Search

A phytochemical and biological investigation of the endemic Mascarene Aloes ( Aloe spp.), including A. tormentorii (Marais) L.E.Newton & G.D.Rowley, A. purpurea Lam, A. macra Haw., A. lomatophylloides Balf.f and A. vera (synonym A. barbadensis Mill.), which are used in the traditional folk medicine of the Mascarene Islands, was initiated. Methanolic extracts of the Aloe s under study were analysed using high resolution LC-UV-MS/MS and compounds belonging to the class of anthraquinones, anthrones, chromones and flavone C -glycosides were detected. The Mascarene Aloe s could be distinguished from A. vera by the absence of 2″- O -feruloylaloesin and 7- O -methylaloeresin. GC–MS analysis of monosaccharides revealed the presence of arabinose, fucose, xylose, mannose and galactose in all the Mascarene Aloe s and in A. vera. The crude extracts of all Aloe s analysed displayed antimicrobial activity against Bacillus cereus, Staphylococcus aureus , Escherichia coli and Pseudomonas aeruginosa . Only extracts of A. macra were active against P. aeruginosa and Klebsiella pneumoniae , while none of the Aloe extracts inhibited Propionibacterium acnes. A. macra displayed anti-tyrosinase activity, exhibiting 50% inhibition at 0.95 mg/mL, and extracts of A. purpurea (Mauritius) and A. vera displayed activity in a wound healing-scratch assay. In vitro cytotoxicity screening of crude methanolic extracts of the Aloe s, using the MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) showed that only A. purpurea (Réunion) elicited a modest toxic effect against HL60 cells, with a percentage toxicity of 8.2% ( A. purpurea -Réunion) and none of the Aloe extracts elicited a toxic effect against MRC 5 fibroblast cells at a concentration of 0.1 mg/mL. Mascarene Aloe species possess noteworthy pharmacological attributes associated with their rich phytochemical profiles. [ABSTRACT FROM AUTHOR]

Globally, chilli (Capsicum annuum L.) is one of the most economically important and widely cultivated crop which elicits ethnomedicinal and nutritional potential as well as enhancing the taste and aroma of foods (Ayob et al., 2022; Kiran et al., 2020). Anthracnose disease is regarded as a prime constraint in chilli production, leading to enormous losses in tropical and subtropical countries. In September 2022, chilli fruit displaying sunken, shriveled and dark bown to black lesion with abundant acervuli on the surface was obtained from Flacq, Mauritius. From the symptomatic tissue, small pieces of the diseased tissue were excised, surface-disinfected using 1% sodium hypochlorite, twice rinsed using sterilized distilled water, air-dried and plated on PDA. After 7 days of incubation at room temperature, white to greyish white colony with dense white cottony aerial mycelium was recovered. Out of two isolates, CHF and CH10, the latter was considered for morphological and molecular characterization. The observed conidia (n=30) were unicellular, straight, cylindrical with rounded ends and slight constriction near the centre and had average length and width of 20.5 µm and 6 µm, respectively. For growth rate measurement of the isolate, two 5×5 mm of fungal agar plugs were taken from growing edge of colony, inoculated at centre of individual PDA plate and incubated at room temperature with a natural light/dark cycle. The diameter of the cultures were measured perpendicularly for a period of 7 days and the growth rate was calculated as 7-day average of daily growth (mm day-1). The growth rate of the fungal isolate (CH10) was 13.5 mm day-1 on PDA. Based on the morphological characters, the isolate was classified within the C. gloeosporioides species complex. For precise identification of the isolate, DNA was extracted from fungal mycelium using traditional DNA isolation methods (Ranghoo and Hyde, 2000), followed by PCR amplification and DNA sequencing using primer pairs ITS4/ITS5 (White et al., 1990), GDF/GDR and T1/Bt2b (Gan et al., 2016), respectively. ITS gene sequence (600 bp) confirmed that the isolate was Colletotrichum, with 99.83% similarity to KR704204 while GADPH (277 bp), TUB2 (733 bp) and ApMat (801 bp) gene sequences showed 99.64 to 100% similarity to C. queenslandicum with GenBank reference sequences, KT372374, KU221378 and MG674932 respectively. The gene sequences of isolate CH10 were deposited in GenBank database under the following accession numbers OR681557 (ITS), OR233734 (GADPH), OR475575 (TUB2) and PP622748 (ApMat). Koch's postulates were confirmed by spraying disease-free chilli plants with 10µL of conidial suspension (1 × 106 spores/ml) prepared from 7 days old colony of isolate CH10. Healthy chilli plants inoculated with sterile distilled water served as a negative control experiment. The plants were grown in pots in a moist chamber at 25˚C. After 5 days post-inoculation, anthracnose symptoms were developed on test plants while the control plant remained asymptomatic. The original isolate was successfully recovered from the test fruits, thus fulfilling Koch's postulates. The experiment was repeated thrice and revealed the same results. To the best of our knowledge, this is the first record of C. queenslandicum in Mauritius and is the first time to report anthracnose of chilli caused by this fungus. Colletotrichum queenslandicum has previously been reported in Europe, Mexico, US, Puerto Rico, Australia, Fiji, Brazil, Indonesia and China. Furthermore, the latter was associated with papaya, avocado, cashew, coffee, Persian lime, Licania tomentosa, white mangrove, lychee, mango, Nephelium lappaceum, olive, passionfruit, Dracaena cambodiana and Syzygium australe (Câmara and Vieira, 2022; Shidiq et al., 2024; Wang et al., 2022). This study will allow local farmers training and extension facilities to increase awareness among farmers about this disease-causing agent and allow them to take necessary measures for building up chilli crops resilience against this new and emerging pathogen in Mauritius.

In August 2021, severe leaf blight symptoms were observed on onion ( Allium cepa L. cvs Francia and Askari F1 hybrid) in commercial fields located in Mauritius, namely La Forêt (20°19'56.1"S57°30'04.9"E), St Aubin (20°29'47.0"S57°32'29.4"E) and Chapiron (20°20'46.8"S 57°29'12.8"E). Infected leaves displayed small circular to oblong yellow-pale-brown and spindle shaped lesions which later coalesced and formed necrotic areas with black sporulation. Three fields were selected from each region, and along a W-pattern across the fields a disease incidence ranging 53-93% and a severity of 9-28% were recorded. Ten symptomatic leaves were collected in each region and small pieces of infected tissue were surface disinfected using 1% NaOCl for 2 min, rinsed with sterile distilled water, air-dried, transferred to potato dextrose agar (PDA) and incubated for 7 days at 20°C under a 12-h light/dark cycle. Fungal cultures with uniform appearance forming multi-septated conidia typical of the genus Stemphylium (Simmons 1969) were consistently isolated. Monosporic colony of isolates SVCWLF24/3, SVSSA23/1 and SVCWLMC26/1 developed similar olivaceous green to light and dark grey mycelium with an average daily growth rate of 6.5 mm at 25°C in the dark. Conidiophores were straight, light brown with a distinct swollen apex on which olive brown to dark brown, oblong to ovoid, septate conidia formed with dimensions 16.2-44.7 × 8.0-22.9 μm (av. 29.5 x 14.7 μm; n = 50) typical of Stemphylium vesicarium (Wallr) E.G. Simmons 1969 (Woudenberg et al. 2017). Genomic DNA of the three isolates was extracted from fungal mycelium (Ranghoo and Hyde 2000).. The ITS, cmdA and gapdh genes of the isolates were amplified with primers ITS4/ITS5 (White et al. 1990), CALDF1/CALDR1 (Lawrence et al. 2013) and Gpd1/Gpd2 (Beerbee et al. 1999) and sequenced. Sequences were submitted to GenBank under accession numbers OR131271, ON620213, OR188702 (ITS), OR350623, OR350622, OR166368 (cmdA) and OR684516, OR684517, OR684518 (Gapdh). The BLAST search of the sequences showed 100% similarity with S. vesicarium strain CBS 155.24 under accession numbers KU850555 (ITS), KU850702 (Gapdh) and KU850845 (cmdA) (Woudenberg et al. 2017). Phylogenetic trees inferred from the ITS, cmdA and Gapdh concatenated datasets with the maximum-likelihood algorithm allowed clustering of the isolates within S. vesicarium clade, confirming the morphological identification. Pathogenicity tests were performed using all three isolates, cultured on PDA at 25°C in a 12-h dark/light cycle. Ten 60-day-old onion plants (cv. Francia) were spray inoculated each with 10 ml of conidial suspension (1 × 104/ml) of each isolate while 10 healthy plants sprayed with sterile distilled water served as control. They were incubated in a greenhouse at 25°C with a 12-h photoperiod and > 80% humidity. Necrotic circular lesions appeared on leaves after 7-10 days while control plants remained symptomless. Re-isolations made from symptomatic leaf tissues on PDA consistently yielded cultures with similar morphology as the original isolates, thus fulfilling Koch's postulates. This is the first report of S. vesicarium as the causal agent of leaf blight of onion in Mauritius. It is a re-emerging fungal disease (Hay et al. 2021) with a wide host range threatening local onion production. This finding will contribute to early detection of leaf blight, implementation of surveillance and integrated disease management in affected regions.

Soft corals, recognized as sessile marine invertebrates, rely mainly on chemical, rather than physical defense, by secreting intricate secondary metabolites with plausible pharmaceutical implication. Their ecological niche encompasses a diverse community of symbiotic microorganisms which potentially contribute to the biosynthesis of these bioactive metabolites. The emergence of new viruses and heightened viral resistance underscores the urgency to explore novel pharmacological reservoirs. Thus, marine organisms, notably soft corals and their symbionts, have drawn substantial attention. In this study, the chemical composition of four Mauritian soft corals: Sinularia polydactya , Cespitularia simplex , Lobophytum patulum , and Lobophytum crassum was investigated using LC-MS techniques. Concurrently, Illumina 16S metagenomic sequencing was used to identify the associated bacterial communities in the named soft corals. The presence of unique biologically important compounds and vast microbial communities found therein was further followed up to assess their antiviral effects against SARS-CoV-2 and HPV pseudovirus infection. Strikingly, among the studied soft corals, L. patulum displayed an expansive repertoire of unique metabolites alongside a heightened bacterial consort. Moreover, L. patulum extracts exerted some promising antiviral activity against SARS-CoV-2 and HPV pseudovirus infection, and our findings suggest that L. patulum may have the potential to serve as a therapeutic agent in the prevention of infectious diseases, thereby warranting further investigation.

Norovirus (NOV) and hepatitis A virus (HAV) are human enteric viruses of major concern worldwide. Salad vegetables and molluscan shellfish are highly susceptible to contamination by NOV and HAV and can pose a health threat when consumed raw. The objective of this study was to determine the occurrence of NOV and HAV in lettuce, watercress, tomatoes, and oysters using the enzyme-linked immunosorbent assay and assess the health risks associated with the consumption of these commodities by semiquantitative risk assessment. The occurrence of NOV in vegetables ranked in the following decreasing order: lettuce (36%) > watercress (16%) > tomatoes (4%). However, HAV was more frequently detected in watercress (56%), compared to lettuce or tomatoes (12%). Additionally, NOV was detected in oysters (60%). The risk assessment exercise pointed to a medium-risk score of contracting a foodborne illness of viral origin for consumers eating fresh watercress or oysters. Future research will ascertain the presence of these enteric viruses in a broader range of food commodities., Competing Interests: Conflict of interest: the authors declare that they have no competing interests, and all authors confirm accuracy., (Copyright © 2023, the Author(s).)

Charcoal rot, caused by Macrophomina phaseolina , is an important disease in tropical and subtropical regions which affects a broad range of host plants, including potato ( Solanum tuberosum L.). In this crop, charcoal rot can reduce the marketable quality of tubers (Arora 2012) and cause yield losses up to 88% (Somani 2007). During a survey of a potato field of 'Spunta' cultivar in Goodlands, Mauritius (20°02'28.2"S 57°39'30.4"E) approximately 10% of tubers with grey pigmentation around the lenticels and small water-soaked spots with white dots were observed. These symptoms later advanced to dark brown to black patches on the skin surface, all conforming to typical symptoms of charcoal rot (Arora and Khurana 2004). Fragments of infected and adjacent healthy tissue were cut, thoroughly washed with tap water, surface sterilized for 30 s with 1% sodium hypochlorite (25% bleach), placed on chloramphenicol-amended Potato Dextrose Agar (PDA), and incubated for 5 days in the dark at 25±2oC. From all the inoculated plates, only fast-growing, dark brown, grey to black Macrophomina -like colonies grew and several mono-sclerotial isolates were obtained with uniform morphological features. Following staining with cotton lactophenol dye using the clean slide technique, the isolate 449G-19/M exhibiting typical characteristics of M. phaseolina (Arora and Dhurwe 2019) and forming flattened, globose, black sclerotia with an average diameter of 180 µm (n= 50), was selected and used for further characterization. Identification was confirmed by sequencing of the ITS region of rDNA. Total DNA was extracted directly from the mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions, while PCR amplification and sequencing were performed with primers ITS1-F (Gardes and Bruns 1993) and ITS-4 (White et al. 1990). The nucleotide sequence of the isolate 449G-19/M (Accession No. MW301138) shared 98.28 to 99.80% similarity with over 70 M. phaseolina isolates in GenBank (99.18% with isolate from Zea mays, Accession No. KF531825 (Phillips et al. 2013)). Pathogenicity was tested on 20 healthy tubers which were initially disinfected with 2% sodium hypochlorite for 1 min and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7-day-old cultures of the isolate 449G-19/M near each tuber. Similarly, 10 tubers inoculated with sterile PDA served as a negative control. The plants were maintained in greenhouse conditions, watered daily, and assessed for the presence of symptoms 8 weeks post emergence. All inoculated tubers exhibited charcoal rot on progeny tubers while control plants remained symptomless. Koch's postulates were fulfilled successfully and the fungus recovered from the inoculated plants. Although M. phaseolina was previously observed in Mauritius on groundnut resulting in pre-emergence rot and collar rot (Anonymous 1962), to our knowledge, this is the first report demonstrating charcoal rot on potato tubers caused by M. phaseolina in Mauritius. As the sclerotia can remain in the soil for long periods of time (Arora and Khurana 2004) and with prevailing conditions of global warming, charcoal rot may be a threat for potatoes and other local crops (Somani et al. 2013). This study will sensitize agricultural extension officers on this new disease and calls for routine surveillance to safeguard this crop.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea , has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato ( Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius ; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Potato ( Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

Tomatoes ( Solanum lycopersicum ) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 μm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena , Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.

Introduction: Aloe tormentorii, A. purpurea and A. macra are used as multipurpose folk medicines in Réunion and Mauritius Islands and are mistaken for the introduced Aloe vera., Objective: To compare the phytochemical, antimicrobial and DNA profiles of Aloe endemic to Mauritius and Réunion with the profiles of A. vera. Methodology - Leaf extracts of these Aloe species were analysed using standard phytochemical screening techniques, TLC and by HPLC. These extracts were also assayed for antimicrobial activity using microdilution techniques. Genetic diversity was studied using RAPD markers., Results: Phytochemical and antimicrobial assays and RAPD analysis showed that Mascarene Aloe species were very different from A. vera., Conclusion: This study is the first report highlighting the differences between Aloe sp.p from Mascarene and Aloe vera at the metabolic and genomic level., (Copyright © 2010 John Wiley & Sons, Ltd.)