaks included primary tick infestation, needle/syringe sharing, and stress factors which may have affected the immunological statues of animals in the feedlots. Control measures performed in all outbreaks were effective. The partial msp4 gene sequences of A. marginale generated herein belonged to two haplotypes, but further research would be needed to investigate if this finding has any clinical significance. [ABSTRACT FROM AUTHOR]

Through a collaborative effort across six Sub-Saharan African countries, using recognized international assessment techniques, 23 stocks of three tick species (Rhipicephalus microplus, Rhipicephalus appendiculatus and Amblyomma variegatum) of economic importance for rural small holder farming communities from East and West Africa were collected from cattle, and evaluated in in vitro larval packet tests (LPT). The results demonstrated medium to high resistance to chlorfenvinphos and amitraz across species. Rhipicephalus microplus demonstrated high level alpha-cypermethrin and cypermethrin resistance. Stocks of A. variegatum (West Africa) and R. appendiculatus (Uganda) demonstrated medium level ivermectin resistance.The four least susceptible stocks (East and West African R. microplus, A. variegatum and R. appendiculatus) were taken into in vivo controlled cattle studies where fipronil was found effective against West and East African R. microplus isolates although persistent efficacy failed to reach 90%. Cymiazole and cypermethrin, and ivermectin based acaricides were partially effective against R. microplus without persistent efficacy. Flumethrin spray-on killed A. variegatum within 72 h for up to 10 days posttreatment, however product application was directly to tick attachment sites, which may be impractical under field conditions. A flumethrin pour-on formulation on goats provided persistent efficacy against A. variegatum for up to one-month. Therapeutic control was achieved against R. appendiculatus through weekly spraying cattle with flumethrin, amitraz or combined cymiazole and cypermethrin. A fipronil pour-on product offered four-week residual control against R. appendiculatus (with slow onset of action).Few studies have assessed and directly compared acaricidal activity in vitro and in vivo. There was some discordance between efficacy indicated by LPT and in vivo results. This observation calls for more research into accurate and affordable assessment methods for acaricide resistance.No single active or product was effective against all three tick species, emphasising the need for the development of alternative integrated tick management solutions.

Abstract Background In 2022, fluralaner was launched on the market for use in the control of the cattle tick Rhipicephalus microplus after showing 100% efficacy in registration trials against the causative agents of cattle tick fever (TFAs). The aim of the present study was to determine whether a strategic control regimen against R. microplus using fluralaner (FLU) in Holstein calves grazing in a tropical region would alter the enzootic stability status of cattle tick fever, triggering outbreaks in these animals up to 22 months age. Methods In this study, a group of calves treated with FLU was compared with a control group treated with the regimen currently being used on the farm, which consisted of the fipronil + fluazuron formulation (FIFLUA). In the first experiment, the efficacy of the FIFLUA pour-on formulation was evaluated in a field study. In the second experiment, which lasted 550 days, two experimental groups (n = 30/group) of Holstein calves naturally infested with R. microplus were analyzed. Calves aged 4 to 10 months received either a specific treatment regimen with FLU (experimental group) or FIFLUA (control group). During this period, tick counts, animal weight measurement, feces collection (to determine eggs and oocysts per gram of feces), tick fever monitoring, blood smears (to ascertain enzootic stability of the herd), PCR testing for TFAs and serology (indirect enzyme-linked immunosorbent assay [iELISA]) were performed. All calves were evaluated for signs of tick fever between ages 11 and 22 months. Results FIFLUA showed an acaricidal efficacy of > 90% from post-treatment days 14 to 35. Regarding treatments against the TFAs, the average number of treatments was similar between groups, but animals treated with FLU had a smaller reduction in packed cell volume on some of the evaluation dates of the second and third treatment against TFAs. In calves aged 10 months in the FLU group, B. bovis was not detected by PCR (0/15 samples), 40% of the samples had antibody titers and 33% (10/30) of the samples had positive blood smears. Regarding B. bigemina, > 86% of the samples in both groups tested positive for B. bigemina DNA and antibodies; there was no difference in the antibody titers between the groups. There were no clinical cases of cattle tick fever in calves aged 11 to 22 months. Conclusions In comparison with the control treatment, the strategic control regimen against R. microplus with FLU that was implemented in the present study did not negatively affect the enzootic stability status of A. marginale and B. bigemina in the herd up to 22 months of age. The enzootic stability status of B. bovis was not reached by either group. These results likely represent a characteristic of the local tick population, so further studies should be performed. Graphical Abstract

Interactions within the tick microbiome involving symbionts, commensals, and tick‐borne pathogens (TBPs) play a pivotal role in disease ecology. This study explored temporal changes in the microbiome of Rhipicephalus microplus, an important cattle tick vector, focusing on its interaction with Anaplasma marginale. To overcome limitations inherent in sampling methods relying on questing ticks, which may not consistently reflect pathogen presence due to variations in exposure to infected hosts in nature, our study focused on ticks fed on chronically infected cattle. This approach ensures continuous pathogen exposure, providing a more comprehensive understanding of the nesting patterns of A. marginale in the R. microplus microbiome. Using next‐generation sequencing, microbiome dynamics were characterized over 2 years, revealing significant shifts in diversity, composition, and abundance. Anaplasma marginale exhibited varying associations, with its increased abundance correlating with reduced microbial diversity. Co‐occurrence networks demonstrated Anaplasma's evolving role, transitioning from diverse connections to keystone taxa status. An integrative approach involving in silico node removal unveils the impact of Anaplasma on network stability, highlighting its role in conferring robustness to the microbial community. This study provides insights into the intricate interplay between the tick microbiome and A. marginale, shedding light on potential avenues for controlling bovine anaplasmosis through microbiome manipulation. [ABSTRACT FROM AUTHOR]

Copyright of Revista Cientifica de la Facultade de Veterinaria is the property of Universidad del Zulia, Facultad de Ciencias Veterinarias and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Acaricides are the most widely used method to control the cattle tick Rhipicephalus microplus. However, its use increases production costs, contaminates food and the environment, and directly affects animal and human health. The intensive use of chemical control has resulted in the selection of genes associated with resistance to acaricides, and consumers are increasingly less tolerant of food contamination. This scenario has increased the interest of different research groups around the world for anti-tick vaccine development, in order to reduce the environmental impact, the presence of residues in food, and the harmful effects on animal and human health. There is enough evidence that vaccination with tick antigens induces protection against tick infestations, reducing tick populations and acaricide treatments. Despite the need for an anti-tick vaccine in Mexico, vaccination against ticks has been limited to one vaccine that is used in some regions. The aim of this review is to contribute to the discussion on tick control issues and provide a reference for readers interested in the importance of using anti-tick vaccines encouraging concerted action on the part of Mexican animal health authorities, livestock organizations, cattle producers, and academics. Therefore, it is suggested that an anti-tick vaccine should be included as a part of an integrated tick management program in Mexico. [ABSTRACT FROM AUTHOR]

In Ecuador, the main tick species affecting cattle are Rhipicephalus microplus and Amblyomma cajennense sensu lato. Understanding their spatial distribution is crucial. To assess their distribution, data from 2895 farms visited between 2012 and 2017 were utilized. Ticks were collected during animal inspections, with each farm's location georeferenced. Bioclimatic variables and vapor pressure deficit data were obtained from Climatologies at High resolution for the Earth´s Land Surface Areas (CHELSA) dataset. They were overlaid to develop predictive maps for each species using Random Forest (RF) models. The cross-validation results for RF prediction models showed high accuracy for both R. microplus and A. cajennense s.l. presence with values of accuracy = 0.97 and 0.98, sensitivity = 0.96 and 0.99, and specificity = 0.96 and 0.93, respectively. A carefully selected subset of bioclimatic variables was used to describe the presence of each tick species. Higher levels of precipitation had positive effect on the presence of R. microplus but a negative effect on A. cajennense s.l. In contrast, isothermality (BIO3) was more important for the presence of A. cajennense s.l. compared to R. microplus. As a result, R. microplus had a broader distribution across the country, while A. cajennense s.l. was mainly found in coastal areas with evident seasonality. The coexistence of both species in some regions could be attributed to transitional zones, whereas high altitudes limited tick presence. This information can aid in developing appropriate tick management plans, particularly considering A. cajennense s.l.'s broad host range species and R. microplus's specificity for cattle. Moreover, the predictive models can identify areas at risk of associated challenging hemoparasite, requiring special attention and mitigation measures. [ABSTRACT FROM AUTHOR]

Background: In 2022, fluralaner was launched on the market for use in the control of the cattle tick Rhipicephalus microplus after showing 100% efficacy in registration trials against the causative agents of cattle tick fever (TFAs). The aim of the present study was to determine whether a strategic control regimen against R. microplus using fluralaner (FLU) in Holstein calves grazing in a tropical region would alter the enzootic stability status of cattle tick fever, triggering outbreaks in these animals up to 22 months age. Methods: In this study, a group of calves treated with FLU was compared with a control group treated with the regimen currently being used on the farm, which consisted of the fipronil + fluazuron formulation (FIFLUA). In the first experiment, the efficacy of the FIFLUA pour-on formulation was evaluated in a field study. In the second experiment, which lasted 550 days, two experimental groups (n = 30/group) of Holstein calves naturally infested with R. microplus were analyzed. Calves aged 4 to 10 months received either a specific treatment regimen with FLU (experimental group) or FIFLUA (control group). During this period, tick counts, animal weight measurement, feces collection (to determine eggs and oocysts per gram of feces), tick fever monitoring, blood smears (to ascertain enzootic stability of the herd), PCR testing for TFAs and serology (indirect enzyme-linked immunosorbent assay [iELISA]) were performed. All calves were evaluated for signs of tick fever between ages 11 and 22 months. Results: FIFLUA showed an acaricidal efficacy of > 90% from post-treatment days 14 to 35. Regarding treatments against the TFAs, the average number of treatments was similar between groups, but animals treated with FLU had a smaller reduction in packed cell volume on some of the evaluation dates of the second and third treatment against TFAs. In calves aged 10 months in the FLU group, B. bovis was not detected by PCR (0/15 samples), 40% of the samples had antibody titers and 33% (10/30) of the samples had positive blood smears. Regarding B. bigemina, > 86% of the samples in both groups tested positive for B. bigemina DNA and antibodies; there was no difference in the antibody titers between the groups. There were no clinical cases of cattle tick fever in calves aged 11 to 22 months. Conclusions: In comparison with the control treatment, the strategic control regimen against R. microplus with FLU that was implemented in the present study did not negatively affect the enzootic stability status of A. marginale and B. bigemina in the herd up to 22 months of age. The enzootic stability status of B. bovis was not reached by either group. These results likely represent a characteristic of the local tick population, so further studies should be performed. [ABSTRACT FROM AUTHOR]

Rhipicephalus (Boophilus) microplus is a hard tick endemic in livestock-growing regions and causes economic losses in the largest beef-producing countries, including Brazil, Mexico, Argentina, Australia and Uruguay. The use of chemical acaricides is still the main strategy to control R. microplus infestations. Nevertheless, immunological control of R. microplus with an anti-tick vaccine is a suitable alternative and has manifold advantages because it can avoid drug-resistance and the presence of acaricide residues in milk, beef and in the environment. Indeed, vaccines based on the Bm86 antigen have had relative commercial and technical success to control R. microplus in some regions. Although, the efficacy of such vaccines varies among tick populations and is insufficient to provide an acceptable level of protection. Therefore, the need to search for better antigens is impelling. This review focused on the restrictions imposed on the use of acaricides in Brazil and in the European Union, as well as on the impacts of Bm86-based vaccines on R. microplus control. The efficacy of experimental anti-tick vaccines (based on subolesin, glutathione S-transferase, ferritin 2; voltage-dependent anion channel; aquaporin, 60 S acidic ribosomal protein, metalloprotease and trypsin) that can elicit an immune response against the physiological functions of various ticks is discussed. [ABSTRACT FROM AUTHOR]

[Objective] The aim of the study is to establish the microRNA library of Rhipicephalus microplus, to identify the species of microRNA including the library, to analyze the secondary and tertiary structure of Vg-2 protein regulated by miR-275, and to predict the signal peptides, transmembrane domain, phosphorylation and glycosylation sites, and to dominant epitopes of Vg-2 protein. [Method] The adult female R. microplus was used as sample. The microRNA library of R. microplus was established by using the high-throughput sequencing, and the software miRDP and miRBase database were used to identify the species of microRNA including this library. The online software EXPASY, PRABI and SWISS-MODEL were used to analyze the physical and chemical properties and to infer the secondary and tertiary structure of Vg-2 protein regulated by miR-275. The online software SignalP 5.0, TMHMM, NetPhos 3.1 and NETCGlye 1.0 were used to detect the signal peptides, transmembrane domain, phosphorylation and glycosylation sites of Vg-2 protein, and the software ABCpred Prediction, Scratch, IEDB and NetCTL were used to predict the dominant antigen epitopes of Vg-2 protein in B and T cells. (Result) Results of our study showed that a microRNA library including total of 383 microRNAs was established, 12 of which microRNAs were identified and annotated, 371 of which microRNAs were newfound, and 85 microRNAs had the rich contents among these microRNAs. The length of the Vg-2 gene sequence of R. microplus was 5040 bp, and this gene totally encoded 1679 amino acids. Vg-2 protein was a hydrophilic acid protein that was 51.98 kDa in molecular size, and its theoretical isoelectric point (pl) was 6.08. Vg-2 protein used ẞsheet as its major structural components. There were 268 phosphate sites and 20 glycosylation sites, but was no signal peptide and transmembrane domain in the amino acids sequence of Vg-2 protein. Vg-2 protein had 58 B cell dominant antigen epitopes and 8 T cell dominant antigen epitopes. [Conclusion] There are 383 microRNAs in the established microRNA library of the adult bloody female R. microplus, and the Vg-2 protein regulated by miR-275 is a hydrophilic acid protein with dominant antigen epitopes. Vg-2 protein with the good antigenicity and immunogenicity is an ideal target for the future research and development of vaccine against R. microplus. [ABSTRACT FROM AUTHOR]

Ticks are competent vectors of a wide range of pathogens. They are of veterinary and public health importance as they affect both animal and human health. Transhumance and the transboundary movements of cattle within the West African Sub-region have facilitated the spread of ticks which threatens the introduction of invasive species. Currently, Rhipicephalus microplus have been identified in the Upper East Region of Ghana which could mean a wider distribution of the species across the country due to livestock trade. This study focused on three sites in the Greater Accra Region, which serves as the gateway to receiving most of the cattle transported from the northern regions of Ghana. Ticks were sampled from August 2022 in the wet season to January 2023 in the dry season. Three tick genera were identified: Amblyomma (19.5%), Hyalomma (1.1%), and Rhipicephalus (79.3%) from the 1,489 feeding ticks collected from cattle. Furthermore, Rhipicephalus microplus, Hyalomma rufipes and Amblyomma variegatum were identified molecularly using primers that target the mitochondrial COI gene. There was a significant association between the tick species and seasons (p < 0.001). Finding R. microplus in this study indicates the extent of the spread of this invasive tick species in Ghana and highlights the need for efficient surveillance systems and control measures within the country. [ABSTRACT FROM AUTHOR]

Rhipicephalus (Boophilus) microplus, also known as the cattle tick, causes severe parasitism and transmits different pathogens to vertebrate hosts, leading to massive economic losses. In the present study, we performed a functional characterization of a ribosomal protein from R. microplus to investigate its importance in blood feeding, egg production and viability. Ribosomal protein S18 (RPS18) is part of the 40S subunit, associated with 18S rRNA, and has been previously pointed to have a secondary role in different organisms. Rhipicephalus microplus RPS18 (RmRPS18) gene expression levels were modulated in female salivary glands during blood feeding. Moreover, mRNA levels in this tissue were 10 times higher than those in the midgut of fully engorged female ticks. Additionally, recombinant RmRPS18 was recognized by IgG antibodies from sera of cattle naturally or experimentally infested with ticks. RNAi-mediated knockdown of the RmRPS18 gene was performed in fully engorged females, leading to a significant (29 %) decrease in egg production. Additionally, egg hatching was completely impaired, suggesting that no viable eggs were produced by the RmRPS18-silenced group. Furthermore, antimicrobial assays revealed inhibitory activities against gram-negative Escherichia coli and gram-positive Staphylococcus aureus bacteria, affecting bacterial growth. Data presented here show the important role of RmRPS18 in tick physiology and suggest that RmRPS18 can be a potential target for the development of novel strategies for tick control.

En este estudio, los archivos ab1 obtenidos de la secuenciación Sanger (hacia adelante y hacia atrás) se utilizaron para realizar el ensamblaje y análisis de la secuencia. Para ello se utilizó el software Staden Package (versión 2.0b10), el cual consta de dos programas: Pregap4 y Gap4. Pregap4 fue responsable del análisis de calidad y la preparación de datos, mientras que Gap4 realizó el ensamblaje, la verificación, el análisis de pares de lectura, la edición contig y el cálculo de confianza de la secuencia de consenso. Se utilizó BLASTn para identificar posibles homólogos (Babesia bovis y B. bigemina). La secuenciación basada en secuencias del gen 18S de B. bigemina, utilizando los oligonucleótidos PIRO A For: (5'–TACCCAATCCTGACACACAGGG–3') y PIRO B (5'–TTAAATACACGAATGCCCCCCCAAC–3'), mostrando una banda de aproximadamente 393 pb, reveló la distribución nucleótica de una cepa designada como 4623Ba.bi_GIR–E, de B. bigemina. El producto produjo una secuencia de 369 pb (>H230420–007_C05_46_Oligo1.ab1) y 371 pb (>H230420–007_I07_46_Oligo2.ab1). B. bigemina fue aislada de sangre periférica de ganado mestizo infectado, positivo a prueba de Giemsa, PCR–RFLP y qRT–PCR, del municipio de Girón en la provincia del Azuay, Ecuador, ubicado a más de 2.000 metros sobre el nivel del mar, el cual comparte 99,72 % de homología con varias secuencias de B. bigemina reportadas en Ecuador, países latinoamericanos como Colombia, Brasil, revelando posibles orígenes del patógeno y, con las secuencias de B. bigemina publicadas aisladas en latitudes extracontinentales, corroborando así la estabilidad genómica del parásito.

Abstract Rhipicephalus microplus one of the ectoparasites with the most significant impact on livestock health and the economy in Ecuador and globally. Controlling ticks through chemical means has been demonstrated to be ineffective, resulting in acaricide resistance and increasing costs and health problems in tropical and subtropical livestock. Several tick control alternatives have been investigated to date, showing promising results under laboratory conditions but not in field applications. The use of multiple control alternatives in a comprehensive management plan for tick control has proven to be effective in reducing tick infestation. The objective of this study was to determine the effectiveness of immunization with the GavacⓇ vaccine and its effect on the rational use of acaricides. The study aimed to establish the impact of immunization on the biotic potential of Rhipicephalus microplus, the level of infestation, and the frequency of acaricidal baths. In a pilot farm, 176 bovines were vaccinated, and 30 animals were observed every 15 days for eight months, resulting in 18 observations. Observationally, a significant reduction in tick load on animals was identified, as well as a reduction in the use of acaricides by less than 10% (1 bath) compared to the farm's estimated use. On average, acaricidal baths were administered 23 days after vaccination. The study found a statistically significant decrease in the number of ticks on the animals, the weight of the eggs, and their hatching percentage after the inclusion of the vaccination program on the farm. However, no statistically significant effect on the weight of engorged ticks was observed. In conclusion, the GavacⓇ vaccine has a positive observational effect on controlling the presence of ticks in animals and a negative effect on their reproductive aspects.

Semiochemical assisted tick control is a novel, promising alternate tick control perspective which can be utilised for controlling tick populations both on and off the host. In the present study, optimal concentrations of synthetic analogues of assembly pheromone (AP) viz., guanine, adenine and xanthine were encapsulated in calcium alginate microparticles. Qualitative analysis of encapsulation of AP within the beads was performed by Fourier Transform Infra-Red Spectroscopy (FTIR). Test beads with AP-deltamethrin combination in alginate microparticles, pheromone control, acaricide control and polymer control beads were prepared. In vitro Petri-dish bioassay was performed for evaluating the responses of unfed larvae and partially fed adults of Rhipicephalus annulatus and Rhipicephalus microplus ticks to the test and control microparticles. Behavioural responses like attraction, cessation of kinetic activity, clustering, sluggishness and mortality of ticks were recorded at 10 min, 30 min, 2h and 24 h post exposure intervals. Larvae and adult stages of both Rhipicephalus spp. exhibited attraction and clustering on exposure to AP microparticles. Statistical analysis revealed a highly significant difference in the number of ticks that were attracted to pheromone control as compared to polymer control. In test plates more than 70 per cent ticks were found dead within 30 min post exposure and cent per cent mortality of ticks was recorded at 2 h post exposure period with test microparticles. There was highly significant difference in the number of ticks that were found dead with test beads as compared to acaricide control. Slow and steady increase in mortality was recorded with acaricide control beads while none of the ticks were found dead on exposure to pheromone control beads. Assembly pheromone-acaricide beads were very effective in controlling ticks in vitro as compared to using only AP or only acaricide. [ABSTRACT FROM AUTHOR]

Rhipicephalus (Boophilus) microplus, an invasive species to Africa, and the endemic R. (B.) decoloratus are of high economic importance in the cattle industry. Invasion of the alien species in South Africa has mostly been reported for traditional communal grazing areas where it seemed to be rapid and, in some cases, even replaced the native species. The alien species is also assumed to already be resistant to acaricides upon invasion. The presence of R. (B.) microplus on commercial farms was therefore investigated and resistance screening of both species to field concentrations of cypermethrin, amitraz, and chlorfenvinphos was determined by means of the larval immersion test. Results showed that only 3.7% (of 383) tick collections submitted were R. (B.) microplus populations. A further 1.6% (of 383) showed co-existence of the two species. Comparing the level of resistance to the acaricides between the two species indicated a mean phenotypic resistance of 66.2 and 26.5% of R. (B.) decoloratus populations to cypermethrin and amitraz, respectively. This was significantly lower for R. (B.) microplus, with 23.0 and 4.1% of its populations resistant to cypermethrin and amitraz, respectively. Closed commercial farming areas seemed to have a preventative advantage for the invasion of R. (B.) microplus and displacement of R. (B.) decoloratus by R. (B.) microplus. Regular monitoring of these two species may be of high importance to prevent unnecessary financial losses due to insufficient control and increased awareness of the threat of Asiatic babesiosis vectored by R. (B.) microplus. [ABSTRACT FROM AUTHOR]

Copyright of China Tropical Medicine is the property of China Tropical Medicine Editorial Office and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Analysis of the tick microbiome can help understand tick–symbiont interactions and identify undiscovered pathogens, which may aid in implementing control of ticks and tick-borne diseases. The tropical cattle tick Rhipicephalus microplus is a widespread ectoparasite of cattle in the Philippines, negatively affecting animal productivity and health. This study characterized the bacterial community of R. microplus from Luzon, Philippines, through next-generation sequencing of 16s rRNA. DNA was extracted from 45 partially engorged female ticks from nine provinces. The DNA samples were pooled per province and then sequenced and analyzed using an open-source bioinformatics platform. In total, 667 operational taxonomic units (OTUs) were identified. The ticks in all nine provinces were found to have Coxiella, Corynebacterium, Staphylococcus, and Acinetobacter. Basic local alignment search tool (BLAST) analysis revealed the presence of known pathogens of cattle, such as Bartonella, Ehrlichia minasensis, and Dermatophilus congolensis. The tick samples from Laguna, Quezon, and Batangas had the most diverse bacterial species, whereas the tick samples from Ilocos Norte had the lowest diversity. Similarities in the composition of the bacterial community in ticks from provinces near each other were also observed. This is the first study on metagenomic analysis of cattle ticks in the Philippines, providing new insights that may be useful for controlling ticks and tick-borne diseases. [ABSTRACT FROM AUTHOR]

This study addresses the variability of the mitochondrial cytochrome oxidase subunit I (COI) and 16S rDNA (16S), and nuclear internal transcriber spacer ITS2 (ITS2) genes in a set of field-collected samples of the cattle tick, Rhipicephalus microplus (Canestrini, 1888), and in geo-referenced sequences obtained from GenBank. Since the tick is currently considered to be a complex of cryptic taxa in several regions of the world, the main aims of the study are (i) to provide evidence of the clades of the tick present in the Neotropics, (ii) to explore if there is an effect of climate traits on the divergence rates of the target genes, and (iii) to check for a relationship between geographical and genetic distance among populations (the closest, the most similar, meaning for slow spread). We included published sequences of Rhipicephalus annulatus (Nearctic, Afrotropical, and Mediterranean) and R. microplus (Afrotropical, Indomalayan) to fully characterize the Neotropical populations (total: 74 16S, 44 COI, and 49 ITS2 sequences included in the analysis). Only the clade A of R. microplus spread in the Nearctic–Neotropics. Both the K and Lambda's statistics, two measures of phylogenetic signal, support low divergence rates of the tested genes in populations of R. microplus in the Neotropics. These tests demonstrate that genetic diversity of the continental populations does not correlate either with the geographic distance among samples or with environmental variables. The low variability of these genes may be due to a combination of factors like (i) the recent introduction of the tick in the Neotropics, (ii) a large, effective, and fast exchange of populations, and (iii) a low effect of climate on the evolution rates of the target genes. These results have implications for the ecological studies and control of cattle tick infestations. [ABSTRACT FROM AUTHOR]

Abstract Interactions within the tick microbiome involving symbionts, commensals, and tick‐borne pathogens (TBPs) play a pivotal role in disease ecology. This study explored temporal changes in the microbiome of Rhipicephalus microplus, an important cattle tick vector, focusing on its interaction with Anaplasma marginale. To overcome limitations inherent in sampling methods relying on questing ticks, which may not consistently reflect pathogen presence due to variations in exposure to infected hosts in nature, our study focused on ticks fed on chronically infected cattle. This approach ensures continuous pathogen exposure, providing a more comprehensive understanding of the nesting patterns of A. marginale in the R. microplus microbiome. Using next‐generation sequencing, microbiome dynamics were characterized over 2 years, revealing significant shifts in diversity, composition, and abundance. Anaplasma marginale exhibited varying associations, with its increased abundance correlating with reduced microbial diversity. Co‐occurrence networks demonstrated Anaplasma's evolving role, transitioning from diverse connections to keystone taxa status. An integrative approach involving in silico node removal unveils the impact of Anaplasma on network stability, highlighting its role in conferring robustness to the microbial community. This study provides insights into the intricate interplay between the tick microbiome and A. marginale, shedding light on potential avenues for controlling bovine anaplasmosis through microbiome manipulation.

Rhipicephalus (Boophilus) microplus is one of the most successful ticks infesting cattle around the world. This highly-invasive species transmits cattle parasites that cause cattle fever leading to a high socio-economic burden. Tick eradication programs have often failed, due to the development of acaricide resistance. Here we characterize acaricide resistance in a large number of tick isolates from regions in South Africa (KwaZulu Natal, Mpumalanga, Western & Eastern Cape provinces) and two Brazilian regions.By means of Larval Packet Tests (LPT's) acaricide resistance was evaluated against five commonly used acaricides (chlorfenvinphos, fipronil, deltamethrin, amitraz, and ivermectin). Furthermore, the coding region containing the knock down resistance (kdr) mutation, known to result in pyrethroid resistance, was sequenced.Resistance to at least one acaricide class was reported in each of the five regions, and a high proportion of tick isolates exhibited multi-resistance to at least two acaricide classes (range: 22.2–80.0%). Furthermore, resistance ratios (RR) showed high spatial variation (intercontinental, as well as regional) but low regional spatial autocorrelation. Previous and current acaricide use correlated with current RR, and several combinations of acaricide RR were positively correlated. Moreover, fipronil resistance tended to be higher in farms with more intense acaricide use. The kdr-mutations provided the ticks a fitness advantage under the selection pressure of synthetic pyrethroids based on population (kdr-allele frequency) and individual level data (genotypes).The data show the threat of acaricide (multi-)resistance is high in Brazil and South Africa, but acaricide specific levels need to be assessed locally. For this purpose, gathering complementary molecular information on mutations that underlie resistance can reduce costs and expedite necessary actions. In an era of human-caused habitat alterations, implementing molecular data-driven programs becomes essential in overcoming tick-induced socio-economic losses.

Abstract Background This study describes the effectiveness of a novel active pharmaceutical ingredient, fluralaner (isoxazoline class), against important ectoparasites infesting cattle in Brazil. Methods A total of 13 studies involving a 5% fluralaner-based pour-on formulation (Exzolt 5%; further referred to as Exzolt) were conducted. Specifically, the effectiveness of this formulation was studied against Rhipicephalus microplus (6 studies), Cochliomyia hominivorax larvae (4 studies), Dermatobia hominis larvae (1 study) and Haematobia irritans flies (2 studies). Results The therapeutic efficacy of Exzolt was found to exceed 98% at 4 days post treatment (DPT), while persistent efficacy (> 90% efficacy) against repeated infestations of R. microplus was observed for up to 79 DPT. In field studies, ≥ 98% therapeutic efficacy was demonstrated at all study sites by 7 DPT, and a persistent efficacy (> 90% efficacy) was observed for 42, 49 or 56 DPT. Exzolt prevented C. hominivorax eggs from developing to the larval stage, thus mitigating the development of myiasis in cattle naturally and artificially infested with this screworm. The efficacy of Exzolt against D. hominis larvae was 98% at 3 DPT, while persistent efficacy (> 90% effectiveness) was found to last for up to 70 DPT. Against H. irritans, Exzolt showed therapeutic efficacy (≥ 90%) within the first day of treatment at both study sites, while persistent efficacy (≥ 90%) was observed for 7 DPT at one site and for 21 DPT at the other site. Conclusions Overall, the results from these studies confirm that Exzolt is therapeutically efficacious against the most important ectoparasites infesting cattle in Brazil. The novel active pharmaceutical ingredient, fluralaner, provides a new treatment option for farmers to control cattle ectoparasites, especially where there is resistance to other chemical classes. In addition, an effective control of ectoparasites will improve overall cattle health and well-being as well as production. Graphical Abstract

Abstract Many ixodid species on the South Texas coastal plain can transmit pathogens to their hosts. Substantial areas are dominated by gulf cordgrass, Spartina spartinae (Trin.) Merr. ex Hitch. The S. spartinae habitat was examined in terms of abiotic and biotic factors that likely impinge upon ixodids using the plant for questing. Natural enemies, temperature, humidity, and plant structure were investigated as possible mortality factors and improving ixodid survival. Spartina spartinae (soil and foliage) harbored few natural enemies of ixodids, and soil salinity was nonlethal. Conditions were cooler and more humid inside S. spartinae clumps than in the canopies; hence, questing ixodids can rehydrate inside the clump when threatened by desiccation. Leaves were mostly “V” shaped in cooler months and, during warm months, the tightly folded leaf slot predominated, into which larvae crawled. Immature ixodids were more abundant in the concave side of the “V”-shaped leaves than on the exposed convex side. Larvae sought refuge from potential lethal ambient air conditions by entering tight warm season leaf folds. The leaf “V” and fold offer opportunities for rehydration on the leaf without moving to the clump’s base. In addition to five other species collected on the grass, a relatively heavy larval southern cattle fever tick, Rhipicephalus (Boophilus) microplus (Canestrini), population was detected, suggesting that abundances in the South Texas cattle fever tick eradication quarantine zone are increasing and might spread further into Texas.

Abstract A meeting, sponsored by the Bill and Melinda Gates Foundation (BMGF) and organised by Clinglobal, was held at The International Livestock Research Institute (ILRI) in Nairobi, Kenya, from 19th – to 21st October 2022. The meeting assembled a unique group of experts on tick control in Africa. Academia, international agencies (FAO and ILRI), the private Animal Health sector and government veterinary services were represented. The significant outcomes included: (i) a shared commitment to standardisation and improvement of acaricide resistance bioassay protocols, particularly the widely used larval packet test (LPT); (ii) development of novel molecular assays for detecting acaricide resistance; (3) creation of platforms for disseminating acaricide resistance data to farmers, veterinary service providers and veterinary authorities to enable more rational evidence-based control of livestock ticks. Implementation of enhanced control will be facilitated by several recently established networks focused on control of parasites in Africa and globally, whose activities were presented at the meeting. These include a newly launched community of practice on management of livestock ticks, coordinated by FAO, an African module of the World Association for the Advancement of Veterinary Parasitology (WAAVP-AN) and the MAHABA (Managing Animal Health and Acaricides for a Better Africa) initiative of Elanco Animal Health. Graphical Abstract

Abstract Background The majority of the African population lives in rural areas and depends on agriculture for their livelihoods. To increase the productivity and sustainability of their farms, they need access to affordable yield-enhancing inputs of which parasite control is of paramount importance. We therefore determined the status of current tick species with the highest economic impact on cattle by sampling representative numbers of animals in each of seven sub-Saharan countries. Methods Data included tick species’ half-body counts from approximately 120 cattle at each of two districts per country, collected four times in approximately 1 year (to include seasonality). Study sites were chosen in each country to include high cattle density and tick burden. Results East Africa (Ethiopia, Uganda and Tanzania) showed overall a higher diversity and prevalence in tick infestations compared to West African countries (Benin, Burkina Faso, Ghana and Nigeria). In East Africa, Amblyomma variegatum (vector of Ehrlichia ruminantium), Rhipicephalus microplus (Babesia bovis, B. bigemina, Anaplasma marginale), R. evertsi evertsi (A. marginale) and R. appendiculatus (Theileria parva) were the most prevalent tick species of economic importance. While the latter species was absent in West Africa, here both A. variegatum and R. microplus occurred in high numbers. Rhipicephalus microplus had spread to Uganda, infesting half of the cattle sampled. Rhipicephalus microplus is known for its invasive behaviour and displacement of other blue tick species, as observed in other East and West African countries. Individual cattle with higher body weights, as well as males, were more likely to be infested. For six tick species, we found reduced infestation levels when hosts were treated with anti-parasiticides. Conclusions These baseline data allow the determination of possible changes in presence and prevalence of ticks in each of the countries targeted, which is of importance in the light of human-caused climate and habitat alterations or anthropogenic activities. As many of the ticks in this study are vectors of important pathogens, but also, as cattle may act as end hosts for ticks of importance to human health, our study will help a wide range of stakeholders to provide recommendations for tick infestation surveillance and prevention. Graphical abstract

ABSTRACT: Although infestation by Rhipicephalus microplus is mentioned as the cause of death among cattle, there are only studies with artificial infestations in which intense parasitism led to the death of cattle due to severe anemia. This study seems to be the first to describe the epidemiology, clinical-pathological condition, and diagnostic conduct of infestation by R. microplus as the cause of death of European breed calves introduced in shady, enclosed pastures in regions with rainfall prior to the onset of the outbreak. The affected calves presented apathy, anorexia, and anemia and were severely infested by R. microplus. The lethality rate of the outbreak was 36.5%. After the rainy period, the dry season facilitated a decrease in the nutritional status of the affected cattle. The delay in the definitive diagnosis contributed to the economic loss of the farm due to the cost of erroneous treatments and the number of dead cattle. The main factors that contributed to the deaths were climatic, environmental, and individual. This study demonstrates that severe infestations by R. microplus in low-quality pasture-raised calves are fatal and emphasizes the importance of diagnostic tools to reduce the economic loss caused by death due to infestation by ticks.

The ectoparasites Rhipicephalus microplus, Dermatobia hominis, and Haematobia hominis are a major obstacle to livestock productivity, a factor that is aggravated above all by the acquisition of drug resistance to many active ingredients. With the aim of minimizing this phenomenon, four clinical studies were conducted with a new formulation (benzoylphenylurea + organophosphate). In order to assess the anti-ixodid activity, trials were carried out on naturally and experimentally infested cattle. In the former, the carrapaticidal efficacy index was over 90% from the 7º to the 28º DPT (Days post-treatment). In the "Stall test" (artificial infestations), the maximum efficacy rate (100%) was achieved from the 20º to the 47º DPT. The mosquicidal activity of the new formulation against Haematobia irritans (natural infestation) remained above 90% from the 1º to the 14º DPT. It was more than 90% effective against Dermatobia hominis larvae from the 7º to the 21º DPT. Based on the results obtained in the four studies carried out, the unprecedented formulation can be recommended, in the dose and route prescribed, for the treatment and control of external parasites in cattle. [ABSTRACT FROM AUTHOR]

One of the main problems in cattle farming is infestations caused by Rhipicephalus microplus ticks, the most important parasitic species in the cattle industry. Its control is based mainly on the application of ixodicides. However, the excessive and inappropriate use of these products has generated resistant strains. As an alternative, biological control has been proposed as a promising method, as it prevents environmental contamination, promotes the safety of animal products, and contributes to sustainability. For this reason, the objective of the present study was to perform an in vitro evaluation of the ixodicidal effect of two plant extracts of Cinnamomum zeylanicum and Tagetes erecta on R. microplus ticks. The analysis was carried out using the larval immersion technique (LIT) and the adult female immersion technique (AIT), and the morphological damage to the cuticular structure of the ticks was then determined by stereo microscopy. The most significant result was 100 % larval mortality (P<0.05) for the C. zeylanicum extract at a concentration of 6%, presenting evident morphological damage in the cuticular structure. In contrast, T. erecta extract showed no ixodicidal activity. Finally, it is concluded that the plant extract of C. zeylanicum shows efficacy in in vitro tests against R. microplus larvae and may prove useful as an economical and sustainable alternative for tick control. [ABSTRACT FROM AUTHOR]