Search

The present study aimed to generate antibodies against predicted B cell epitopic peptides encoding bAMH for developing different ELISA models. Sandwich ELISA was determined to be an excellent technique for assessing bAMH in bovine plasma based on sensitivity tests. The assay's specificity, sensitivity, inter- and intra-assay CV, recovery %, Lower limit of quantification (LLOQ), and Upper limit of quantification (ULOQ) were determined. The test was selective since it did not bind to AMH-related growth and differentiation factors (LH and FSH) or non-related components (BSA, progesterone). The intra-assay CV was 5.67%, 3.12%, 4.94%, 3.61% and 4.27% for 72.44, 183.11, 368.24, 522.24 and 732.25 pg/ml AMH levels, respectively. At the same time, the inter-assay CV was 8.77%, 7.87%, 4.53%, 5.76% and 6.70% for 79.30, 161.27, 356.30, 569.33 and 798.19 pg/ml AMH levels, respectively. The average (Mean ± SEM) recovery percentages were 88-100%. LLOQ was 5 pg/ml and ULOQ at 50 µg/ml (CV < 20%). In conclusion, we developed a new highly sensitive ELISA against bAMH using epitope specific antibodies., Competing Interests: Conflict of interestThere are no conflicts to declare. The authors declare that they have no conflict of interest and no competing financial interest. An Indian patent entitled “Peptide sequences and epitope specific antibodies for detection of bovine Anti-Mullerian hormone (bAMH)” has been filed with application number 202111038528., (© King Abdulaziz City for Science and Technology 2023. Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.)

Identification of glycomacropeptide (GMP) and β-lactoglobulin (β-lg) present in cheese whey is difficult on SDS-PAGE due to their close proximity during electrophoresis and poor sensitivity of commonly used staining dye 'coomassie brilliant blue' (CBB) towards GMP. A simple method has been developed for the detection of GMP and β-lg by staining acrylamide gel after tricine SDS-PAGE using cationic 'stains all' dye. After staining and destaining major whey proteins, viz. ɑ-lactalbumin (ɑ-la) and β-lg appear red while GMP stains blue. The method can be used for the identification of these macromolecules in cheese whey and the detection of adulteration of milk with rennet whey., (Copyright © 2020 Elsevier Ltd. All rights reserved.)

Huge demand of safe and natural preservatives has opened new area for intensive research on bacteriocins to unravel the novel range of antimicrobial compounds that could efficiently fight off the food-borne pathogens. Since food safety has become an increasingly important international concern, the application of bacteriocins from lactic acid bacteria that target food spoilage/pathogenic bacteria without major adverse effects has received great attention. Different modes of actions of these bacteriocins have been suggested and identified, like pore-forming, inhibition of cell-wall/nucleic acid/protein synthesis. However, development of resistance in the food spoilage and pathogenic bacteria against these bacteriocins is a rising concern. Emergence and spread of mutant strains resistant to bacteriocins is hampering food safety. It has spurred an interest to understand the bacteriocin resistance phenomenon displayed by the food pathogens, which will be helpful in mitigating the resistance problem. Therefore, present review is focused on the different resistance mechanisms adopted by food pathogens to overcome bacteriocin., (Copyright © 2019 Elsevier Ltd. All rights reserved.)

Steviol glycosides (SGs) are non-caloric, natural sweetener obtained from plant Stevia rebaudiana and are used as sugar substitute in foods. The level of SGs in foods should not exceed maximum permissible limit defined by regulatory agencies. Thus analytical methods are required for assay of stevioside (Stev) and rebaudioside A (Reb A), which are two major constituents of SGs, in foods. A method for extraction of Stev and Reb A from dairy viz., flavoured milk, flavoured yoghurt and non-dairy foods viz., carbonated water, jam, chewing gum and estimation of these by HPLC has been described. Extraction of SGs from dairy samples was achieved by treating samples with 20% acetonitrile in presence of Carrez solutions while these can be simply extracted with water from non-dairy samples. Separation and estimation of these two glycosides was achieved on C18 column (length: 4.6 × 250 mm, particle size: 5 μm) using isocratic mobile phase prepared by mixing of acetonitrile and 10 mM sodium phosphate buffer (pH 2.6) in ratio of 32:68 (v/v). Recovery of two SGs was quantitative. Separation and estimation of SGs by HPLC was robust. Limit of detection and limit of quantitation for Reb A in different food was in range from 1.057-1.834 to 3.525-6.114 mg kg -1 while that of Stev was from 1.679-2.912 to 5.596-9.707 mg kg -1 , respectively. Neotame, an artificial sweetener can be used as internal standard for separation of SGs., Competing Interests: Compliance with ethical standardsThe authors declare that they have no conflict of interest.This article does not contain any studies with human participants or animals performed by any of the authors.

Aflatoxin M1 (AFM1) is present in milk of lactating animals fed on aflatoxin B1 contaminated feeds. Aptamers are new emerging ligand molecules and can be employed in assay protocols. Shorter aptamers have several advantages. Untruncated (72-nucleotide long) and truncated (18- to 42-nucleotide long) aptamers were evaluated for AFM1 recognition that was detected by color change in aptamer-conjugated gold nanoparticles in the presence of AFM1. Truncation of 10 aptamers was designed to retain motifs. Untruncated and truncated aptamers recognized AFM1. Binding region on truncated aptamers was predicted by aligning sequences with reported aptamer "ACTGCTAGAGATTTTCCACAT". Aptamer "AFAS3Tr" (ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGA), APM15Tr (CAACGCCAGTCAGTATCTTATATGCTATACTGGCTGGTGTTG), AFA4Tr (AAAA-ACACTATGTAGTGGTGT), AFAM7Tr (CCGGCGGATGCTAATTGCAGAGCAGGTGTGCCGG), and APM6Tr (AAAAATAATTCTAGGTTA) derived from random region of oligonucleotide library had strong homology with 8-nucleotide (ACTGCTAG) sequence at 5 ' end of reported aptamer. Comparison of sequence alignment of each of five truncated aptamers with reported sequence has allowed concluding that CTGCTCTGACGCTG in AFAS3Tr, ACGCCAG in APM15Tr, ACTATGTAG in AFA4Tr, TGCTA in AFAM7Tr, AATTCTAG in APM6Tr, and ACTGCTAG in reported aptamer are probable binding regions in aptamers. Truncated aptamers APM15Tr, AFAS3Tr, AFAM7Tr, APM6Tr, AFA4Tr, and predicted shorter nucleotide sequences offer promise for further exploitation in developing sensitive methods for AFM1 measurement., (© 2017 International Union of Biochemistry and Molecular Biology, Inc.)

A lateral flow based detection method for ascertaining the presence of soymilk in whole bovine milk has been described. The method uses commercially available rabbit anti-soy protein antibodies conjugated to gold nanoparticles (AuNPs) wherein soymilk protein in adulterated milk and soymilk protein at test line competes for limited antibodies. At control line, anti-rabbit immunoglobulin was immobilized for ensuring flow properties of antibody-conjugated AuNPs. Absence or diminished intensity of band at test line indicates presence of soymilk in milk. The soymilk detection limit was 1.75% (v/v) in whole bovine milk and results are available in 5 min. Constructed lateral flow device can be used for on-spot examination of soymilk in milk.

A rapid, semi-quantitative lateral flow assay (LFA) was developed to screen the oxytetracycline (OTC) antibiotics residues in milk samples. In this study a competitive immuno-assay format was established. Colloidal gold nano-particles (GNP) were prepared and used as labelling material in LFA. Polyclonal antibodies were generated against OTC molecule (anti-OTC), purified and the quality was assessed by enzyme linked immuno sorbet assay. For the first time membrane components required for LFA in milk system was optimized. GNP and anti-OTC stable conjugate preparation method was standardized, and then these components were placed over the conjugate pad. OTC coupled with carrier protein was placed on test line; species specific secondary antibodies were placed on the control line of the membrane matrix. Assay was validated by spiking OTC to antibiotic free milk samples and results could be accomplished within 5min. without need of any equipment. The visual detection limit was 30ppb., (Copyright © 2016 Elsevier Ltd. All rights reserved.)

An electrochemical aptasensor for detection of trace amounts of aflatoxin M1 was developed. This required immobilization of aptamer on screen printed gold electrode comprising of working electrode, counter electrode and reference electrode and was achieved by sequentially layering dithiodipropionic acid, streptavidin and biotinylated-tetraethylene glycol-aptamer. Immobilization of aptamer was monitored by cyclic voltammetry. Peak current in square wave voltammogram was inversely related to logarithmic concentration of aflatoxin M1. Dynamic range of sensor was 1-10 5  ppt aflatoxin M1. Sensor can be regenerated by treating electrode with 10% sodium dodecyl sulfate or 40 mM tris-HCl (pH 8.0) containing 10 mM ethylenediaminetetraacetic acid and 0.02% tween-20.

This study was designed to assess anti-diabetic potential of goat, camel, cow and buffalo milk in streptozotocin (STZ) induced type 1 diabetic albino wistar rats. A total of 48 rats were taken for the study where one group was kept as non-diabetic control group (8 rats) while others (40 rats) were made diabetic by STZ (50 mg/kg of body weight) injection. Among diabetic rats, a control group (8 rats) was kept and referred as diabetic control whereas other four groups (8 rats each) of diabetic rats were fed on 50 ml of goat or camel or cow or buffalo milk for 4 weeks. All the rats (non-diabetic and diabetic) were maintained on standard diet for four weeks. STZ administration resulted in enhancement of glucose, total cholesterol, triglyceride, low density lipoprotein, HbA1c and reduction in high density lipoprotein in plasma and lowering of antioxidative enzymes (catalase, glutathione peroxidase and superoxide dismutase) activities in pancreas, kidney, liver and RBCs, coupled with enhanced levels of TBARS and protein carbonyls in pancreas, kidney, liver and plasma. OGTT carried out at the end of 4 week milk feeding indicated that all milks helped in early maintenance of glucose level. All milks reduced atherogenic index. In camel milk fed diabetic group, insulin concentration enhanced to level noted for non-diabetic control while goat, cow and buffalo milk failed to restore insulin level. HbA1c level was also restored only in camel milk fed diabetic group. The level of antioxidative enzymes (catalase, GPx and SOD) in pancreas enhanced in all milk fed groups. Camel milk and to a reasonable extent goat milk reduced formation of TBARS and PCs in tissues and blood. It can be concluded that camel milk ameliorates hyperglycaemia and oxidative damage in type-1 diabetic experimental rats. Further, only camel milk completely ameliorated oxidative damage in pancreas and normalised insulin level.

Homeobox (Hox) genes are involved in body plan of embryo along the anterior-posterior axis. Presence of several Hox genes in white adipose tissue (WAT) and brown adipose tissue (BAT) is indicative of involvement of Hox genes in adipogenesis. We propose that differentiation inducing agents viz. isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3) and insulin may regulate differentiation in brown adipose tissue through Hox genes. In vitro culture of brown fat stromalvascular fraction (SVF) in presence or absence of differentiation inducing agents was used for establishing relationship between fat accumulation in differentiated adipocytes and expression of Hox genes. Relative expression of Pref1, UCP1 and Hox genes was determined in different stages of adipogenesis. Presence or absence of IBMX, indomethacin and DEX during differentiation of proliferated pre-adipocytes resulted in marked differences in expression of Hox genes and lipid accumulation. In presence of these inducing agents, lipid accumulation as well as expression of HoxA1, HoxA5, HoxC4 &HoxC8 markedly enhanced. Irrespective of presence or absence of T3, insulin down regulates HoxA10. T3 results in over expression of HoxA5, HoxC4 and HoxC8 genes, whereas insulin up regulates expression of only HoxC8. Findings suggest that accumulation of fat in differentiated adipocytes is linked with expression of Hox genes., (Copyright © 2016 Elsevier B.V. All rights reserved.)

En1, Nr2f1, Gpc4, Sfrp2, Shox2, Tbx15 and Thbd are among the genes involved in development process of an organism in a number of tissues, in particular adipose tissue. Considering the involvement of isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3), and insulin in adipocyte differentiation, we propose that these differentiation-inducing agents may regulate differentiation in brown adipose tissue through a developmental process. Stromavascular cells isolated from interscapular brown fat of mice were cultured in DMEM-LG medium. Proliferating brown preadipocytes were differentiated in the presence of IBMX, indomethacin, DEX, T3 and insulin. Pref1 (marker of proliferation stage) and uncoupling protein 1 (UCP1, marker for differentiation stage) were upregulated during proliferation and differentiation, respectively. Relative expression of Pref1, UCP1 and developmental genes was determined in different stages of adipogenesis. En1, Gpc4, Nr2f1, Sfrp2 and Shox2 were upregulated during differentiation. Differentiation of preadipocytes in the absence of IBMX, indomethacin, and DEX resulted in drastic reduction in fat accumulation in differentiated adipocytes with simultaneous decrease in En1, Gpc4, Nr2f1, Sfrp2, Shox2 and Tbx15 gene expression. T3 upregulated the expression of En1, Gpc4, Sfrp2 and Tbx15 genes during differentiation and downregulated Shox2 expression as compared to proliferated state. Insulin upregulated the expression of Shox2.

Molecular imprinted polymer (MIP) against cephalexin was synthesized by co-polymerization of functional monomer, cross-linker, radical initiator, along with target molecule (cephalexin) in a porogenic material. Binding of cephalexin towards prepared MIP was studied in different solvents (water, methanol, 1M NaCl, acetone and acetonitrile) and best binding was observed in methanol. Partition coefficient and selectivity of prepared imprint and non-imprint was also studied. Cross reactivity in terms of binding efficiency was also assessed with other antibiotics. Chromatographic study of MIP was carried out by packing prepared imprint into glass column. MIP was used as matrix in solid phase extraction (SPE) for recovery of cephalexin from spiked milk samples for further estimation by high performance liquid chromatography. No interference was observed from milk components after elution of cephalexin from MIP, indicating selectivity and affinity of MIP. On the other hand, interference was observed in eluate obtained from C18 SPE column., (Copyright © 2015 Elsevier Ltd. All rights reserved.)

To understand the role of cell membrane phospholipids during resistance development to cationic antimicrobial peptides (CAMPs) in Enterococcus faecalis, gradual dose-dependent single exposure pediocin-resistant (Pedr) mutants of E. faecalis (Efv2.1, Efv3.1, Efv3.2, Efv4.1, Efv4.2, Efv5.1, Efv5.2 and Efv5.3), conferring simultaneous resistance to other CAMPs, selected in previous study were characterized for cell membrane phospholipid head-groups and fatty acid composition. The involvement of phospholipids in resistance acquisition was confirmed by in vitro colorimetric assay using PDA (polydiacetylene)-biomimetic membranes. Estimation of ratio of amino-containing phospholipids to amino-lacking phospholipids suggests that phospholipids in cell membrane of Pedr mutants loose anionic character. At moderate level of resistance, the cell-membrane becomes neutralized while at further higher level of resistance, the cell-surface acquired positive charge. Increased expression of mprF gene (responsible for lysinylation of phospholipids) was also observed on acquiring resistance to pediocin in PedrE. faecalis. Decreased level of branched chain fatty acids in Pedr mutants might have contributed in enhancing rigidification of cell membrane and contributing towards resistance. The interaction of pediocin with PDA-biomimetic membranes prepared from wild-type and Pedr mutants was monitored by measuring percent colorimetric response (%CR). Increased %CR of pediocin against PDA-biomimetic membranes prepared from Pedr mutants confirmed that cell membrane phospholipids are involved in the interactions of pore formation by CAMPs. There was a direct linear relationship between percent colorimetric response and IC50 of CAMPs for wild-type and Pedr mutants. This relationship further reveals that in vitro colorimetric assay can be used effectively for quantification of resistance to CAMPs., (Copyright © 2015 Elsevier B.V. All rights reserved.)

β-Casomorphin-7 (BCM-7), a seven amino acid peptide, is released during digestion of β-casein A1 variant of milk which is speculated to be associated with certain diseases. Fifteen ssDNA aptamers having high affinity toward BCM-7 were identified from a 72 nt long random library after ten rounds of systematic evolution of ligands by exponential enrichment. Dissociation constant values of selected aptamers were in the range of 7.7-156.7 nM. Seq6 aptamer exhibited the lowest Kd value. Nine aptamers were evaluated for their binding toward BCM-7, BCM-9A1, and BCM-9A2 peptides, and binding was variable. SeqU5 exhibited the lowest binding with BCM-9A1 and BCM-9A2. Aptamer-coated gold nanoparticles (GNPs) resulted in color change of GNPs in the presence of BCM-7, thereby establishing recognition of BCM-7 by aptamers. The enzyme-linked aptamer-sorbent assay (ELASA) was evaluated as an assay of BCM-7 in biological fluids. BCM-7-peroxidase competed with BCM-7 in ELASA, performed with BCM-7 solution and BCM-7 spiked urine pretreated with urease, plasma, and β-casein digest samples.

In the present work, aptamers against aflatoxin M1 and aflatoxin B1 were generated and tested for creating proof of principle of recognition of aflatoxin M1 by generated aptamers. The aptamers were selected through the process referred as systematic evolution of ligands by exponential enrichment. A total of 41 different aptamer (36 aptamers for aflatoxin M1 and 5 for aflatoxin B1) sequences were obtained. The determination of dissociation constant (Kd ) values revealed that aptamers generated against aflatoxin M1 exhibited Kd values in the range of 35-1515 nM. Selected aptamers were grouped on the basis of the presence of common motifs or G-quadruplex. We find it interesting that one aptamer with no conserved motif or G-quadruplex had lowest Kd value (Kd = 35 nM). This structural motif is very distinct from motifs present in other aptamers. The Kd values of selected aptamers for aflatoxin B1 were in the range of 96-221 nM. One aptamer from each group was further tested for its ability to be used in aptasensor. The aptamer recognized aflatoxin M1 as indicated by color change (red to purple or blue) of aptamer-coated gold nanoparticles in the presence of 250-500 nM aflatoxin M1. The aptamers can be used in developing methods for detection/estimation/separation of aflatoxin or antidote for aflatoxin toxicity., (Copyright © 2014 John Wiley & Sons, Ltd.)

Two methods based on the activity of γ-glutamyl transpeptidase and lactoperoxidase are developed for assessing the efficiency of heat treatment of milk at 80 °C for 15 s. Heat treatment of milk at 80 °C (15 s) completely inactivates both milk enzymes. Under the selected assay conditions, enzyme activities are related with intensity of pink colour of product. In contrast to raw (unheated) milk which gives pink colour under the test conditions, heated milk (80 °C, 15 s) remains either white or gives pink colour with significantly reduced intensity. It is recommended to always use raw milk as positive control for the enzyme assay. Principles of colour formation in enzymatic reactions are discussed.

A paper chromatographic method for the detection of adulteration of anionic detergent in milk is described. The method is based on the complexing of anionic detergent with methylene blue dye and separation of complex from free dye using simple paper chromatographic method. Since complexing of detergent is with dye, visualization is direct without involvement of subsequent detection of complex. The method is simple and results are available in 10 min. The method is sensitive to detect 0.1 % (w/v) labolene (laboratory grade detergent) or 0.01 % (w/v) sodium dodecylbenzene sulfonate (pure anionic detergent) in milk. The method can be adopted at quality control laboratories in dairies for ascertaining the quality of milk.

Glycomacropeptide (GMP) is a C-terminal part (f 106-169) of kappa-casein which is released in whey during cheese making by the action of chymosin. GMP being a biologically active component has gained much attention in the past decade. It also has unique chemical and functional properties. Many of the biological properties have been ascribed to the carbohydrate moieties attached to the peptide. The unique set of amino acids in GMP makes it a sought-after ingredient with nutraceutical properties. Besides its biological activity, GMP has several interesting techno-functional properties such as wide pH range solubility, emulsifying properties as well as foaming abilities which are shown to be promising for applications in food and nutrition industry. These properties of GMP have given new dimension for the profitable utilization of cheese whey to the dairy industry. A number of protocols for isolation of GMP from cheese whey have been reported. Moreover, its role in detection of sweet/rennet whey adulteration in milk and milk products has also attracted attention of various researchers, and many GMP-specific analytical methods have been proposed. This review discusses the chemico-functional properties of GMP and its role in the detection methods for checking cheese or sweet whey adulteration in milk. Recent concepts used in the isolation of GMP from cheese whey have also been discussed.

Sialic acid, being a biologically active compound, is recognised as an important component of milk and milk products. Almost all the sialic acid estimation protocols in milk require prior hydrolysis step to release the bound sialic acid followed by its estimation. The objective of this work was to estimate sialic acid in milk and milk products by fluorimetric assay which does not require a prior hydrolysis step thus decreasing the estimation time. The recovery of added sialic acid in milk was 91·6 to 95·8%. Sialic acid in milk was found to be dependent on cattle breed and was in the range of 1·68-3·93 g/kg (dry matter basis). The assay was further extended to detect adulteration of milk with sweet whey which is based on the detection of glycomacropeptide (GMP) bound sialic acid in adulterated milk. GMP is the C-terminal part of κ-casein which is released into the whey during cheese making. For detection of adulteration, selective precipitation of GMP was done using trichloroacetic acid (TCA). TCA concentration in milk was first raised to 5% to precipitate milk proteins, especially κ-casein, followed by raising the TCA concentration to 14% to precipitate out GMP. In the precipitates GMP bound sialic acid was estimated using fluorimetric method and the fluorescence intensity was found to be directly proportional to the level of sweet whey in adulterated milk samples. The method was found to detect the presence of 5% sweet whey in milk.

Background & Objectives: Adherence of bacteria to epithelial cells and mucosal surfaces is a key criterion for selection of probiotic. We assessed the adhesion property of selected indigenous probiotic Lactobacillus strains based on their hydrophobicity and ability to adhere to human epithelial cells., Methods: Five human faecal Lactobacillus isolates, one from buffalo milk and one from cheese were assessed for hydrophobicity following the microbial adhesion to hydrocarbons (MATH) method and colonization potentials based on their adherence to Caco2 and HT-29 colonic adenocarcinomal human intestinal epithelial cell lines. Lactobacillus strains that adhered to Caco2 and HT-29 cell lines were quantified by plating after trypsinization and simultaneously the adhered bacteria were also examined microscopically after staining with Geimsa stain and counted in different fields., Results: Among the tested faecal isolates, L. plantarum Lp91 showed maximum percentage hydrophobicity (35.73±0.40 for n-hexadecane and 34.26±0.63 for toluene) closely followed by L. plantarum Lp9 (35.53±0.29 for n-hexadecane and 33.00±0.57 for toluene). Based on direct adhesion to epithelial cells, L. plantarum Lp91 was the most adhesive strain to HT-29 and Caco2 cell lines with per cent adhesion values of 12.8 ± 1.56 and 10.2 ± 1.09, respectively. L. delbrukeii CH4, was the least adhesive with corresponding figures of 2.5 ± 0.37 and 2.6 ± 0.20 per cent on HT-29 and Caco2 cell lines. Adhesion of the six isolated Lactobacillus strain to HT-29 cell and Caco2 lines as recorded under microscope varied between 131.0 ± 13.9 (Lp75) to 342.7 ± 50.52 (Lp91) and 44.7 ± 9.29 (CH4) to 315.7± 35.4 (Lp91), respectively., Interpretation & Conclusions: Two Indigenous probiotic Lactobacillus strains (Lp9, Lp91) demonstrated their ability to adhere to epithelial cell and exhibited strong hydrophobicity under in vitro conditions, and thus could have better prospects to colonize the gut with extended transit.

Twenty crossbred lactating multiparous cows were used in a 28-day study to compare dry matter intake (DMI), milk yield, milk composition and Bacillus thuringiensis (Bt) protein concentrations in plasma when fed diets containing Bollgard II(®) cottonseed (BGII) or a control non-genetically modified isogenic cottonseed (CON). Bollgard II cottonseed contains the Cry1Ac and Cry2Ab insecticidal proteins that protect cotton plants from feeding damage caused by certain lepidopteran insects. Cows were assigned randomly to the BGII or CON treatments after a 2-week adjustment period. Cows consumed a concentrate containing 40% crushed cottonseed according to milk yield and green maize forage ad libitum. All cows received the same diet but with different crushed cottonseed sources. Cottonseed was included to provide approximately 2.9 kg per cow daily (dry matter basis). The ingredient composition of the concentrate was 40% crushed cottonseed, 15% groundnut cake, 20% corn, 22% wheat bran, 1% salt and 2% mineral mixture. Milk and blood plasma were analyzed for Cry1Ac and Cry2Ab proteins. DMI, BW, milk yield and milk components did not differ between cows on the BGII and CON treatments. Although milk yield and milk fat percentage were not affected by treatment, 4% fat-corrected milk (FCM) production and FCM/kg DMI for cows on the BGII treatment (14.0 kg/cow per day, 1.12 kg/kg) were significantly improved compared with cows on the CON treatment (12.1 kg/cow per day, 0.97 kg/kg). Gossypol contents in BGII cottonseed and conventional cottonseed were similar. Cry1Ac and Cry2Ab2 proteins in Bollgard II cottonseed were 5.53 and 150.8 μg/g, respectively, and were not detected in the milk or plasma samples. The findings suggested that Bollgard II cottonseed can replace conventional cottonseed in dairy cattle diets with no adverse effects on performance and milk composition.

The effects of feeding transgenic (Bt) whole cottonseed (WCS) were studied in lactating cows. Twenty multiparous crossbred cows (Karan Swiss x Karan Fries) in early lactation were given a concentrate mixture containing 40% crushed delinted non-transgenic (non-Bt) WCS, 2 kg wheat straw and green fodder ad lib for a 15-day adaptation period. Thereafter, the cows were divided in two similar groups of 10 each on the basis of milk yield, body weight (BW) and date of calving. The non-Bt control group continued on same ration, while for the Bt group the non-Bt WCS was replaced by transgenic WCS, in a feeding trial of four weeks. The diets provided a minimum of 2 kg cottonseed/cow/d. Mean DMI/100 kg BW and milk yield of non-Bt and Bt groups was 3.48 and 3.45 kg and 11.4 and 12.0 kg/d, respectively. Intake of nutrients, digestibility, milk production and body condition score (BCS) did not differ between the groups (P > 0.05), but BW gain was higher (P < 0.05) in the Bt group than the non-Bt group, probably as a result of hoof problem in two cows of non-Bt group, which when compared excluding two animals from each group did not differ significantly (P > 0.05). Transgenic protein (Cry1C) was not detected in the weekly milk samples or in blood plasma at the end of the experiment, showing that delinted WCS containing Cry1C protein can safely be fed to lactating cows.

A method for the estimation of urea in milk using ammonia electrode is described. Urea is first degraded by urease enzyme into ammonium ion and carbon dioxide at neutral pH. The ammonium ion is then converted into ammonia at alkaline pH. A linear inverse relationship was observed between logarithmic concentration of ammonia or urea and electrode response. Repeatability, expressed as a coefficient of variation, was 1.77% at a level of 8.92 mm-urea in milk. The method was validated in milk samples spiked with between 2 x 10-3 and 10 x 10-3 m-urea and recovery of added urea was quantitative. Whereas, preservative sodium azide at 0.5 g/l or 2 g/l level did not affect results, lower values of urea concentration in presence of Bronopol at 0.5 g/l were observed. Urea levels in milk samples estimated by this method were comparable to standard enzymatic method. The method is simple, fast and is not prone to interference from other milk constituents.

Immunosuppressive activity in buffalo placenta was evaluated by measuring proliferation of lymphocytes in presence of phytohaemagglutinin (PHA) alone or PHA plus placental proteins. The immunosuppressive activity was dose-dependent over the protein concentration range of 10-50 micrograms/ml. Proteins from both cotyledon and non-cotyledon portions of placenta exhibited immunosuppressive activity. Fractions obtained with 0-40, 40-60 and 60-80% saturated ammonium sulphate exhibited 70, 73 and 75% suppression, respectively. PBS-soluble placental proteins were resolved on G-100 column into three peaks that exhibited 69 (peak 1), 55 (peak 2) and 73% (peak 3) suppression. Exogenously added interleukin-1 (IL-1) failed to reverse the suppression caused by buffalo placental proteins.

A number of mouse x mouse hybridomas producing monoclonal antibodies (MAbs) against bovine growth hormone (bGH) were prepared by fusion of spleen cells from bGH-primed mice (Balb/c) with non-secretory mouse myeloma cells (PAIOP3) and characterized. MAbs obtained from three fusion experiments belonged to IgM, IgG1 and IgG2b class/subclass of antibodies. Cross-reaction studies indicated that generated antibodies were against three different epitopes of bGH. VIA6E8 (IgG1) and VIIB2E11C9 (IgM) did not cross-react with ovine prolactin (oPRL), ovine leutinizing hormone (oLH) and porcine follicle stimulating hormone. Antibody VIB3C9E8 (IgM) exhibited cross-reaction with oPRL and oLH. Antibody VIC1F9 (IgG2b) cross reacted with oPRL. All MAbs were against conformational epitopes of bGH.

An acid phosphatase from Arachis hypogaea (peanuts) has been purified. The electrophoretically homogeneous enzyme preparation is free of any phophodiesterase activity. The enzyme has a molecular weight of 120,000. Among the various phosphomonoesters tested, p-nitrophenylphosphate was found to be its most effective substrate. The Km for p-nitrophenylphosphate was 1.21 mM at pH 5.0 and 25 degrees C. The enzyme was thermostable and did not loose activity after 1 hr at 50 degrees C.

The method of chemical aggregation of enzymes has the advantage of yielding an immobilized enzyme preparation wherein reactor volume can be significantly reduced because of the absence of an inert carrier. A coaggregate of trypsin and chymotrypsin formed by extensive cross-linking with glutaraldehyde is described. A significant property of this aggregate is the reduced autolysis of the trypsin component of the coaggregate.

Hybrid enzymes which have two different enzyme activities linked together covalently may be useful reagents for various applications, such as the determination of complex biological structures. The present paper describes the preparation and purification of two such enzyme-enzyme conjugates, namely, trypsin-chymotrypsin and trypsin-alkaline phosphatase. Whereas the former has been prepared by using the well-known bifunctional reagent glutaraldehyde, the latter exploited the Schiff base formation between the oxidized carbohydrate moiety of alkaline phosphatase and the free amino groups of trypsin.

A heteroenzyme conjugate retaining activities of two component enzymes from trypsin and chymotrypsin was prepared using N-succinimidyl pyridyl dithiopropionate as crosslinking reagent. The conjugate bound to both trypsin and chymotrypsin affinity columns. Trypsin and chymotrypsin were linked in the ratio of 1:1 on mol basis. The conjugate, when treated with dimethyladipimidate, showed decreased autolysis of its trypsin component.

The distribution of acid phosphatase (EC 3.1.3.1) and alkaline phosphatase (EC 3.1.3.2) was studied in the head, midpiece and tail fractions of buffalo spermatozoa. Fractionation was achieved by the basic principles of ultrasonication and density gradient centrifugation. The activity of acid phosphatase in the head, midpiece and tail fractions was 7.30, 11.55 and 47.10 and for alkaline phosphatase 1.74, 6.95 and 26.71 respectively; the unit being microgram of inorganic phosphorus liberated/mg of protein/h at 37 degrees C.