Search

Horses and cattle have shown low susceptibility to SARS-CoV-2, and there is no evidence of experimental intraspecies transmission. Nonetheless, seropositive horses in the US and seropositive cattle in Germany and Italy have been reported. The current study investigated the prevalence of antibodies against SARS-CoV-2 in horses and cattle in Switzerland. In total, 1940 serum and plasma samples from 1110 horses and 830 cattle were screened with a species-specific ELISA based on the SARS-CoV-2 receptor-binding domain (RBD) and, in the case of suspect positive results, a surrogate virus neutralization test (sVNT) was used to demonstrate the neutralizing activity of the antibodies. Further confirmation of suspect positive samples was performed using either a pseudotype-based virus neutralization assay (PVNA; horses) or an indirect immunofluorescence test (IFA; cattle). The animals were sampled between February 2020 and December 2022. Additionally, in total, 486 bronchoalveolar lavage (BAL), oropharyngeal, nasal and rectal swab samples from horses and cattle were analyzed for the presence of SARS-CoV-2 RNA via reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). Six horses (0.5%; 95% CI: 0.2-1.2%) were suspect positive via RBD-ELISA, and neutralizing antibodies were detected in two of them via confirmatory sVNT and PVNA tests. In the PVNA, the highest titers were measured against the Alpha and Delta SARS-CoV-2 variants. Fifteen cattle (1.8%; 95% CI: 1.0-3.0%) were suspect positive in RBD-ELISA; 3 of them had SARS-CoV-2-specific neutralizing antibodies in sVNT and 4 of the 15 were confirmed to be positive via IFA. All tested samples were RT-qPCR-negative. The results support the hypotheses that the prevalence of SARS-CoV-2 infections in horses and cattle in Switzerland was low up to the end of 2022.

Sapovirus (genus Sapovirus, family Caliciviridae), along with norovirus, is recognized as an important cause of acute intestinal infection (AII) in humans. Human sapovirus strains exhibit significant genetic diversity. The existence of 18 genotypes, combined into four genogroups (GI, GII, GIV, GV), has been shown. Reverse transcription-PCR (RT-PCR) techniques are widely used for the detection of sapoviruses in clinical samples due to their high sensitivity and broad reactivity. To further characterize the identified sapoviruses, genotyping is carried out, which is the basis for constructing a classification system for human sapoviruses. The purpose of this review was to highlight modern methods for the detection and genotyping of sapoviruses based on the reverse transcription polymerase chain reaction and viral genome sequencing. [ABSTRACT FROM AUTHOR]

Helicobacterpylori colonizes the human gastric mucosa of more than half of the human population and has a unique lipopolysaccharide (LPS) structure. LPS is the most dominant and suitable pathogen-associated molecular pattern that is detected via pattern recognition receptors. Although the priming effect of H. pylori LPS on reactive oxygen species (ROS) production of PMNs is lower than that of Escherichia coli O111:B4 LPS, LPS released from H. pylori associated with antibiotics eradication therapy may activate PMNs and increase ROS production. In addition, we describe the effects of H. pylori and E. coli O111:B4 LPSs on gene expression and the anti-inflammatory effect of lansoprazole (LPZ) in human polymorphonuclear leukocytes. LPS isolated from H. pylori and E. coli O111:B4 alters toll-like receptor 2 (TLR) and TLR4 expressions similarly. However, LPS from E. coli O111:B4 and H. pylori caused a 1.8-fold and 1.5-fold increase, respectively, in CD14 expression. All LPS subtypes upregulated TNFα and IL6 expression in a concentration-dependent manner. Although E. coli O111:B4 LPS upregulated IL8R mRNA levels, H. pylori LPS did not (≦ 100 ng/mL). Gene expression levels of ITGAM demonstrated no significant change on using both LPSs. These different effects on the gene expression in PMNs may depend on variations in LPS structural modifications related to the acquired immunomodulatory properties of H. pylori LPS. Proton pump inhibitors, i.e., LPZ, are used in combination with antibiotics for the eradication therapy of H. pylori. LPZ and its acid-activated sulphenamide form AG-2000 suppress ROS production of PMNs in a dose-dependent manner. These results suggest that LPZ combination with antibiotics for H. pylori eradication reduces gastric inflammation by suppressing ROS release from PMNs. [ABSTRACT FROM AUTHOR]

Background: The possibility of considering Culex pipiens (Cx. pipiens) as a vector for transmitting the hepatitis C virus (HCV) is controversial and needs further investigation. This work aimed to detect the possibility of transmission of the hepatitis C virus by Cx. pipiens and the role of the bacterial microbiota in their midgut. Main body: Two groups of symbiotic and aposymbiotic of female Cx. pipiens were infected with the hepatitis C virus using an artificial feeding membrane technique. The viral load was detected in the head region for up to 60 min in the infected symbiotic group and 90 min in the aposymbiotic group. The midgut region can harbor the virus for 5 days after feeding. The absence of gut microbiota increases the potentiality of ten females to carry high titer of infective dose (1.2 × 106 IU/ml) of HCV genotype 4a for 6 days. The bacterial midgut microbiota appears to play a significant role in the transmission of HCV. On the other hand, HCV was not detected in the salivary glands of either symbiotic or aposymbiotic mosquitoes during the detection period. Cx. pipiens can transmit HCV from infected female adult mosquitoes to HCV-negative human blood in vitro. The biological parameters were survival rate, blood feeding, oviposition, hatchability rates, and mean digestion period of Cx. pipiens after infection with HCV showed significant changes. Moreover, an ex vivo assay demonstrated that HCV-infected mosquitoes could transmit the virus RNA into healthy blood. Conclusion: The results suggested that the mosquitoes' mechanical transmission of HCV was reasonable. In addition, the mosquito microbiome played a significant role in determining the potentiality of mosquitoes as a vector for disseminating HCV infections. [ABSTRACT FROM AUTHOR]

Introduction: Wheat dwarf virus (WDV), the species Mastrevirus hordei of the genus Mastrevirus in the family Geminiviridae , is a cereal virus commonly detected in several European, African and Asian countries that causes economic losses. Methods: In the spring of 2019, a severe outbreak of wheat dwarfing and yellowing was observed in many winter wheat crops across Serbia. A total of 161 samples were tested for the presence of WDV and other common wheat viruses using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). To obtain the complete genome of 23 selected isolates, several overlapping segments of the WDV genome were amplified and sequenced. A phylogenetic tree was constructed using the whole genome sequences of the WDV isolates identified in this study and 40 selected sequences from GenBank. Results and discussion: The results of DAS-ELISA indicated the presence of WDV in all samples collected from 21 sites in all nine districts surveyed. Further molecular characterization based on complete genome sequencing of 23 selected isolates showed that the Serbian WDV isolates had low nucleotide diversity and were closely related to wheat-infecting isolates from Europe, suggesting the presence of wheat-adapted forms of WDV in Serbia. The constructed phylogenetic tree revealed that Serbian isolates grouped in clade E within the wheat-adapted forms. This study provided the first insight into the genetic structure of WDV in Serbia based on its whole genome sequence. Further studies on the vector biology and population dynamics are needed to better understand the factors influencing the emergence and spread of WDV under local agroecological conditions. [ABSTRACT FROM AUTHOR]

[Objective] To establish a rapid and specific multiplex fluorescence quantitative PCR method for duck circovirus (DuCV), duck enteritis virus (DEV) and novel duck parvovirus (NGPV). [Method] Three pairs of specific primers and three fluorophore-labeled Taq-Man probes were designed and synthesized for the conserved region sequences of DuCV, DEV and NGPV. Recombinant plasmid standards were con- structed, the reaction conditions were optimized, and multiplex quantitative PCR detection methods for DuCV, DEV and NGPV were established. [Result] The method could identify DuCV, DEV and NGPV at the same time, and did not cross-react with other common duck virus diseases. The minimum detection amount of DuCV, DEV and NGPV was 2.5×10¹ copies/µL. The method was reproducible, and the coefficient of variation between and within groups was less than 1.0%. A total of 150 clinical samples were tested with this method, the results showed that the positive rates of DuCV, DEV and NGPV were 32% (48 cases), 23.3% (35 cases) and 18.7% (28 cases), respectively, the mixed infection rates of DuCV and DEV were 4.6% (7 cases), the mixed infection rate of DuCV and NGPV was 8.6% (13 cases), and the total positive rate was 87.3% (131 cases), and the results of mixed infection of DEV and NGPV were not detected. Compared with the conventional PCR detection method, the positive coincidence rate was 100%. [Conclusion] A multiplex real-time PCR method based on Taq-Man probes was estab- lished to detect DuCV, DEV, NGPV simultaneously, quickly and quantitatively. It is more sensitive and practical than ordinary PCR, which ef- fectively avoids the problems of time-consuming and cost-effective multiple tests, and provides an effective and reliable detection technology for the monitoring and prevention of DuCV, DEV and NGPV. [ABSTRACT FROM AUTHOR]

AbstractZNF384 gene rearrangements are a distinct subtype of adult B cell acute lymphoblastic leukemia (B-ALL). We screened 46 B-other ALL patients for ZNF384 fusions using fluorescent in situ hybridization (FISH) and reverse transcription-polymerase chain reaction (RT-PCR). Clinical data, treatment response, and minimal residual disease (MRD) status were analyzed. Ten (21.7%) patients were ZNF384-r positive (nine by FISH, nine by RT-PCR, eight by both). FISH showed atypical signals, including 3’ signal gain and 5’ signal deletion. EP300 was the main fusion partner (n = 5). TAF15::ZNF384, SYNRG::ZNF384, CREBBP::ZNF384, and TCF3::ZNF384 fusions were found in one patient each; one case’s partner gene is unknown. One patient was MRD-negative at the end of the first induction, lower than in patients without ZNF384-r. ZNF384-r incidence matched B-other ALL incidence in Chinese patients. Combined FISH and RT-PCR improved detection. ALL with ZNF384-r has unique features, and lower MRD-negative response may indicate a negative impact on traditional treatments. [ABSTRACT FROM AUTHOR]

Smad Family Member (SMAD), a protein family responsible for transducing the signal induced by TGF-β into the nucleus, is thought to play a role in the pathology of many heart diseases. Therefore, we aimed to evaluate the influence of the SMAD1 rs1016792 polymorphism and gene expression on pulmonary arterial hypertension (PAH) due to congenital heart disease (CHD) in children. A total of 90 children, 45 of whom were PAH-CHD children and 45 healthy children, were included in the study. Patients were selected from those who were diagnosed and followed in the Department of Pediatric Cardiology.The SMAD1 rs1016792 genotyping and expression analysis was performed using a real-time polymerase chain reaction (RT-PCR)-based system. It was determined that the left ventricular end-diastolic diameter (LVEDD) value was lower in the patient group than in the control group, while the pulmonary artery pressure (PAP) value was higher in the patient group than in the control group. When the SMAD1 gene expression level was examined, a statistically significant difference was found between the patient and control groups. Patients had decreased SMAD1 expression compared to controls (p˂0.001). We found no significant difference between the patient and control groups in terms of SMAD1 rs1016792 genotype distribution or allele frequency (p > 0.05). There was no difference between genotype distribution and SMAD1 expression levels in the groups. In this study, we showed for the first time that SMAD1 expression is decreased in children with PAH-CHD. These results will be a preliminary step toward understanding the role of SMAD1 in the etiopathogenesis of CHD. [ABSTRACT FROM AUTHOR]

During the COVID-19 pandemic, veterinary diagnostic laboratories tested both human and animal samples and needed to ensure that they could accurately perform large numbers of diagnostic tests in a timely manner. Sample pooling, a methodology used effectively for over 80 years as a surveillance tool for screening large numbers of potentially infected individuals, was employed. Given its sensitivity, real-time polymerase chain reaction (PCR) is more suitable for employing this strategy, as compared to other less sensitive testing methods. In this study, we evaluated the capability of detecting SARS-CoV-2 in both 5-sample and 10-sample pools of feces using real-time reverse transcriptase polymerase chain reaction (rRT-PCR) as well as determined the level of sensitivity. A blinded method test (BMT) by an independent laboratory was conducted to assess the five-sample fecal pool. To complement detection capability, the stability of the genome within a PBS fecal suspension was measured under various time and temperature conditions across a 28-day period. Our results showed that the limit of detection for 5-sample and 10-sample fecal pools is 12.8 and 6.4 genome copies in a 25 µL PCR, respectively. The 5-sample and 10-sample pooling resulted in a cycle threshold (Ct) value loss of 2.35 and 3.45, as compared to Ct values of known positive individual samples, but consistent detection was still achieved in pools containing positive samples with an original Ct below 36 and 34, respectively. The simulation of clinical five-sample pooling showed that all positive samples could be detected regardless of the number (1–3) of positive samples in each pool. The BMT results demonstrated excellent sensitivity (100 copies/reaction) in five-sample pools for the detection of SARS-CoV-2 RNA even though a fecal matrix effect was observed. Finally, our results show that the SARS-CoV-2 genome remains stable over a wide range of time and temperature variations. Overall, our findings provide solid data to scale up SARS-CoV-2 testing capacity in veterinary diagnostic laboratories. [ABSTRACT FROM AUTHOR]

Background: BCR::ABL1 fusion is mostly derived from a reciprocal translocation t(9;22)(q34.1;q11.2) and is rarely caused by insertion. Various methods have been used for the detection of t(9;22)/BCR::ABL1, such as G-banded chromosomal analysis, fluorescence in situ hybridization (FISH), quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) and optical genome mapping (OGM). Understanding the strengths and limitations of each method is essential for the selection of appropriate method(s) of disease diagnosis and/or during the follow-up. Methods: We compared the results of OGM, chromosomal analysis, FISH, and/or RT-PCR in 12 cases with BCR::ABL1. Results: BCR:ABL1 was detected by FISH and RT-PCR in all 12 cases. One case with ins(22;9)/BCR::ABL1 was cryptic by chromosomal analysis and nearly missed by OGM. Atypical FISH signal patterns were observed in five cases, suggesting additional chromosomal aberrations involving chromosomes 9 and/or 22. RT-PCR identified the transcript isoforms p210 and p190 in seven and five cases, respectively. Chromosomal analysis revealed additional chromosomal aberrations in seven cases. OGM identified extra cytogenomic abnormalities in 10 cases, including chromoanagenesis and IKZF1 deletion, which were only detected by OGM. Conclusions: FISH offers rapid and definitive detection of BCR::ABL1 fusion, while OGM provides a comprehensive cytogenomic analysis. In scenarios where OGM is feasible, chromosomal analysis and RT-PCR may not offer additional diagnostic value. [ABSTRACT FROM AUTHOR]

Streptozotocin (STZ) is used as a diabetes-inducing agent in experimental animal studies. However, it is known that STZ-induced diabetic animals show significant increases in oxidative stress parameters and neurodegeneration besides their blood glucose level. In this study, the acute and subacute toxic effects of STZ on the liver, sciatic nerve, and brain tissues were investigated in vivo rat model. Sprague-Dawley rats were divided into two groups; while 50 mg/kg STZ was administered ip to the STZ group, only saline was administered to the control group. After STZ administration, three units (100 U/mL) of subcutaneous insulin glargine were applied daily to prevent the formation of diabetes. At 24 h, 1,2, and 4 weeks after applications, rats from each group were sacrificed and tissues were removed under anesthesia. At the end of the study, compared to the control, a significant decrease in SOD and GST activity and an increase in lipid peroxidation were detected in the liver and sciatic tissues of rats in the STZ-treated group in the first 24h. Considering the TUNEL, NFκB, and NOS2 expressions, it was noted that while the effects of STZ on the liver were observed in the acute stage (24h), it had subacute effects on the brain. When apoptosis-related gene expression (Bcl-2, Bax, CASP3, CASP8, CASP9, TNF-α) and immunohistochemistry were evaluated, the apoptotic effect of STZ was observed mostly in sciatic nerve tissues. Within the scope of the study, it was revealed that STZ did not only show selective toxicity to pancreatic β cells but also very toxic to other tissues and organs. [ABSTRACT FROM AUTHOR]

Introduction: SARS-CoV-2, seasonal influenza, and respiratory syncytial virus (RSV) are major causes of acute respiratory infections in all age groups and responsible for an enormous socio-economic burden. The recently coined term 'tripledemic' describes co-circulation of these three viruses, a novel epidemiological paradigm that poses profound public health implications. Areas covered: Real-time reverse transcription polymerase chain reaction (RT-PCR) is now considered the reference method for the diagnosis of SARS-CoV-2, influenza, and RSV infections. Syndromic-based multiplex RT-PCR panels that simultaneously detect several respiratory viruses have become increasingly common. This review explores available molecular diagnostics (MDx) platforms for the diagnosis of SARS-CoV-2, influenza, and RSV in the same biological sample. Within some limitations of the published validation and diagnostic accuracy studies, both laboratory-based and point-of-care multiplex panels proved highly performant in identifying SARS-CoV-2, influenza A, influenza B, and RSV. Improved operational efficiency and faster turnaround times make these assays potentially cost-effective or even cost-saving. Expert opinion: The adoption of multiplex MDx assays for the contemporary detection of SARS-CoV-2, influenza, RSV, and other respiratory pathogens will likely increase in the next few years. To maximize the clinical usefulness and cost-effectiveness of these assays, locally issued guidelines and protocols on their implementation should be adopted. [ABSTRACT FROM AUTHOR]

Sweet potato (Ipomoea batatas L. Lam.) is a major source of food in many parts of Ethiopia. In recent years, viral diseases have become the main threat to sweet potato production in Ethiopia. Previous virus survey studies carried out from 1986 to 2020 reported eight viruses infecting sweet potato in Ethiopia. Consequently, obtaining and multiplying virus-free planting materials have been difficult for farmers and commercial multipliers. This study was conducted to detect viruses infecting the five sweet potato varieties used as source plants and compare the virus elimination efficiency between meristem cultures from untreated and heat-treated mother plants and production of virus-free sweet-potato-planting materials. Seven common viruses were tested for, using grafting to Ipomoea setosa, enzyme-linked immunosorbent assay (ELISA) and reverse-transcription polymerase chain reaction (RT–PCR) before and after elimination procedures as screening and confirmatory methods. The sweet potato feathery mottle virus (SPFMV) elimination efficiencies of meristem cultures from untreated (grown at 25 ± 1 °C) and heat-treated (grown at 39 ± 1 °C) potted plants of sweet potato varieties were evaluated and compared. Sweet potato feathery mottle virus (SPFMV) was detected in 12 of the 15 source plants tested. Triple infections of SPFMV, sweet potato chlorotic stunt virus (SPCSV), and sweet potato virus C (SPVC) were detected in one of the fifteen plants. This study reports the detection of SPVC for the first time in sweet potato plants from Ethiopia. The cutting of meristems from heat-treated plants further increased the percentage of virus-free plantlets by ca 10% to ca 16%, depending on the plant variety. Elimination efficiency also seemed to vary among varieties: the greatest difference was observed for 'Tola', and the least difference was observed for 'Guntute'. The present study provided protocols for detecting viruses and generating virus-free sweet-potato-planting materials in Ethiopia. [ABSTRACT FROM AUTHOR]

Overuse of artificial chemical fertilizers could be detrimental to the environment. Utilizing beneficial microorganisms as biofertilizers is a sustainable technique that promotes soil health, crop yield, and ecosystem preservation. Curcuma longa L. is utilized as a medication since it has its antibacterial, anti-microbial, and anti-tumor characteristics, which reduce inflammation and hasten wound healing. The effect of E. cloacae strain MSR1, which is common in the roots of alfalfa grown in the Al-Ahsaa region, on C. longa plants is being investigated. C. longa rhizomes were planted under greenhouse conditions after being submerged in a solution of E. cloacae strain MSR1 (OD 500) or water treatment as a control for 12 hours. After 240 days of growing, ten randomly selected plants from each treatment were collected, and the vegetative growth and yield metrics were assessed. To investigate how E. cloacae influences C. longa production and chemical composition (photosynthetic pigment, nitrogen, phosphorus, potassium, and curcuminoid), measurements were conducted as well as genes diketide-CoA and curcumin synthases genes. Our research showed that C. longa's growth and yield were favorably impacted by E. cloacae. Significant increases in the related plants' chlorophyll a,b, carotenoid, nitrogen, phosphorus, and potassium levels were likewise a reflection of the enhanced effects shown in the growth and yield parameters. Treatment with E. cloacae raised the curcuminoid's three sub-components' compositions to varying degrees: bisdemethoxycurcumin, demethoxycurcumin, and curcumin. Comparing E. cloacae treated plants to the control, high expression levels of the genes diketide-CoA and curcumin synthase-1, -2, and 3 were also found. The treatment of E. cloacae is a good biostimulant candidate for boosting growth and yield as well as raising the medicinal qualities of C. longa, according to the overall results. [ABSTRACT FROM AUTHOR]

Background: The dilution-replicate experimental design for qPCR assays is especially efficient. It is based on multiple linear regression of multiple 3-point standard curves that are derived from the experimental samples themselves and thus obviates the need for a separate standard curve produced by serial dilution of a standard. The method minimizes the total number of reactions and guarantees that Cq values are within the linear dynamic range of the dilution-replicate standard curves. However, the lack of specialized software has so far precluded the widespread use of the dilution-replicate approach. Results: Here we present repDilPCR, the first tool that utilizes the dilution-replicate method and extends it by adding the possibility to use multiple reference genes. repDilPCR offers extensive statistical and graphical functions that can also be used with preprocessed data (relative expression values) obtained by usual assay designs and evaluation methods. repDilPCR has been designed with the philosophy to automate and speed up data analysis (typically less than a minute from Cq values to publication-ready plots), and features automatic selection and performance of appropriate statistical tests, at least in the case of one-factor experimental designs. Nevertheless, the program also allows users to export intermediate data and perform more sophisticated analyses with external statistical software, e.g. if two-way ANOVA is necessary. Conclusions: repDilPCR is a user-friendly tool that can contribute to more efficient planning of qPCR experiments and their robust analysis. A public web server is freely accessible at https://repdilpcr.eu without registration. The program can also be used as an R script or as a locally installed Shiny app, which can be downloaded from https://github.com/deyanyosifov/repDilPCR where also the source code is available. [ABSTRACT FROM AUTHOR]

Eimeria maxima (APU1 and APU2) differ in virulence for chickens, due in part to the greater fecundity of the former. In a previous study, RNA-seq was used to identify a transcripts upregulated in E. maxima APU1 compared to E. maxima APU2. In this study, 2 of these upregulated genes (EMWEY 23530 and EMWEY 48910) were characterized by first confirming upregulation using quantitative RT-PCR. For both EMWEY 23530 and EMWEY 48910, RNA transcription was fairly consistent during sporulation. The extent of differential expression was about 2-fold log2 higher in APU-1 compared to APU-2 (peaking at 18 h for EMWEY 23530 and 0 h for EMWEY 48910). EMWEY 23530 and EMWEY 48910 cDNA were cloned and expressed as polyHis-fusion proteins in Escherichia coli. The observed size of recombinant EMWEY 23530 was 24 kDa; the observed size of recombinant EMWEY 48910 was 35 kDa, which are consistent with the predicted size based on the coding sequences. Immunostaining 2D gel blots of E. maxima APU1 and APU2 oocyst/sporocyst protein with antisera specific for EMWEY 23530 identified a 33.5 kDa protein with a pH 7.4 isoelectric point (Emax p33.5). Similar 2D gel blot analysis with EMWEY 48910 identified a 41 kDa protein with a pH 7.2 isoelectric point (Emax p41). The intensity of Emax p33.5 and Emax p41 was noticeably greater in oocyst/sporocyst proteins from E. maxima APU1 compared to E. maxima APU2. This was corroborated by ELISA wherein equal amounts of total E. maxima APU1 and APU2 protein were probed with serial dilutions of anti-rEmax p33.5 or anti-rEmax p41. Immunofluorescence (IFA) staining of permeabilized unsporulated E. maxima APU1 and APU2 oocysts revealed Emax p33.5 to be localized in one end of oocysts, while Emax p41 appeared on the surface of oocysts. After sporulation, the p33.5 and p41 antigens appeared loosely associated with sporocysts. Taken together, these data confirm excess expression of two proteins in the E. maxima strain characterized by greater fecundity and virulence, and may provide insight into basis for phenotypic differences among different E. maxima. [ABSTRACT FROM AUTHOR]

Background: Determination of SARS-CoV-2 variant is significant to prevent the spreads of COVID-19 disease. Methods: We aimed to evaluate the variants of SARS-CoV-2 rate in positive patients in Kanuni Sultan Suleyman Training and Research Hospital (KSS-TRH), Istanbul, Türkiye between 1st January and 30th November 2021 by using RT-PCR method. Results: Herein, 825,169 patients were evaluated (male:58.53% and female:41.47%) whether COVID-19 positive or not [(+):21.3% and (−):78.7%] and 175,367 patient was described as positive (53.2%-female and 46.8%-male) by RT-PCR. COVID-19 positive rate is observed highest in the 6–15- and 66–75-year age range. The frequencies were obtained as SARS-CoV-2 positive (without mutation of B.1.1.7 [B.1.1.7 (U.K), E484K, L452R, B.1.351 (S. Africa/Brazil) spike mutations] as 66.1% (n: 115,899), B.1.1.7 Variant as 23.2% (n:40,686), Delta mutation (L452R) variant as 9.8% (n:17,182), B.1.351 variant as 0.8% (n:1370) and E484K as 0.1% (n: 230). In April 2021, general SARS-CoV-2 and B.1.1.7 variant were dominantly observed. Up to July 2021, B.1.617.2 (Delta variant/ Indian variant) and E484K has been not observed. B.1.351 variant of SARS-CoV-2 has been started in February 2021 at the rarest ratio and March 2021 is the top point. September 2021 is the pick point of E484K. African/Brazil variant of SARS-CoV-2 has been started in February 2021 at the rarest ratio and March 2021 is the top point. September 2021 is the pick point of E484K. When the gender type is compared within the variants, women were found to be more prevalent in all varieties. Conclusions: The meaning of these mutations is very important to understand the transmission capacity of the COVID-19 disease, pandemic episode, and diagnosis of the virus with mutation types. Understanding the variant type is important for monitoring herd immunity and the spread of the disease. [ABSTRACT FROM AUTHOR]

Potato virus M (PVM) is one of the most widespread and economically damaging viruses worldwide, along with X, Y, S, A, and L. Therefore, outcomes of the monitoring surveys carried out in potato fields during this study showed numerous disease symptoms visible on potato plants, such as boat-shaped curling of leaf tips, mosaic twisting, leaf swelling, striped mosaic along the veins, and spotted mosaic. The diseased sample collections from potato plants and the molecular and genetic identification progressed based on the PVM protein coat (CP) gene. The results revealed that the boat-shaped curling and mosaic symptoms were PVM's typical signs. The isolates' identification continued through PCR product sequencing, and their submission in the NCBI database received a PP235793.1 tag and the name PVM-Uz-AY1. The phylogenetic analysis of the identified isolates showed that the said isolate was 98% related to the isolate GQ469609.1, and the rest to isolates, such as VF-Nevsky2 (LC511899.1), FE-Queen_anne10 (LC511893.1), and KC479342.1. Those located on other phylogenetic branches were KF561611.1, KF561603.1, and KF561608.1, which appeared to share 99% homology. In addition, the study identified the virus using the Real Time-PCR method, obtaining reliable results. [ABSTRACT FROM AUTHOR]

The Barley Yellow Dwarf Virus (BYDV) is one of the most economically significant viruses from the Luteoviridae family that infects most crop plants of the family Poaceae. The presented study sought to molecularly identify BYDV in proso millet (Panicum miliaceum L.) and evaluate the genetic diversity of its CP (coat protein) gene concerning other strains worldwide. Plant samples collected from proso millet fields in the Navoiy Region, Uzbekistan, incurred BYDV-PAV RT-PCR for the CP gene. The results authenticated the presence of a BYDV-PAV strain in the collected samples. The identified nucleotide sequence of BYDV-PAV isolate T-UZB2 proceeded to deposit in the GenBank database. BLASTN analysis of this sequence showed the highest genetic similarity (98.75%) with the Pakistan PAV-type isolate PK3 (JX473288.1). Phylogenic analysis and multiple sequence alignment revealed that four mutation events (268G>A, 440A>C, 450A>C, and 464C>T) involving the BYDV-PAV isolate Pk3 Pakistan have considerably contributed to the evolutionary history of PAV T-UZB2 Uzbekistan haplotype. SMV identification can help control pathogens and reduce their impact on the soybean crop in Uzbekistan. [ABSTRACT FROM AUTHOR]

Bovine tuberculosis (BTB) still represents a significant public health concern and economic issue for livestock breeders in Egypt. This research investigates the incidence of bovine tuberculosis in cattle slaughtered at the central abattoir in Aswan, Egypt, in 2023. A total of 720 cattle were checked antemortem and postmortem at the abattoir. The suspected lesions were analyzed with acid-fast staining, microscopy, histology, ELISA, and RT-PCR. Based on gross tubercle lesions, the overall occurrence of bovine tuberculosis in cattle slaughtered at Aswan abattoirs was 3.2% (23/720), with thoracic lymph nodes and lungs exhibiting the highest frequency of tubercle lesions compared to other organs. According to employed diagnostic tests, the prevalence of tuberculosis was estimated as 68.6, 61, 56.5, and 78.3% for microscopy, histopathology, ELISA, and RT-PCR, respectively. These findings highlight the incidence of bovine tuberculosis and the dissemination of tuberculous lesions among cattle slaughtered at Aswan abattoirs. Furthermore, such prevalence emphasizes the urgent need for a practical disease control approach and an organized surveillance system in the cattle population. One Health strategy is strongly advised to mitigate the zoonotic transmission to people and economic losses in the cattle industry. [ABSTRACT FROM AUTHOR]

The purpose of this study was to determine the impact of feeding time on NPY/AgRP protein and mRNA expression in the brain during prenatal and postnatal periods. Feeding at different times of the day during pregnancy may have lasting effects on the hypothalamic circuitry in offspring energy homeostasis. In the experimental design, adult female hamsters were randomly assigned to receive three different feeding conditions: ad libitum, night-time feeding and day-time feeding groups. After the lactation period, feeding regimens were continued for the offspring born from mothers who were given nutritional regimens, until they were 30 days old. RT-PCR for NPY/AgRP mRNA expression and ELISA analysis for protein levels were performed on hypothalamus tissues of hamsters at 10, 20 and 30 days of postnatal stage. There was no difference between the groups in terms of the daily measured food consumption of the offspring's. Body weights were significantly decreased in both night-time and day-time feeding groups compared to the ad libitum group (p<0.05). The highest increase in mRNA expression of NPY/AgRP was seen in the samples taken at 10. day of lactation in the night-time and day-time feeding groups of the offspring treated with three different feeding regimens. When the feeding regimes were compared, it was observed that the protein and mRNA expression of both NPY and AGRP increased the most in the offspring groups in which the feeding was restricted night -time only. Early stages of development have shown that maternal factors have significantly affected the offspring NPY and AgRP mRNA expression and protein levels. These results show that the metabolic regulation of energy balance may change with maternal factors during the very early stages of development. [ABSTRACT FROM AUTHOR]

The main objective of this study is to characterize the virus associated with faba bean (Vicia faba L.) crops in the Department of Nariño (Colombia). Faba bean is an important food source, but it faces challenges from viral diseases such as "pod mottle." This disease manifests with symptoms such as leaf chlorosis, dwarfism, and pod lesions. Viral characterization is conducted through seed transmission tests, mechanical transmission, RT-PCR, and transmission electron microscopy (TEM). The results show that the virus morphology consists of spherical and enveloped particles that range between 80-100nm in diameter. RT-PCR and sequencing of the nucleocápside gen (558bp) reveals the virus is Orthotospovirus tomatomaculae (Tomato spotted wilt virus) with a 97% homology. Seed transmission is 2% while mechanical transmission is 40%. This is the first report of an Orthotospovirus affecting faba bean in Nariño, posing a risk to food security. [ABSTRACT FROM AUTHOR]

In the present study, the aim was to predict and validate putative candidate genes underlying drought‐tolerant quantitative trait loci (QTLs) in rice crop using in silico approaches and real‐time polymerase chain reaction (RT‐PCR). The genes underlying major drought‐tolerant QTLs which have been reported by data mining, sequence variation, gene ontology analysis, quantitative traits gene finder and gene expression analysis were subjected to RiceVarmap software to design primers, and only a few variants gave the SNP/InDel primers; thus, finally, 15 primers were ultimately selected, which were used in identification of differentially expressed genes (DEGs) among contrasting rice genotypes IR 64 and N 22 for drought tolerance trait using quantitative RT‐PCR studies by providing drought stress treatment during panicle initiation stage. In this investigation, we predicted 11 genes as candidate genes underlying drought‐tolerant QTLs. Out of these, only four QTLs were found responsible for the major effect in drought tolerance regions such as QTL‐Qsn‐4b, QTL‐rn7a, QTL‐Qtgw‐2a and QTL‐phc4.1 and 11 prioritized candidates were identified that expressed in leaf tissues. Only four primers belong to two QTLs, primer vg0712623096 from QTL‐rn7a (LOC_Os07g22450) located on chromosome‐7 encoding NAC domain‐containing protein and the primers vg0431750843(LOC_Os04g53310) encoding soluble starch synthase 3‐ chloroplast precursor, vg0432626757 (LOC_Os04g54850) encoding pectin acetylesterase domain‐containing protein and vg0433031562 (LOC_Os04g55520) encoding AP2 domain‐containing protein, from QTL‐Qsn‐4b, located on chromosome‐4 found to have higher differential expression in N 22 in comparison with IR 64 during drought stress as per quantitative RT‐PCR 2–ΔΔCt values. Considering the overall study, these four primers/genes were identified as candidate genes underlying genomic regions governing drought tolerance. Therefore, these putative candidate genes could be focussed for further functional analysis to exploit in rice breeding. [ABSTRACT FROM AUTHOR]

Purpose: To study the positivity rate of conjunctival realtime polymerase chain reaction (RT-PCR) testing for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Design: Systematic review and diagnostic accuracy meta-analysis. Methods: MEDLINE and EMBASE were queried using medical subject headings terms. Diagnostic accuracy meta-analyses and forest plots were obtained using the RevMan software. Results: After deduplication, appraisal of abstract titles and full-text analysis of 1441 articles, 42 articles with 3351 COVID-19 patients were included in this review. Of these, 412 conjunctival swabs/Schirmer paper strips tested positive for SARS-CoV-2 by RT-PCR. The pooled sensitivity of the RT-PCR tests across the 24 studies with laboratory-confirmed COVID-19 patients was 10.3%. Conclusions: Only 1 in 10 RT-PCR tests performed on conjunctival swabs were positive for SARS-CoV-2. Although this suggests that SARS-CoV-2 is likely present and detectable in the conjunctiva, this detection method has low diagnostic potential. [ABSTRACT FROM AUTHOR]

Fluoxetine, being a selective serotonin uptake inhibitor, has been broadly used to modulate the neurotransmission of serotonin in the central nervous system. Fluoxetine performs a number of crucial central nervous system-related tasks, including neuroprotective effects against microglial neurotoxicity and protecting oxidative cell damage produced by stress in a variety of stress-related unfavourable health disorders. Studies have shown that the drug (fluoxetine) also has analgesic and anti-inflammatory characteristics in addition to its other basic benefits. Furthermore, existing treatment approaches (NSAIDs, DMARDs, corticosteroids and other immunosuppressants) for RA have limited effects on chronic immunological models. These facts served as the basis for carrying out a study on fluoxetine to explore its therapeutics in a chronic inflammatory rat model called Freund's complete adjuvant (FCA)-induced arthritis. The therapeutic effect of the fluoxetine in FCA-induced arthritic rats was assessed by paw volume, paw diameter, arthritic index and body weight at specific days through the experiment of 28 days. These findings were further co-investigated by haematological, biochemical parameters and radiographic imaging at the end of experiment. Furthermore, the modulatory effects on gene expression (NF-κB, PGE2, COX2, INF-γ, IL-4 and IL-10) and antioxidant properties were gritty using qRT-PCR and ELISA kits, respectively, in experimental arthritic rats. Fluoxetine at 10, 20 and 40 mg/kg doses reduced (p < 0.001) the serum concentration of C-reactive protein and rheumatoid factor as well as suppressed the expression of PGE2, NF-kB, COX2 and INF-γ when compared to arthritic control. Moreover, fluoxetine (at higher doses) caused significant rise of IL-4 and IL-10. These findings supported the anti-inflammatory and antioxidant potential of fluoxetine in chronic inflammatory model and endorsed it for clinical trials. [ABSTRACT FROM AUTHOR]

A novel grapevine viroid was discovered in an asymptomatic grapevine of Indian rootstocks. The whole genome sequence of the viroid (370 nt) was determined by high-throughput sequencing as well as RT-PCR followed by cloning and Sanger sequencing. The terminal conserved region (TCR), central conserved region (CCR) upper strand, and CCR lower strand are conserved regions found in the viroid that are unique to the members of the genus Apscaviroid. Based on our findings and the demarcation criteria for viroids, the novel viroid, which we have tentatively named "grapevine yellow speckle viroid 3" is a putative new member of the genus Apscaviroid. [ABSTRACT FROM AUTHOR]

Background: Avian metapneumovirus (aMPV) is a widespread infectious respiratory pathogen affecting turkeys and chickens, with co-predominance of the subtypes A and B. Objectives: There is no official reports in Morocco about the subtypes of aMPV circulating. Hence, using quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) subtypesspecific A and B, we aimed at detecting and identifying the potential subtype(s) circulating. Methods: We conducted a longitudinal study on three broiler flocks that were strictly not vaccinated against aMPV and were located in two different geographical regions. We studied two flocks that expressed typical swollen head syndrome (SHS) and sampled them once. Furthermore, we sampled dead birds of one flock confirmed seropositive from a previous study. A total of 118 swabs pooled in 24 samples were subjected to RNA extraction and amplified using a triplex RT-PCR for specific detection of aMPV subtypes A and B. Additionally, serum samples were taken at slaughtering age to cross-check the molecular results. A total of 84 sera were analyzed with a commercial indirect enzyme-linked immunosorbent assay (ELISA) kit to detect and titer antibodies against the two subtypes. Results: Avian metapneumovirus was detected by qRT-PCR in all flocks. About 87.50% of the samples were positive for aMPV-B, and 16.67% for aMPV-A and aMPV-B simultaneously. All flocks showed seropositivity, confirming the molecular findings. Conclusion: The present investigation is the first molecular study in Morocco to elucidate the circulation of aMPV-A and aMPV-B in broiler farms in Morocco with a dominance of aMPV-B and the possibility of co-presence of both subtypes. [ABSTRACT FROM AUTHOR]

Background Doxorubicin (DOX) is a broad-spectrum antitumor drug while its use is limited nowadays due to its neurobiological side effects associated with depression. Bone marrow mesenchymal stem cells (BM-MSCs) derived exosomes are a promising regenerative therapy. In this study, we investigated the therapeutic potentiality of BM-MSCs derived exosomes against the neurotoxicity induced by DOX. Methods Twenty-four male albino rats were divided equally in to three groups as follow: group 1 (control), group 2 (rats injected intraperitoneally (i.p|) with DOX at a dose 2.5mg/Kg), and group 3 (rats injected with DOX and BM-MSCs derived exosomes i.p at a dose 1.5ml/Kg). During the experiment the behavior tests were noted, after three weeks rats were sacrificed, serum and brain samples were collected for biochemical, molecular and histopathological examinations. Results The results revealed that DOX causing impairment of the locomotor and increasing the anxiety like behavior of rats, marked neuropathological changes, significant elevation of MDA content and TNF-α concentration, reduction of phospholipase (PLD) and acetylcholinesterase (AChE) protein concentration in addition, there were up regulation of JNK, NF-κB and p38 genes and down regulation of Erk1. Conclusion Exosomal therapy improved the substantial neurotoxicity of DOX through modulating the markers involved in the neurotoxic signalling pathway of DOX that resulting in improving the pathological lesions and the animal behaviours. [ABSTRACT FROM AUTHOR]

This study investigated the genotype classification and pathogenicity of infectious bursal disease virus (IBDV) circulating in vaccinated broiler chicken farms in Egypt. A total of 150 samples were collected from 30 vaccinated commercial broiler chicken farms and pooled into 30 working samples. IBDV was tested using reverse transcriptase polymerase chain reaction (RT-PCR) amplification of the hypervariable region of the viral protein 2 (hvVP2) and the VP1 gene 5' extremity. Both RT-PCR fragments were sequenced from six samples, and then the obtained nucleotide sequences were analyzed. The IBDV genotypes were identified using nucleotide sequences. Five sequences of the six strains examined were classified as genotype A3B2 for the highly virulent segments A and B (vv-A/vv-B IBDV). Interestingly, this study identified and classified a novel segment-reassortant strain as the A1B2 genotype. Specifically, it involved the segment reassortment of classical virulent segment A (cv-A) with vv-B producing cv-A/vv-B reassortant IBDV. Subsequently, we compared the pathogenicity of reassortant (cv-A/vv-B) IBDV and vvIBDV strains identified in this study. Both strains developed typical IBD clinical signs, postmortem lesions, histopathology, immunohistochemistry, and lesion scores, which were more severe in vvIBDV than reassortant IBDV. In conclusion, this is the first report of the genotype classification based on both genome segments (hvVP2 and VP1) with pathogenicity of IBDV circulating in vaccinated broiler chicken farms and this pathogenicity is more severe in vvIBDV strain than a novel reassortant IBDV strain. [ABSTRACT FROM AUTHOR]

Background: Radiation-induced liver disease (RILD) is a severe complication arising from radiotherapy, particularly when treating abdominal malignancies such as hepatocellular carcinoma. The liver's critical role in systemic metabolism and its proximity to other abdominal organs make it highly susceptible to radiation-induced damage. This vulnerability significantly limits the maximum safe therapeutic dose of radiation, thereby constraining the overall efficacy of radiotherapy. Among the various modalities, electron beam therapy has gained attention due to its ability to precisely target tumors while minimizing exposure to surrounding healthy tissues. However, despite its advantages, the long-term impacts of electron beam exposure on liver tissue remain inadequately understood, particularly concerning chronic injury and fibrosis driven by sustained oxidative stress. Objectives: to investigate the molecular and cellular mechanisms underlying the radioprotective effects of vitamin C in a model of radiation-induced liver disease. Methods: Male Wistar rats (n = 120) were randomly assigned to four groups: control, fractionated local electron irradiation (30 Gy), pre-treatment with vitamin C before irradiation, and vitamin C alone. The study evaluated the effects of electron beam radiation and vitamin C on liver tissue through a comprehensive approach, including biochemical analysis of serum enzymes (ALT, AST, ALP, and bilirubin), cytokine levels (IL-1β, IL-6, IL-10, and TNF-α), and oxidative stress markers (MDA and SOD). Histological and morphometric analyses were conducted on liver tissue samples collected at 7, 30, 60, and 90 days, which involved standard staining techniques and advanced imaging, including light and electron microscopy. Gene expression of Bax, Bcl-2, and caspase-3 was analyzed using real-time PCR. Results: The present study demonstrated that fractional local electron irradiation led to significant reductions in body weight and liver mass, as well as marked increases in biochemical markers of liver damage (ALT, AST, ALP, and bilirubin), inflammatory cytokines (IL-1β, IL-6, and TNF-α), and oxidative stress markers (MDA) in the irradiated group. These changes were accompanied by substantial histopathological alterations, including hepatocyte degeneration, fibrosis, and disrupted microvascular circulation. Pre-treatment with vitamin C partially mitigated these effects, reducing the severity of the liver damage, oxidative stress, and inflammation, and preserving a more favorable balance between hepatocyte proliferation and apoptosis. Overall, the results highlight the potential protective role of vitamin C in reducing radiation-induced liver injury, although the long-term benefits require further investigation. Conclusions: The present study highlights vitamin C's potential as a radioprotective agent against electron beam-induced liver damage. It effectively reduced oxidative stress, apoptosis, and inflammation, particularly in preventing the progression of radiation-induced liver fibrosis. These findings suggest that vitamin C could enhance radiotherapy outcomes by minimizing liver damage, warranting further exploration into its broader clinical applications. [ABSTRACT FROM AUTHOR]

Titanium and its alloys are commonly used in dentistry for implants due to their strength, lightweight nature, durability, corrosion resistance, and biocompatibility. These implants can osseointegrate after surface treatments such as SLA, plasma-spray, and nanotubes, providing a stable foundation for prostheses. However, Candida albicans, an opportunistic fungal pathogen, can threaten the success of titanium dental implants, causing oral infections in vulnerable individuals. A dual novel silane blend of 3-acryloxypropyltrimethoxysilane (ACPS) and bis-1,2-(triethoxysilyl)ethane (BTSE) has been shown to improve the shear bond strength in resin cement bonds with titanium and ceramics. This study evaluated the effects of Candida albicans colonization on blended silane-coated SLA-Ti surfaces compared to non-coated SLA-Ti (positive control) and flat titanium (negative control). Candida albicans biofilms were cultured on all surfaces, and it was found that silane-coated SLA-Ti had significantly lower CFU counts than non-coated SLA-Ti. However, no significant differences were observed in the RT-PCR results. In conclusion, a combination of 1.0 vol% ACPS and 0.3 vol% BTSE shows promise as a silane coupling agent with potential antifungal properties for inhibiting Candida albicans proliferation. [ABSTRACT FROM AUTHOR]

Duck hepatitis A virus (DHA) is very fatal viral disease affecting young ducklings under one month old. The disease is generally spread among duckling flocks inducing sever dramatic and economic losses. The present research highlights investigation of duck hepatitis virus through collection of hundred spleen and liver field samples from various commercial 3-11 days old duckling sectors (Pekin and Mullard) at ten Egyptian governorates in 2022 and 2023 with historical view of high mortalities and nervous manifestations with background of previous immunization. The clinically infected specimens were directly screened using RT-PCR assay to detect duck hepatitis A virus through amplification of VP1 gene that reveals only one sample (obtained from Menofia governorate) was positive for DHAV-3. BLAST analysis of Partial obtained sequence of VP1 gene showed that it was closely related Egyptian strain (accession number OR543968) besides nucleotides and amino acid changes were observed in comparison with other strains. Phylogenetic analysis of the obtained strain revealed clustering with viruses of Chinese origin and distinctive from vaccinal strains utilized in Egypt. Successful isolation of duck hepatitis A virus was achieved through inoculation of tissue homogenates into allantoic cavity of 9-11 day old embryonated chicken eggs. The outcomes of this work supplied rationalized knowledge about the epidemiological criteria of DHA virus in Egypt; emphasize the significance of DHA survey and vaccine selection. [ABSTRACT FROM AUTHOR]

Background: Peste des Petits Ruminants (PPR) is an economically significant transboundary viral disease of sheep and goats caused by the PPRV virus, affecting annual losses of 1.45–2.10 billion US dollars globally. We designed the current study to evaluate the positive cases, molecular characterization, phylogenetic analysis, and risk factors correlated with the disease in various districts of Khyber Pakhtunkhwa, Pakistan, with the aim of contributing to these strategies. Methods and results: A total of 384 samples from three selected districts, i.e., Peshawar, Charsadda and Chitral (n = 128 each), were collected, and the virus was investigated by using the sandwich ELISA, while the N gene of the virus was used as a target for molecular detection via RT-PCR. The confirmed samples were then sequenced, and phylogenetic analysis was performed. According to our findings, the highest positive cases was found in district Peshawar (50.87%), followed by Charsadda and Chitral (24.56%), respectively, while risk factor analysis showed that certain categories, such as species, sex, and age less than two years, have higher risk (P < 0.05) in contrast to their respective categories. Furthermore, sequencing and phylogenetic analysis of representative samples showed that the PPRV strains in the current study clustered in lineage IV, which is circulating in the small ruminant population of Asia, the Middle East, and African countries. Comparative residue analysis highlighted the mutation by representing 242 variable sites out of 371 locations. Conclusions: PPRV has foremost importance in Pakistan because the virus was detected in a considerable number of samples, and most of which were sourced from subsidiary areas where veterinary services are not prioritized. [ABSTRACT FROM AUTHOR]

Recurrence of thrombotic events during aspirin therapy is known as aspirin resistance (AR). This study aimed to investigate the rate of AR, the factors influencing AR in patients with acute ischemic stroke under regular aspirin use, and the relationship between AR and ABCB1 (MDR-1) C3435T (rs1045642) polymorphism. Throughout this multicenter prospective study, 174 patients with acute ischemic stroke who had been prescribed aspirin for at least one month due to the risk of vascular disease, along with 106 healthy volunteers, were included as part of the study group. The results of our study indicate that AR was detected in 21.3% of the patient group. According to the results of an analysis of the polymorphism of the ABCB1 C3435T in patients with AR compared to those with aspirin sensitivity, patients with AR possessed more heterozygous (CT) and homozygous genotypes (TT) than those with aspirin sensitivity (p = 0.001). Based on multivariate logistic regression analysis of factors affecting AR in acute ischemic stroke patients, hypertension (OR: 5.679; 95% CI: 1.144–28.19; p = 0.034), heterozygous (CT) genotype (OR: 2.557; 95% CI: 1.126–5.807; p = 0.025), increased platelet values (OR: 1.005; 95% CI: 1.001–1.009; p = 0.029), and CRP/albumin values (OR: 1.547; 95% CI: 1.005–2.382; p = 0.047) were found to be associated with a greater risk of AR. The presence of heterozygous (CT) genotype in the ABCB1 C3435T gene region in the Turkish population is associated with an increased risk of AR. When planning aspirin therapy, it is crucial to consider the ABCB1 (MDR-1) C3435T polymorphism. [ABSTRACT FROM AUTHOR]

Abstract Background The possibility of considering Culex pipiens (Cx. pipiens) as a vector for transmitting the hepatitis C virus (HCV) is controversial and needs further investigation. This work aimed to detect the possibility of transmission of the hepatitis C virus by Cx. pipiens and the role of the bacterial microbiota in their midgut. Main body Two groups of symbiotic and aposymbiotic of female Cx. pipiens were infected with the hepatitis C virus using an artificial feeding membrane technique. The viral load was detected in the head region for up to 60 min in the infected symbiotic group and 90 min in the aposymbiotic group. The midgut region can harbor the virus for 5 days after feeding. The absence of gut microbiota increases the potentiality of ten females to carry high titer of infective dose (1.2 × 106 IU/ml) of HCV genotype 4a for 6 days. The bacterial midgut microbiota appears to play a significant role in the transmission of HCV. On the other hand, HCV was not detected in the salivary glands of either symbiotic or aposymbiotic mosquitoes during the detection period. Cx. pipiens can transmit HCV from infected female adult mosquitoes to HCV-negative human blood in vitro. The biological parameters were survival rate, blood feeding, oviposition, hatchability rates, and mean digestion period of Cx. pipiens after infection with HCV showed significant changes. Moreover, an ex vivo assay demonstrated that HCV-infected mosquitoes could transmit the virus RNA into healthy blood. Conclusion The results suggested that the mosquitoes’ mechanical transmission of HCV was reasonable. In addition, the mosquito microbiome played a significant role in determining the potentiality of mosquitoes as a vector for disseminating HCV infections. Graphic abstract

Abstract Background The dilution-replicate experimental design for qPCR assays is especially efficient. It is based on multiple linear regression of multiple 3-point standard curves that are derived from the experimental samples themselves and thus obviates the need for a separate standard curve produced by serial dilution of a standard. The method minimizes the total number of reactions and guarantees that Cq values are within the linear dynamic range of the dilution-replicate standard curves. However, the lack of specialized software has so far precluded the widespread use of the dilution-replicate approach. Results Here we present repDilPCR, the first tool that utilizes the dilution-replicate method and extends it by adding the possibility to use multiple reference genes. repDilPCR offers extensive statistical and graphical functions that can also be used with preprocessed data (relative expression values) obtained by usual assay designs and evaluation methods. repDilPCR has been designed with the philosophy to automate and speed up data analysis (typically less than a minute from Cq values to publication-ready plots), and features automatic selection and performance of appropriate statistical tests, at least in the case of one-factor experimental designs. Nevertheless, the program also allows users to export intermediate data and perform more sophisticated analyses with external statistical software, e.g. if two-way ANOVA is necessary. Conclusions repDilPCR is a user-friendly tool that can contribute to more efficient planning of qPCR experiments and their robust analysis. A public web server is freely accessible at https://repdilpcr.eu without registration. The program can also be used as an R script or as a locally installed Shiny app, which can be downloaded from https://github.com/deyanyosifov/repDilPCR where also the source code is available.

A machine learning‐based approach was utilized to develop a device for groundnut bud necrosis virus (GBNV) disease severity detection and estimation in tomato plants (Solanum lycopersicum L.). The study involved inoculating tomato plants with GBNV, monitoring changes in morphological and spectral characteristics, evaluating machine learning algorithms (decision tree [DT] classifier) for analysis and classification of disease severity, and developing and validating a device for disease detection and severity estimation. Spectral data analysis revealed distinct patterns in reflectance, with notable peaks observed in the 680 and 760 nm bands, while reflectance remained low and constant beyond 900 nm. Machine learning techniques, specifically a DT model, were employed to classify disease severity based on spectral data with high accuracy (95.01% training accuracy and 93.65% testing accuracy). The model identified the near‐infrared band as highly correlated (correlation coefficient of 0.82) with disease severity. Furthermore, a compact handheld device integrating a spectral sensor, organic light‐emitting diode display, and Raspberry Pi 3B was developed for real‐time disease severity estimation. The device demonstrated robust performance, accurately predicting disease severity at different growth stages, even in the absence of visible symptoms. Additionally, disease severity percentages obtained via reverse transcription polymerase chain reaction were used to validate the accuracy of the device's estimations. Its responsive nature, with estimated response times ranging from milliseconds to seconds, facilitates timely interventions in agricultural settings. Overall, this interdisciplinary approach, combining spectral analysis, machine learning, and device development, presents a promising solution for efficient disease monitoring and management in agriculture, contributing to enhanced crop health and food security. [ABSTRACT FROM AUTHOR]

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like Rat Meat (RM). Aim: This study aims to develop a Real-Time Polymerase Chain Reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other 8 species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in 8 marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs. [Open Vet J 2024; 14(9.000): 2484-2492]

Abstract Background Although there have been reports of COVID-19 breakthrough infections in vaccinated individuals, the vaccines have demonstrated a high efficacy in preventing severe illness and death. Nepal has reported fewer studies of COVID-19 breakthrough infections. Hence, this study has objective to assess the prevalence, and to describe clinical characteristics of severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) breakthrough infection. Methods This descriptive study was conducted from January to December 2022. The study enrolled 200 individuals who had received the recommended doses of the COVID-19 vaccine and they were RT-PCR positive diagnosed with vaccine breakthrough infections after 14 days of completing the vaccination course. The patient’s demographic and clinical profiles, as well as their outcomes in terms of severity, length of hospital stay, and mortality were recorded. Results The prevalence of SARS-CoV2 infection was 6.3% (547/8682). Among fully vaccinated personnel, the prevalence of breakthrough infections was 6.2% (200/3175). This study found the Omicron variants in respondents. The mean age of the patients was 38.28 years, and 41.5% (83/200) of the breakthrough cases were healthcare workers. The mean time gap between the second dose of vaccination and a positive RT-PCR test was 354.68 days. Of the 200 breakthrough cases, 89% (178) had mild symptoms, 9% (17) had moderate symptoms requiring hospitalization, and 2% (4) were severe cases that required intensive care facility. Among the severe cases, 3 out 4 were above 60 years old. Furthermore, the patients greater than 60 years had longer hospital stays (p

Background & objectives: Dengue fever is a mosquito-bome illness that affects millions of people worldwide every year. With no vaccination available, early detection and treatment are critical. It is found in 112 countries and poses a risk to travellers, particularly in metropolitan areas. Laboratory diagnoses vary according to objectives, resources, and schedule, with sensitivity and specificity must be balanced for effective testing. Methods: The current study is a cross-sectional diagnostic study and samples from suspected patients of dengue was collected from May to November 2023 and transported to laboratory. RT-PCR and Dengue Duo Rapid test diagnosis techniques were used and total 48 clinical samples were included in this study. Results: A total of 48 clinical samples were collected. Blood was collected from the suspected cases of dengue and further subjected to different molecular and serological parameters. Serum was separated from all blood samples. RNA was isolated by silica column extraction method which is further utilized as a template for amplification and detection of dengue serotyping. Master Mix was prepared for the amplification and detection of dengue virus by Rotor-Gene Q Real-Time PCR Machine and further serological profiling of positive dengue cases was studied by conventional PCR. Interpretation & conclusion: Our laboratory effectively standardized an RT-PCR-based approach for molecular identification of dengue virus in clinical specimens. This adaptive technique, which uses numerous primer sets, displayed good specificity and sensitivity in serotype detection. The technology provides for quick and reliable identification of dengue virus infections, allowing for targeted treatment and preventative actions for successful disease management in highly populated regions.

Abstract Background This hospital-based cross-sectional study aims to investigate the epidemiologic and clinical characteristics of rotavirus group A (RVA) infection among children with acute gastroenteritis and to detect the most common G and P genotypes in Egypt. Methods A total of 92 stool samples were collected from children under five who were diagnosed with acute gastroenteritis. RVA in stool samples was identified using ELISA and nested RT-PCR. Common G and P genotypes were identified utilizing multiplex nested RT-PCR assays. Results RVA was detected at a rate of 24% (22 /92) using ELISA and 26.1% (24 /92) using VP6 nested RT-PCR. The ELISA test demonstrated diagnostic sensitivity, specificity, and accuracy of 91.7%, 100%, and 97.8%, respectively. G3 was the most prevalent G type (37.5%), followed by G1 (12.5%), whereas the most commonly detected P type were P[8] (41.7%) and P[6] (8.2%). RVA-positive samples were significantly associated with younger aged children (p = 0.026), and bottle-fed (p = 0.033) children. In addition, RVA-positive samples were more common during cooler seasons (p = 0.0001). Children with rotaviral gastroenteritis had significantly more frequent episodes of diarrhea (10.87 ± 3.63 times/day) and vomiting (8.79 ± 3.57 times/day) per day (p = 0.013 and p = 0.011, respectively). Moreover, they had a more severe Vesikari clinical score (p = 0.049). Conclusion RVA is a prevalent cause of acute gastroenteritis among Egyptian children in our locality. The discovery of various RVA genotypes in the local population, as well as the identification of common G and P untypeable strains, highlights the significance of implementing the rotavirus vaccine in Egyptian national immunization programs accompanied by continuous monitoring of strains.

One hundred and twenty shallot (Allium cepa var. aggregatum) and 22 garlic (Allium sativum) samples were collected from major growing regions and markets to determine the distribution and molecular diversity of 3 potyviruses: leek yellow stripe virus (LYSV), onion yellow dwarf virus (OYDV), and shallot yellow stripe virus (SYSV) in Indonesia. The results of reverse transcription-polymerase chain reaction (RT-PCR) showed that 83% of shallot and all garlic samples were infected by at least 1 virus species. Coat protein (CP) region of 8 Indonesian LYSV, 19 OYDV, and 10 SYSV isolates were sequenced and given accession nos. OR772038-OR772082 in NCBI GenBank. Five isolates were recombinants according to analysis using the Recombination Detection Program (RDP v5.30). The phylogenetic tree deduced that 6 LYSV Indonesian and 2 China imported isolates belong to S-type. All tested OYDV isolates, including the 19 isolates, were clustered separately according to their respective hosts: onion and garlic. The 10 Indonesian SYSV isolates were clustered together in the same group and thus shown to be closely related. All isolates tested in this study were estimated to be still within their respective species demarcation according to percentage identity analysis. This was the most comprehensive molecular study on LYSV, OYDV, and SYSV that may help to find sustainable management strategies according to conditions in Indonesia and contribute to the global knowledge on the genetic diversity of the 3 viruses.

Abstract Background Pakistan reported 1.57 million COVID-19 cases between 2020 and 2022, based on approximately 30.6 million SARS-CoV-2 RT-PCR (reverse-transcription polymerase chain reaction) tests conducted. This study utilized data from one of the largest in-country testing facilities, Aga Khan University Hospital (AKUH) in Karachi, Pakistan, to explore gender and age-related in RT-PCR testing patterns. Methods We conducted a retrospective review of SARS-CoV-2 RT-PCR test data extracted from AKUH clinical laboratory records between February 2020 and February 2022. Gender and age distributions were examined in the context of testing patterns across the period. Multivariate regression models assessed independent associations between COVID-19 positivity and key variables. Results We reviewed 470,249 RT-PCR tests, finding that most tests were in those aged 21–40 years (48.1%). Overall, COVID-19 test positivity was 20.6%. In all, 57.7% were performed for males, predominant amongst those tested across all age groups and waves. Females had significantly lower odds of testing positive for COVID-19 (OR: 0.9; 95% CI: 0.9-1.0). However, when adjusted for gender, age and pandemic phases, the positivity rates between males and females were the same. The odds of a positive result increased significantly with age; individuals aged > 80 years had 2.5 times higher odds of testing positive than those aged 0–10 years (aOR 2.5, 95% CI 2.3–2.7). Conclusions The analysis indicates a consistent male dominance in COVID-19 testing, with higher positivity rates in older age groups. Our study highlight the importance of examining demographic characteristics in disease associated data especially, representation of females amongst cohorts.

Among the many diseases that affect potato plants, viral infections are the most common and cause significant damage to farms, affecting both the yield and quality of potatoes. In this regard, an important condition for preserving the potato seed fund in Russia is systematic monitoring and early highly specific detection of potato viral infections. The purpose of the work is to study samples of potato varieties collected in the Novosibirsk region for the presence of viral infections using RT-PCR. 130 potato plants from three districts of the Novosibirsk region (NR) were studied. As a result of monitoring, the following viruses were identified: PVY (potato virus Y), PVS (potato virus S), PVM (potato virus M) and PVX (potato virus X). The quarantine pathogen potato spindle tuber viroid (PSTVd) was not detected in any of the samples analyzed. The maximum frequency of occurrence in the region was noted for three viruses: PVY, PVM and PVS. A significant proportion of the samples were mixed viral infections: the occurrence of the combination of infection PVY + PVM in plants was 25.0 %, and PVY + PVS, 22.6 %. To develop methods for determining the strain affiliation of the studied samples, the nucleotide sequences of the capsid protein genes of 10 Y-virus isolates were sequenced. Phylogenetic analysis of the studied sequences of NR isolates was carried out with a set of sequences of reference strains 261-4, Eu-N, N:O, NE-11, NTNa, NTNb, N-Wi, O, O5, SYR_I, SYR_II and SYR_III retrieved from GenBank. As a result of phylogenetic analysis, it was established that NR viral samples fell into two groups of strains: group 1, which also includes isolates of the reference strains 261-4/SYR_III, and group 2, NTNa. The obtained results of the strain affiliation of NR samples lay the basis for the development of DNA and immunodiagnostic systems for identifying PVY circulating in NR, as well as for elucidating the source and routes of entry of specific virus strains.

The present study aims to evaluate the effect of Sepia pharaonis ink on insulin resistance in PCOS-induced mice. Treatment with sepia ink in dehydroepiandrosterone (DHEA)-induced PCOS mice at various doses of 50 mg/kg, 100 mg/kg, and 200 mg/kg body weight mitigated the insulin resistance in the study groups with decreased concentration of testosterone and increased concentrations of estrogen and progesterone compared to the PCOS group tested by ELISA. The histopathological analysis and restoration of glucose analysis showed a significant reduction in treatment groups. Reduced expression of insulin resistance genes like androgen receptor (AR), insulin receptor substrate 1 (IRS-1), and insulin-like growth factor1 (IGF-1) by qRT-PCR indicate a positive impact of sepia ink in alleviating the symptoms associated with PCOS. Taken together, the results of this study indicate sepia ink as a promising therapeutic intervention and a possible drug target for insulin resistance in diabetes and gynecological disorders like PCOS.

Bo Liu,&ast; Yao Zhang,&ast; Zheng Yuan, Qiang Zhang Department of Orthopaedics, Beijing Ditan Hospital, Capital Medical University, National Center for Infectious Diseases, Beijing, 100015, People’s Republic of China&ast;These authors contributed equally to this workCorrespondence: Qiang Zhang, Department of Orthopaedics, Beijing Ditan Hospital, Capital Medical University, National Centre for Medical Infectious Diseases, No. 8 Jingshun Eest Road, Beijing, 100015, People’s Republic of China, Email sydtzhangqiang@163.comBackground: Brucellosis is a zoonotic disease that can affect various organs, including the spine. Cervical spondylitis caused by Brucella is rare but can lead to significant morbidity if not diagnosed and treated promptly.Case Presentation: We report a case of a 46-year-old female who presented with intermittent high fever and intractable neck, shoulder, and back pain for two months. She was diagnosed with Brucella cervical spondylitis based on clinical manifestations, Rose-Bengal Plate Agglutination Test (RBPT, positive), and cervical MRI findings. She was treated with a combination of antibiotics for at least two weeks, followed by surgical intervention including abscess clearance, partial vertebral resection, and titanium mesh bone fusion. Real-time Polymerase Chain Reaction (RT-PCR) confirmed the presence of sheep Brucella DNA. The patient recovered well postoperatively with significant pain reduction and restoration of full mobility in the right upper limb.Conclusion: This case highlights the diagnostic value of RT-PCR and tissue biopsy in cervical brucellosis spondylitis. Our study found that anterior cervical subtotal corpectomy can restore cervical stability, clear abscess, and relieve spinal cord compression on the basis of drug treatment, with good clinical results.Keywords: Brucellosis, cervical spondylitis, anterior cervical subtotal corpectomy, RT-PCR, gam staining, case report

Background: Coronavirus disease 2019 (COVID-19) continues to be a significant global public health issue. Aims and Objectives: This study aims to describe the demographic characteristics, comorbidities, clinical presentations, inflammatory biomarkers, and chest computed tomography (CT) findings of patients with severe acute respiratory infection (SARI) at a tertiary care hospital in Odisha, India. Additionally, the study aims to evaluate different COVID-19 diagnostic methods. Materials and Methods: A prospective observational study was conducted at a tertiary care hospital in Odisha, India. All admitted SARI patients underwent COVID-19 testing. Data on demographics, clinical presentations, laboratory investigations, and outcomes at 72 h were collected. COVID-19 diagnostic methods were also analyzed. Statistical Analysis: The statistical analysis was performed using GraphPad Prism 9.5. Results: Among the 830 patients studied, 305 tested positive for COVID-19. The rapid antigen test (RAT) demonstrated a sensitivity of 93.85% and a specificity of 97.43% compared to the real-time reverse transcriptase-polymerase chain reaction (RT-PCR) test. Discrepancies with RAT results were noted in cases with higher cycle threshold (Ct) values (>25). A male predominance was observed, with a mean age of 43.30 ± 15.19 years in the COVID-19-positive group and 40.95 ± 17.15 years in the COVID-19-negative group. Patients with multiple comorbidities (15.68%) had a higher susceptibility to COVID-19 infection. The COVID-19-positive group showed a significantly elevated neutrophil-to-lymphocyte ratio (NLR) (P = 0.0001) and thrombocytopenia (P = 0.001). Inflammatory biomarkers, including CRP, LDH, ferritin, D-dimer, and IL-6, were markedly elevated in swab-positive cases. Bilateral chest involvement and ground glass opacities were common radiological findings in both groups. Conclusion: In resource-limited settings, the RAT is considered an alternative screening tool for COVID-19. Initial laboratory and radiological investigations may aid clinicians in effective management of such patients.

The COVID-19 pandemic has spread worldwide for over two years. It was considered a significant threat to global health due to its transmissibility and high pathogenicity. The standard test for COVID-19, namely, reverse transcription polymerase chain reaction (RT–PCR), is somehow inaccurate and might have a high false-negative rate (FNR). As a result, an infected person with a negative test result may unknowingly continue to spread the virus, especially if they are infected with an undiscovered COVID-19 strain. Thus, a more accurate diagnostic technique is required. In this study, we propose 3Cs, which is a capsule neural network (CapsNet) used to classify computed tomography (CT) images as novel coronavirus pneumonia (NCP), common pneumonia (CP), or normal lungs. Using 6123 CT images of healthy patients’ lungs and those of patients with CP and NCP, the 3Cs method achieved an accuracy of around 98% and an FNR of about 2%, demonstrating CapNet’s ability to extract features from CT images that distinguish between healthy and infected lungs. This research confirmed that using CapsNet to detect COVID-19 from CT images results in a lower FNR compared to RT–PCR. Thus, it can be used in conjunction with RT–PCR to diagnose COVID-19 regardless of the variant.