Search

Hepatitis E virus (HEV) poses a significant global health threat, with an estimated 20 million infections occurring annually. Despite being a self-limiting illness, in most cases, HEV infection can lead to severe outcomes, particularly in pregnant women and individuals with pre-existing liver disease. In the absence of specific antiviral treatments, the exploration of RNAi interference (RNAi) as a targeted strategy provides valuable insights for urgently needed therapeutic interventions against Hepatitis E. We designed small interfering RNAs (siRNAs) against HEV, which target the helicase domain and the open reading frame 3 (ORF3). These target regions will reduce the risk of viral escape through mutations, as they belong to the most conserved regions in the HEV genome. The siRNAs targeting the ORF3 efficiently inhibited viral replication in A549 cells after HEV infection. Importantly, the siRNA was also highly effective at inhibiting HEV in the persistently infected A549 cell line, which provides a suitable model for chronic infection in patients. Furthermore, we showed that a 5′ triphosphate modification on the siRNA sense strand activates the RIG-I receptor, a cytoplasmic pattern recognition receptor that recognizes viral RNA. Upon activation, RIG-I triggers a signaling cascade, effectively suppressing HEV replication. This dual-action strategy, combining the activation of the adaptive immune response and the inherent RNAi pathway, inhibits HEV replication successfully and may lead to the development of new therapies. [ABSTRACT FROM AUTHOR]

The clinical development of tyrosine kinase inhibitors (TKI) has led to great strides in improving the survival of chronic myeloid leukemia (CML) and acute myeloid leukemia (AML) patients. But even the new generation TKIs are rendered futile in the face of evolving landscape of acquired mutations leading to drug resistance, necessitating the pursuit of alternative therapeutic approaches. In contrast to exploiting proteins as targets like most conventional drugs and TKIs, RNA Interference (RNAi) exerts its therapeutic action towards disease-driving aberrant genes. To realize the potential of RNAi, the major challenge is to efficiently deliver the therapeutic mediator of RNAi, small interfering RNA (siRNA) molecules. In this study, we explored the feasibility of using aliphatic lipid (linoleic acid and lauric acid)-grafted polymers (lipopolymers) for the delivery of siRNAs against the FLT3 oncogene in AML and BCR-ABL oncogene in CML. The lipopolymer delivered siRNA potently suppressed the proliferation AML and CML cells via silencing of the targeted oncogenes. In both AML and CML subcutaneous xenografts generated in NCG mice, intravenously administered lipopolymer/siRNA complexes displayed significant inhibitory effect on tumor growth. Combining siFLT3 complexes with gilteritinib allowed for reduction of effective drug dosage, longer duration of remission, and enhanced survival after relapse, compared to gilteritinib monotherapy. Anti-leukemic activity of siBCR-ABL complexes was similar in wild-type and TKI-resistant cells, and therapeutic efficacy was confirmed in vivo through prolonged survival of the NCG hosts systemically implanted with TKI-resistant cells. These results demonstrate the preclinical efficacy of lipopolymer facilitated siRNA delivery, providing a novel therapeutic platform for myeloid leukemias. [Display omitted] • Lipopolymers showed superior siRNA delivery in 'hard-to-transfect' leukemia cells. • Lipopolymer/siFLT3 complexes demonstrated therapeutic efficacy in FLT3-ITD AML animal models as monotherapy and in combination with gilteritinib. • Treatment with lipopolymer/siBCR-ABL complexes enhanced survival in mice bearing imatinib-resistant CML xenografts. [ABSTRACT FROM AUTHOR]

Hepatitis E virus (HEV) poses a significant global health threat, with an estimated 20 million infections occurring annually. Despite being a self-limiting illness, in most cases, HEV infection can lead to severe outcomes, particularly in pregnant women and individuals with pre-existing liver disease. In the absence of specific antiviral treatments, the exploration of RNAi interference (RNAi) as a targeted strategy provides valuable insights for urgently needed therapeutic interventions against Hepatitis E. We designed small interfering RNAs (siRNAs) against HEV, which target the helicase domain and the open reading frame 3 (ORF3). These target regions will reduce the risk of viral escape through mutations, as they belong to the most conserved regions in the HEV genome. The siRNAs targeting the ORF3 efficiently inhibited viral replication in A549 cells after HEV infection. Importantly, the siRNA was also highly effective at inhibiting HEV in the persistently infected A549 cell line, which provides a suitable model for chronic infection in patients. Furthermore, we showed that a 5′ triphosphate modification on the siRNA sense strand activates the RIG-I receptor, a cytoplasmic pattern recognition receptor that recognizes viral RNA. Upon activation, RIG-I triggers a signaling cascade, effectively suppressing HEV replication. This dual-action strategy, combining the activation of the adaptive immune response and the inherent RNAi pathway, inhibits HEV replication successfully and may lead to the development of new therapies.

Simple Summary: In this review, we discuss how miRNAs play a critical role in the regulation of mRNA stability and translation, how determining the direct targets of miRNAs in complex networks is extremely difficult, and how translating specific miRNAs to the clinic often results in failure. This has led to concerns that this approach may not be feasible. Using hsa-miR-429 as an example, we discuss the limitations encountered in the development of efficient miRNAs-related therapies and diagnostic approaches and how this can be improved. We also provide a literature analysis of the verified hsa-miR-429 targets in various human research models. A meta-analysis of this work should provide better insights into the role of hsa-miR-429 in cancer diagnosis and any potential therapeutic approaches. MicroRNAs (miRNAs) play a critical role in the regulation of mRNA stability and translation. In spite of our present knowledge on the mechanisms of mRNA regulation by miRNAs, the utilization and translation of these ncRNAs into clinical applications have been problematic. Using hsa-miR-429 as an example, we discuss the limitations encountered in the development of efficient miRNA-related therapies and diagnostic approaches. The miR-200 family members, which include hsa-miR-429, have been shown to be dysregulated in different types of cancer. Although these miR-200 family members have been shown to function in suppressing epithelial-to-mesenchymal transition, tumor metastasis, and chemoresistance, the experimental results have often been contradictory. These complications involve not only the complex networks involving these noncoding RNAs, but also the problem of identifying false positives. To overcome these limitations, a more comprehensive research strategy is needed to increase our understanding of the mechanisms underlying their biological role in mRNA regulation. Here, we provide a literature analysis of the verified hsa-miR-429 targets in various human research models. A meta-analysis of this work is presented to provide better insights into the role of hsa-miR-429 in cancer diagnosis and any potential therapeutic approach. [ABSTRACT FROM AUTHOR]

The recent pandemic of variants of concern (VOC) of severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) highlights the need for innovative anti‐SARS‐CoV‐2 approaches in addition to vaccines and antiviral therapeutics. Here, we demonstrate that a CRISPR‐Cas13‐based strategy against SARS‐CoV‐2 can effectively degrade viral RNA. First, we conducted a cytological infection experiment, screened CRISPR‐associated RNAs (crRNAs) targeting conserved regions of viruses, and used an in vitro system to validate functional crRNAs. Reprogrammed Cas13d effectors targeting NSP13, NSP14, and nucleocapsid transcripts achieved >99% silencing efficiency in human cells which are infected with coronavirus 2, including the emerging variants in the last 2 years, B.1, B.1.1.7 (Alpha), D614G B.1.351 (Beta), and B.1.617 (Delta). Furthermore, we conducted bioinformatics data analysis. We collected the sequence information of COVID‐19 and its variants from China, and phylogenetic analysis revealed that these crRNA oligos could target almost 100% of the SARS‐CoV family, including the emerging new variant, Omicron. The reprogrammed Cas13d exhibited high specificity, efficiency, and rapid deployment properties; therefore, it is promising for antiviral drug development. This system could possibly be used to protect against unexpected SARS‐CoV‐2 variants carrying multiple mutations. [ABSTRACT FROM AUTHOR]

Abstract The recent pandemic of variants of concern (VOC) of severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) highlights the need for innovative anti‐SARS‐CoV‐2 approaches in addition to vaccines and antiviral therapeutics. Here, we demonstrate that a CRISPR‐Cas13‐based strategy against SARS‐CoV‐2 can effectively degrade viral RNA. First, we conducted a cytological infection experiment, screened CRISPR‐associated RNAs (crRNAs) targeting conserved regions of viruses, and used an in vitro system to validate functional crRNAs. Reprogrammed Cas13d effectors targeting NSP13, NSP14, and nucleocapsid transcripts achieved >99% silencing efficiency in human cells which are infected with coronavirus 2, including the emerging variants in the last 2 years, B.1, B.1.1.7 (Alpha), D614G B.1.351 (Beta), and B.1.617 (Delta). Furthermore, we conducted bioinformatics data analysis. We collected the sequence information of COVID‐19 and its variants from China, and phylogenetic analysis revealed that these crRNA oligos could target almost 100% of the SARS‐CoV family, including the emerging new variant, Omicron. The reprogrammed Cas13d exhibited high specificity, efficiency, and rapid deployment properties; therefore, it is promising for antiviral drug development. This system could possibly be used to protect against unexpected SARS‐CoV‐2 variants carrying multiple mutations.

Rationale: Chronic wounds associated with diabetes exact a heavy burden on individuals and society and do not have a specific treatment. Exosome therapy is an extension of stem cell therapy, and RNA interference (RNAi)-based therapy is a type of advanced precision therapy. Based on the discovery of chronic wound-related genes in diabetes, we combined exosome therapy and RNAi therapy through an engineering approach for the treatment of diabetic chronic wounds. Methods: We combined exosome therapy and RNAi therapy to establish a precision therapy for diabetes-associated wounds via an engineered exosome approach. Results: First, chronic diabetic wounds express low levels of miR-31-5p compared with nondiabetic wounds, and an miR-31-5p mimic was shown to be effective in promoting the proliferation and migration of three wound-related cell types in vitro. Second, bioinformatics analysis, luciferase reporter assays and western blotting suggested that miR-31-5p promoted angiogenesis, fibrogenesis and reepithelization by inhibiting factor-inhibiting HIF-1 (HIF1AN, also named FIH) and epithelial membrane protein-1 (EMP-1). Third, engineered miR-31 exosomes were generated as a miR-31-5p RNAi therapeutic agent. In vivo, the engineered miR-31 exosomes promoted diabetic wound healing by enhancing angiogenesis, fibrogenesis and reepithelization. Conclusion: Engineered miR-31 exosomes are an ideal disease pathophysiology-initiated RNAi therapeutic agent for diabetic wounds.

Treatment options for COVID-19 remain limited. Here, we report the optimization of an siRNA targeting the highly conserved leader region of SARS-CoV-2. The siRNA was rendered nuclease resistant by the introduction of modified nucleotides without loss of activity. Importantly, the siRNA also retained its inhibitory activity against the emerged omicron sublineage variant BA.2, which occurred after the siRNA was designed and is resistant to other antiviral agents such as antibodies. In addition, we show that a second highly active siRNA designed against the viral 5′-UTR can be applied as a rescue molecule, to minimize the spread of escape mutations. We therefore consider our siRNA-based molecules to be promising broadly active candidates for the treatment of current and future SARS-CoV-2 variants. [Display omitted] • siRNA-CoV6 exhibits high antiviral activity against all SARS-CoV-2 s variant tested. • Reduced silencing activity due to mutations can be compensated by second siRNA. • The introduction modified nucleotides improves stability of the siRNA. • High potency and stability make siCoV6 a candidate for the treatment of COVID-19. [ABSTRACT FROM AUTHOR]

The discovery of RNA interference (RNAi) more than two decades ago opened avenues for avant‐garde cancer treatments that possess the ability to evade issues hampering current chemotherapeutic strategies, owing to its specific gene sequence‐driven mechanism of action. A potent short interfering RNA (siRNA) delivery vehicle designed to overcome physiological barriers is imperative for successful RNAi therapy. For this purpose, this study explored the characteristics and therapeutic efficacy of low‐molecular weight (MW) polyethylenimine (PEI) with high cholesterol substitution, yielding water‐insoluble polymers, in chronic myeloid leukemia (CML) K562 cells. A strong impact of cholesterol grafting on the physicochemical attributes of the resultant polymers and their corresponding complexes with siRNA was observed, with the siRNA binding capacity of polymers increasing and complex dissociation sensitivity decreasing with increase in cholesterol content of the polymers. The modified polymer complexes were significantly smaller in size and possessed higher cationic charge compared to the parent polymer. The interaction with anionic heparan sulfate preoteoglycans present on the cell surface was significant in cellular uptake of the complexes. The therapeutic efficacy of siRNA/polymer complexes was reflected in their ability to effectively silence the reporter green fluorescent protein gene and endogenous CML oncogene BCR‐ABL as well as significantly inhibit colony formation by K562 cells post BCR‐ABL silencing. The results of this study demonstrated beneficial effects of high levels of hydrophobic substitution on low MW PEI on their functional performance bestowing them the potential to be potent RNAi agents for CML therapy. [ABSTRACT FROM AUTHOR]

Abstract With the first RNA interference (RNAi) drug (ONPATTRO (patisiran)) on the market, we witness the RNAi therapy field reaching a critical turning point, when further improvements in drug candidate design and delivery pipelines should enable fast delivery of novel life changing treatments to patients. Nevertheless, ignoring parallel development of RNAi dedicated in vitro pharmacological profiling aiming to identify undesirable off-target activity may slow down or halt progress in the RNAi field. Since academic research is currently fueling the RNAi development pipeline with new therapeutic options, the objective of this article is to briefly summarize the basics of RNAi therapy, as well as to discuss how to translate basic research into better understanding of related drug candidate safety profiles early in the process.

In the course of antitumor therapy, the complex tumor microenvironment and drug-mediated changes in cell signaling and biological processes lead to drug resistance. The effect of sorafenib is greatly limited by the specific tumor microenvironment induced by antiangiogenic therapy and ferroptosis resistance induced by the upregulation of nuclear factor erythroid-2 related factor 2 (NRF2). In this study, a pH responsive and amphiphilic hyperbranched polyglycerol, HDP, is synthesized based on a co-graft click chemistry pathway. This nano-scale carrier provides excellent drug-loading capacity, storing stability and pH responsibility, and effectively co-delivery of sorafenib and siRNA. Sorafenib and siNRF2 plays a greatly synergistic effect in inducing reactive oxygen species (ROS), iron overloading, depleting glutathione (GSH), and promoting lipid peroxidation. Importantly, verified in two different animal experiments, HDP-ss (HDP loaded with both siNRF2 and sorafenib) presents a superior anti-tumor effect, by achieving a tumor inhibition rate of ≈94%. Thus, HDP can serve as an excellent targeted delivery nanocarrier with good biocompatibility in antitumor therapy, and combined application of siNRF2 effectively improves the antitumor effect of sorafenib by overcoming NRF2-mediated ferroptosis resistance. Taken together, this study provides a novel therapeutic strategy to combat the drug resistance in antiangiogenic therapy and ferroptosis., (© 2023 Wiley‐VCH GmbH.)

Severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5′ end, which is added to all subgenomic mRNAs at their 5′ terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in‐silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed‐duplex stability, exact complementarity with target, at least three mismatches with any off‐target and least number of off‐targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5′GUUUAGAGAACAGAUCUACAA3′ met almost all specificity criteria with no off‐targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of −327.45 for above‐mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off‐target sequences gave significantly low binding scores. Hence, 5′GUUUAGAGAACAGAUCUACAA3′ siRNA possess great potential to silence the leader sequence of SARS‐CoV‐2 with least off‐target effect. Present study provides great scope for development of gene therapy against the prevailing COVID‐19 disease, thus further research in this concern is urgently demanded. [ABSTRACT FROM AUTHOR]

Introduction: Primary hyperoxaluria (PH) is a rare genetic disorder of hepatic glyoxylate metabolism. Nedosiran is an RNA interference (RNAi) therapeutic that the US Food and Drug Administration has approved for treatment of PH1. PHYOX3 is a trial evaluating monthly nedosiran in patients with PH., Methods: In this PHYOX3 interim analysis, participants with PH1 who continued from a single-dose nedosiran trial (PHYOX1), with no previous kidney or liver transplantation, dialysis, or evidence of systemic oxalosis were eligible. The safety and efficacy of once-monthly nedosiran was assessed over 30 months., Results: Thirteen participants completed PHYOX1 and continued into PHYOX3. At baseline, the mean (SD) and median (range) age was 24.2 (6.6) years and 23.0 (14-39) years, respectively; 53.8% were female and 61.5% were White. Mean estimated glomerular filtration rate (eGFR) remained stable (62-84.2 mL/min per 1.73 m 2 ) to month 30. Mean 24-hour urinary oxalate (Uox) excretion showed a sustained reduction from baseline of ≥60% at every visit (months 2-30). From month 2, at least 10 of 13 (76.9%) participants achieved normal (<0.46 mmol/24h; upper limit of assay-normal [ULN]) or near-normal (≥0.46 to <0.60 mmol/24h; ≥ULN to <1.3 × ULN) 24-hour Uox excretion. All participants experienced ≥1 adverse event (AE), mostly mild or moderate in severity (primarily, injection site events). Three serious, not treatment-related AEs were reported; there were no deaths or study discontinuations due to AEs., Conclusion: Nedosiran was well-tolerated in patients with PH1, and treatment resulted in a sustained, substantial reduction in Uox excretion for at least 30 months in this long-term study. No safety signals have been identified to date. The PHYOX3 study is ongoing., (© 2024 International Society of Nephrology. Published by Elsevier Inc.)

RNA interference (RNAi) holds great promise for therapeutic applications. However, safe and successful clinical translation essentially requires further advancement of developing efficient delivery systems. Herein, we report that amphiphilic phospholipid peptide dendrimers (AmPPDs) could mediated effective delivery of siRNA targeting Hsp27 for treating castration-resistant prostate cancer (CRPC). AmPPDs bears natural lipid derivative DSPE as the hydrophobic tail and different dendritic l -lysine as the hydrophilic head, capable of compacting siRNA into nanoparticles to protect it from enzymatic degradation. Interestingly, DSPE-KK 2 , AmPPD bearing smaller hydrophilic dendron, promoting more efficient intracellular uptake and endosome release of the so-formed siRNA complexes, as well as better siRNA releasing ability, ultimately resulting in more potent gene silencing and anticancer effects both in vitro and in vivo. Such outstanding performance of DSPE-KK 2 in siRNA delivery may attribute to its optimal balance between the hydrophobic tail and hydrophilic dendritic portion. Our findings provide guidance for the development of safe and effective dendrimer-based siRNA delivery system, thus bringing new hope for combating various diseases. Unlabelled Image [ABSTRACT FROM AUTHOR]

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected almost 200 million people worldwide and led to approximately 4 million deaths as of August 2021. Despite successful vaccine development, treatment options are limited. A promising strategy to specifically target viral infections is to suppress viral replication through RNA interference (RNAi). Hence, we designed eight small interfering RNAs (siRNAs) targeting the highly conserved 5′-untranslated region (5′-UTR) of SARS-CoV-2. The most promising candidate identified in initial reporter assays, termed siCoV6, targets the leader sequence of the virus, which is present in the genomic as well as in all subgenomic RNAs. In assays with infectious SARS-CoV-2, it reduced replication by two orders of magnitude and prevented the development of a cytopathic effect. Moreover, it retained its activity against the SARS-CoV-2 alpha variant and has perfect homology against all sequences of the delta variant that were analyzed by bioinformatic means. Interestingly, the siRNA was even highly active in virus replication assays with the SARS-CoV-1 family member. This work thus identified a very potent siRNA with a broad activity against various SARS-CoV viruses that represents a promising candidate for the development of new treatment options.

Neeraj Prabhakar,1,2 Jixi Zhang,3 Diti Desai,1 Eudald Casals,1 Tina Gulin-Sarfraz,1 Tuomas Näreoja,2,4 Jukka Westermarck,5,6 Jessica M Rosenholm1 1Pharmaceutical Sciences Laboratory, Faculty of Science and Engineering, Åbo Akademi University, 2Laboratory of Biophysics, Faculty of Medicine, University of Turku, Turku, Finland; 3College of Bioengineering, Chongqing University, Chongqing, People’s Republic of China; 4Department of Neuroscience, Karolinska Institute, Stockholm, Sweden; 5Centre for Biotechnology, University of Turku and Åbo Akademi, 6Department of Pathology, University of Turku, Turku, Finland Abstract: Small interfering RNA (siRNA) is a highly potent drug in gene-based therapy with the challenge being to deliver it in a sustained manner. The combination of mesoporous silica nanoparticles (MSNs) and polycations in the confined pore space allows for incorporation and controlled release of therapeutic siRNA payloads. We hereby constructed MSNs with expanded mesopores and pore-surface-hyperbranched poly(ethyleneimine) (PEI) tethered with redox-cleavable linkers that could carry a high payload of siRNA (120 mg·g-1). The developed nanocarriers were efficiently taken up by cancer cells and were subsequently able to escape to the cytoplasm from the endosomes, most likely owing to the integrated PEI. Triggered by the intracellular redox conditions, the siRNA was sustainably released inside the cells over a period of several days. Functionality of siRNAs was demonstrated by using cell-killing siRNA as cargo. Despite not being the aim of the developed system, in vitro experiments using cell-killing siRNAs showed that the efficacy of siRNA transfection was comparable to the commercial in vitro transfection agent Lipofectamine. Consequently, the developed MSN-based delivery system offers a potential approach to hybrid nanocarriers for more efficient and long-term siRNA delivery and, in a longer perspective, in vivo gene silencing for RNA interference (RNAi) therapy. Keywords: mesoporous silica nanoparticles, RNAi therapy, siRNA delivery, stimuli-responsive drug release, hybrid nanocarriers

The use of synthetic RNA for research purposes as well as RNA-based therapy and vaccination has gained increasing importance. Given the anatomical seclusion of the eye, small interfering RNA (siRNA)-induced gene silencing bears great potential for targeted reduction of pathological gene expression that may allow rational treatment of chronic eye diseases in the future. However, there is yet an unmet need for techniques providing safe and efficient siRNA delivery to the retina. We used magnetic nanoparticles (MNPs) and magnetic force (Reverse Magnetofection) to deliver siRNA/MNP complexes into retinal explant tissue, targeting valosin-containing protein (VCP) previously established as a potential therapeutic target for autosomal dominant retinitis pigmentosa (adRP). Safe and efficient delivery of VCP siRNA was achieved into all retinal cell layers of retinal explants from the RHO P23H rat, a rodent model for adRP. No toxicity or microglial activation was observed. VCP silencing led to a significant decrease of retinal degeneration. Reverse Magnetofection thus offers an effective method to deliver siRNA into retinal tissue. Used in combination with retinal organotypic explants, it can provide an efficient and reliable preclinical test platform of RNA-based therapy approaches for ocular diseases.

Multidrug resistance (MDR) is a major obstacle in the clinical treatment of cancer. Herein, a facile strategy is reported to construct a versatile DNA nanostructure as a co‐delivery vector of RNA interference (RNAi) and chemodrugs to combat multidrug‐resistant tumor (MCF‐7R) in vitro and in vivo. In the tailored nanocarrier, two linear small hairpin RNA (shRNA) transcription templates targeting MDR‐associated genes (gene of P‐glycoprotein, a typical drug efflux pump; and gene of survivin, a representative anti‐apoptotic protein) are precisely organized in the chemodrug (doxorubicin, DOX) pre‐loaded DNA origami. With the incorporation of active targeting and controlled‐release elements, these multifunctional DNA nanocarriers can successfully enter the target MCF‐7R cells and synergistically inhibit tumor growth without apparent systemic toxicity. This tailored DNA nanoplatform, which combines RNAi therapy and chemotherapy, provides a new strategy for the treatment of multidrug‐resistant tumors. A DNA nanoplatform‐based co‐delivery system containing two linear shRNA transcription templates against tumor‐associated genes (Pgp and survive) and a chemotherapeutic drug (doxorubicin, DOX) was constructed for synergistic therapy of multidrug resistant (MDR) tumors in vivo. [ABSTRACT FROM AUTHOR]

Abstract In the present study, a highly effective carrier system has been developed for the delivery of antiviral siRNA mixtures. The developed hybrid microcarriers, made of biodegradable polymers and SiO 2 nanostructures, more efficiently mediate cellular uptake of siRNA than commercially available liposome-based reagents and polyethyleneimine (PEI); they also demonstrate low in vitro toxicity and protection of siRNA from RNase degradation. A series of siRNA designs (targeting the most conserved regions of three influenza A virus (IAV) genes: NP, NS, and PA) were screened in vitro using RT-qPCR, ELISA analysis, and hemagglutination assay. Based on the results of screening, the three most effective siRNAs (PA-1630, NP-717, and NS-777) were selected for in situ encapsulation into hybrid microcarriers. It was revealed that pre-treatment of cells with a mixture of PA-1630, NP-717, and NS-777 siRNAs, delivered by hybrid microcarriers, provided stronger inhibition of viral M1 mRNA expression and control of NP protein level, after viral infection, than single pre-treatment by any of three encapsulated siRNAs used in the study. Moreover, the effective inhibition of replication in several IAV subtypes (H1N1, H1N1pdm, H5N2, and H7N9) using a cocktail of the three selected siRNAs, delivered by our hybrid capsules to the cells, was achieved. In conclusion, we have developed a proof-of-principle which shows that our hybrid microcarrier technology (utilizing a therapeutic siRNA cocktail) may represent a promising approach in anti-influenza therapy. Graphical abstract Image 1 Highlights • In vitro screening of series of designed siRNAs specific for PA, NP and NS genes was performed. • Hybrid microcarriers for in situ encapsulation of anti-viral siRNA mixture have been developed. • The hybrid microcarriers showed high uptake efficacy and low cytotoxicity. • siRNA mixture –loaded microcarriers provided the most substantial inhibition of virus production. • The antiviral effect of encapsulated siRNAs was demonstrated on several IAV subtypes (H1N1, H1N1pdm, H5N2, H7N9). [ABSTRACT FROM AUTHOR]

RNA interference (RNAi) is the biological mechanism that allows targeted gene knockdown through the addition of exogenous short-interfering RNAs (siRNAs) to cells and organisms. RNAi has revolutionized cell biology and holds enormous potential for human therapy. One of the major challenges facing RNAi as a therapy is achieving efficient and nontoxic delivery of siRNAs into the cell cytoplasm, since their highly anionic character precludes their passage across the cell membrane unaided. Herein, we report a novel fusion protein between the tombusviral p19 protein, which binds siRNAs with picomolar affinity, and the “TAT” peptide (RKKRRQRRRR), which is derived from the transactivator of transcription (TAT) protein of the human immunodeficiency virus and acts as a cell-penetrating peptide. We demonstrate that this fusion protein, 2x-p19-TAT, delivers siRNAs into the cytoplasm of human hepatoma cells where they elicit potent and sustained gene knockdown activity without toxic effects.

RNA interference (RNAi) has the potential to treat diseases caused by dominant, gain-of-function type of gene mutations. In these diseases, one allele is mutated and produces a toxic protein, whereas the other allele is normal and performs vital functions. One challenge in the treatment is to specifically inhibit the mutant allele toxicity while maintaining the normal allele function. To test allele-specific silencing in vivo, we made transgenic mice that express an shRNA against mutant Cu, Zn superoxide dismutase gene (SOD1G93A), which causes amyotrophic lateral sclerosis (ALS) by a gain of an unknown toxic property. By crossing this transgenic line with mice that express SOD1G93A and mice that express wild-type human SOD1, we found that this shRNA specifically silences the mutant, but not the wild-type SOD1. The silencing of the mutant significantly delayed ALS onset and extended survival. Thus, RNAi can achieve allele-specific silencing and therapeutic benefit in vivo.

Background & Aims Antiviral agents including entecavir (ETV) suppress the replication of the hepatitis B virus (HBV) genome in human hepatocytes, but they do not reduce the abundance of viral proteins. The present study focused on effectively reducing viral protein levels. Methods We designed siRNAs (HBV-siRNA) that target consensus sequences in HBV genomes. To prevent the emergence of escaped mutant virus, we mixed three HBV-siRNAs (HBV-siRNAmix); the mixture was encapsulated in a novel pH-sensitive multifunctional envelope-type nanodevice (MEND), a hepatocyte-specific drug delivery system. Coagulation factor 7 siRNA was used to assess delivery and knockdown efficiencies of MEND/siRNA treatments in mice. The potency of MEND/HBV-siRNAmix was evaluated in primary human hepatocytes and in chimeric mice with humanized liver persistently infected with HBV. Results Effective knockdown of targets, efficient delivery of siRNA, and liver-specific delivery were each observed with MEND. MEND/HBV-siRNA caused efficient reduction of HBsAg and HBeAg in vitro and in vivo . However, ETV treatment did not efficiently reduce HBsAg or HBeAg when compared with a single MEND/HBV-siRNAmix treatment. Furthermore, the suppressive effects of a single dose of MEND/HBV-siRNAmix persisted for 14 days in vitro and in vivo . Conclusion We demonstrated that MEND/HBV-siRNA controlled HBV more efficiently than did ETV. Furthermore, the effect of a single dose of MEND/HBV-siRNA persisted for a long time. These results indicated that MEND/HBV-siRNA may be a promising novel HBV treatment that is more effective than reverse transcriptase inhibitors. [ABSTRACT FROM AUTHOR]

[Display omitted] • A GSH-responsive SS-LNP/shPKN3 based on DDA-SS-DMA is developed. • The SS-LNP delivery system has lower toxicity, higher transfection efficiency. • The SS-LNP/shPKN3 effectively inhibits the expression of PKN3 protein. • The SS-LNP/shPKN3 shows significant anti-tumor activity. Protein kinase N3 (PKN3), an AGC-family member, is often overexpressed in breast tumor cells. RNAi therapy is a promising approach to inhibit tumor growth by reducing the expression of PKN3. In this report, lipid nanoparticles encapsulated with new shRNA PKN3 (SS-LNP/shPKN3) with redox-responsiveness were developed in order to specifically down-regulate the expression of PKN3 for breast cancer treatment. The SS-LNP/shPKN3 was prepared by microfluidic method using disulfide bonds based ionizable lipid as main component. The as-prepared SS-LNP/shPKN3 lipid nanoparticles were characterized via using dynamic light scattering (DLS) and transmission electron microscopy (TEM). The results indicated that the obtained SS-LNP/shPKN3 exhibited uniform particle size and regular spherical morphology. Moreover, glutathione (GSH) triggered release of shPKN3 confirmed the redox-responsiveness of the SS-LNP/shPKN3. Finally, the anti-tumor effect of SS-LNP/shPKN3 was evaluated against MDA-MB-231 cells and derived xenograft tumor bearing mice. It was found that the SS-LNP/shPKN3-2 had the highest PKN3 protein inhibition rate of 60.8% and tumor inhibition rate of 62.3%. Taken together, the SS-LNP/shPKN3 might be a potential therapeutic strategy for breast cancer. [ABSTRACT FROM AUTHOR]

Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD). Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi) therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6) carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT), which is the underlying cause of LGMD type 1A (LGMD1A). Our best MYOT-targeted microRNA vector (called miMYOT) significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model) both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

Summary RNAi has always captivated scientists due to its tremendous power to modulate the phenotype of living organisms. This natural and powerful biological mechanism can now be harnessed to downregulate specific gene expression in diseased cells, opening up endless opportunities. Since most of the conventional siRNA delivery methods are limited by a narrow therapeutic index and significant side and off-target effects, we are now in the dawn of a new age in gene therapy driven by nanotechnology vehicles for RNAi therapeutics. Here, we outlook the “do's and dont's” of the inorganic RNAi nanomaterials developed in the last 15 years and the different strategies employed are compared and scrutinized, offering important suggestions for the next 15. [ABSTRACT FROM AUTHOR]

Protein kinase N3 (PKN3), by virtue of its abnormal expression in prostate cells, has been widely used as a target of RNAi (shRNA, siRNA, miRNA) therapy. The major challenges of PKN3 RNAi therapy lie in how to design effective interference sequences and delivery systems. Herein, new PKN3 shRNA sequences (shPKN3-2459 and shPKN3-3357) were designed, and bioreducible, biodegradable, ionizable lipid-based nanoparticles were developed for shPKN3 delivery. First, an ionizable lipid (DDA-SS-DMA) bridged with disulfide bond and ester bonds was synthesized by a three-step reaction and confirmed by MS, 1 H NMR, and 13 C NMR. The ionizable lipid was mixed with cholesterol, DSPC, PEG-lipid, and shPKN3 by a microfluidic mixer to prepare lipid nanoparticles (LNP-shPKN3) which were characterized by DLS and TEM. Afterward, the pH and glutathione (GSH)-responsiveness of the DDA-SS-DMA based LNP delivery system were investigated by lysosome escape and gel electrophoresis assays. Compared with the commercial transfection reagent Lipo2000, the DDA-SS-DMA based delivery system showed higher transfection efficiency and lower toxicity. Western blot analysis, invasion tests, and migration assays were performed to evaluate the silencing effect of shPKN3 in vitro . In in vivo studies, high tumor suppression (65.8%) and treatment safety were evident in the LNP-shPKN3-2459 treatment group. Taken together, the DDA-SS-DMA based delivery system encapsulating shPKN3-2459 showed significant antitumor efficacy and might be a promising formulation for the treatment of prostate cancer.

Highlights: [•] The use of T cell lines to replace PBMCS for HIV-1 studies has been studied. [•] The PM1 T cell line supports the replication of all HIV-1 subtypes. [•] The PM1 T cell line supports CCR5- and CXCR4-using HIV-1 variants. [•] The safety and efficacy of an RNAi-based anti-HIV gene therapy were evaluated. [•] The PM1 cells provide a valuable tool for basic and applied HIV-1 studies. [ABSTRACT FROM AUTHOR]

Transthyretin familial amyloid polyneuropathy (TTR-FAP) classically presents as a length dependent small fiber polyneuropathy in endemic countries like Portugal. In nonendemic countries, it may mimic a variety of chronic polyneuropathies, with several phenotypes: ataxic, upper limb onset neuropathy, or motor. In these cases, there is usually a late onset and no positive family history. TTR gene sequencing appears the most pertinent first-line test for diagnosis. Cardiac involvement of various severities is common in FAP. Liver transplantation remains the standard antiamyloid therapy with better results in Val30Met TTR-FAP of early onset. Antiamyloid medication has been developed. (1) TTR stabilizers: Tafamidis was the first drug approved in Europe in stage 1 (walking unaided) TTR-FAP to slow progression of the disease; diflunisal has been assessed in a phase 3 clinical trial; (2) TTR gene silencing is a new strategy to inhibit production of both mutant and nonmutant TTR with antisense oligonucleotides or SiRNA (2 ongoing phase 3 clinical trials). [ABSTRACT FROM AUTHOR]

Abstract: The risk of acquisition of resistance to chemotherapy remains a major hurdle in the management of various types of cancer patients. Several cellular and noncellular mechanisms are involved in developing both intrinsic and acquired resistance in cancer cells toward chemotherapy. This review covers the various multidrug resistance (MDR) mechanisms observed in cancer cells as well as the various strategies developed to overcome these MDR mechanisms. Extensive studies have been conducted during the last several decades to enhance the efficacy of chemotherapy by suppressing or evading these MDR mechanisms including the use of new anticancer drugs that could escape from the efflux reaction, MDR modulators or chemosensitizers, multifunctional nanocarriers, and RNA interference (RNAi) therapy. [Copyright &y& Elsevier]

The article presents a study centered on ribonucleic acid (RNA) interference (RNAi) as a tool to control gene expression in the laboratory. It notes that a post-transcriptional gene-silencing mechanism can surface due to the presence of a double-stranded RNA (dsRNA) in eukaryotic cells, leading to a sequence-specific degradation of the target messenger RNA (mRNA). Silencing of viral genes is recommended as a therapeutic strategy, while marine shrimp viral diseases, particularly white spot disease (WSD), are regarded as the most attractive targets for the development of therapeutic RNAi due to its widespread economic impact. The author concluded that the cycle of pathogen must be considered when designing the RNAi-based therapy.

Introduction. In the early 1990s, during experiments aimed at intensifying the co lour of Petunia hybryda flowers, a new mechanism of regulation of gene expression was discovered; however, its mechanism, i.e. inhibition of gene expression at a post-transcriptional stage, remained unknown. In 1998 two groups led by A. Fire and C. Mello found a molecular basis for the phenomenon called RNA interference (RNAi). Delivery of a double stranded RNA to a model organism, Caenorhabditis elegans, triggered silencing of complementary messenger RNA sequences. This discovery opened new perspectives for research involving gene functions due to the possibility of inhibiting the expression of a specific gene through its mRNA degradation in the cytosol. Aim. The aim of this paper is to present a potential role of RNAi as a therapeutic method for various diseases. Discussion. RNAi provides a powerful technique for the derivation and analysis of loss-of-function phenotypes in vertebrate cells. This technique may be also applied as a therapeutic strategy, e.g. in genetic and viral diseases, and clinical trials to test this possibility have been already initiated. Conclusions. RNAi-based therapy may become a powerful tool to treat many diseases whose molecular pathogenesis mechanisms have been thoroughly understood. [ABSTRACT FROM AUTHOR]

Abstract: RNA interference (RNAi) has the potential to treat diseases caused by dominant, gain-of-function type of gene mutations. In these diseases, one allele is mutated and produces a toxic protein, whereas the other allele is normal and performs vital functions. One challenge in the treatment is to specifically inhibit the mutant allele toxicity while maintaining the normal allele function. To test allele-specific silencing in vivo, we made transgenic mice that express an shRNA against mutant Cu, Zn superoxide dismutase gene (SOD1G93A), which causes amyotrophic lateral sclerosis (ALS) by a gain of an unknown toxic property. By crossing this transgenic line with mice that express SOD1G93A and mice that express wild-type human SOD1, we found that this shRNA specifically silences the mutant, but not the wild-type SOD1. The silencing of the mutant significantly delayed ALS onset and extended survival. Thus, RNAi can achieve allele-specific silencing and therapeutic benefit in vivo. [Copyright &y& Elsevier]

Double stranded short interfering RNAs (siRNAs) mediate gene silencing in a sequence specific manner. By virtue of their specific gene silencing activity and owing to the recent discoveries on their plasmid and virus driven expression, siRNAs are being widely adopted in research and therapeutics. Efforts were made to optimize the siRNA expression system for the application in therapy. One major obstacle in developing RNA interference (RNAi) therapy is the delivery of siRNAs to the target cells. Combination of novel molecular targeting technologies, such as recombinant protein technology and ribosome display technology, will enable to deliver gene silencing agents to target cells specifically and efficiently. [ABSTRACT FROM AUTHOR]