Search

As a member of the class I PI3K family, phosphoinositide 3-kinase δ (PI3Kδ) is an important signaling biomolecule that controls immune cell differentiation, proliferation, migration, and survival. It also represents a potential and promising therapeutic approach for the management of numerous inflammatory and autoimmune diseases. We designed and assessed the biological activity of new fluorinated analogues of CPL302415, taking into account the therapeutic potential of our selective PI3K inhibitor and fluorine introduction as one of the most frequently used modifications of a lead compound to further improve its biological activity. In this paper, we compare and evaluate the accuracy of our previously described and validated in silico workflow with that of the standard (rigid) molecular docking approach. The findings demonstrated that a properly fitted catalytic (binding) pocket for our chemical cores at the induced-fit docking (IFD) and molecular dynamics (MD) stages, along with QM-derived atomic charges, can be used for activity prediction to better distinguish between active and inactive molecules. Moreover, the standard approach seems to be insufficient to score the halogenated derivatives due to the fixed atomic charges, which do not consider the response and indictive effects caused by fluorine. The proposed computational workflow provides a computational tool for the rational design of novel halogenated drugs. [ABSTRACT FROM AUTHOR]

Currently, G protein-coupled receptors (GPCRs) constitute a significant group of membrane-bound receptors representing more than 30% of therapeutic targets. Fluorine is commonly used in designing highly active biological compounds, as evidenced by the steadily increasing number of drugs by the Food and Drug Administration (FDA). Herein, we identified and analyzed 898 target-based F-containing isomeric analog sets for SAR analysis in the ChEMBL database—FiSAR sets active against 33 different aminergic GPCRs comprising a total of 2163 fluorinated (1201 unique) compounds. We found 30 FiSAR sets contain activity cliffs (ACs), defined as pairs of structurally similar compounds showing significant differences in affinity (≥50-fold change), where the change of fluorine position may lead up to a 1300-fold change in potency. The analysis of matched molecular pair (MMP) networks indicated that the fluorination of aromatic rings showed no clear trend toward a positive or negative effect on affinity. Additionally, we propose an in silico workflow (including induced-fit docking, molecular dynamics, quantum polarized ligand docking, and binding free energy calculations based on the Generalized-Born Surface-Area (GBSA) model) to score the fluorine positions in the molecule. [ABSTRACT FROM AUTHOR]

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10−9 – 200 × 10−9 M), detection limit (1.0 × 10−9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples. [Display omitted] • 238 ssDNA nucleotide 3D structures were predicted through a standard bioinformatics workflow. • Top 5 ciprofloxacin specific DNA aptamers were screened using standard precision (SP) docking and QPLD docking. • Using Aptamer5099 and ciprofloxacin interaction data, electrochemical measurements were performed. • The aptamer showed a linear range (10 × 10−9 – 200 × 10−9 M), detection limit (1.0 × 10−9), and good recoveries in real samples. [ABSTRACT FROM AUTHOR]

As a member of the class I PI3K family, phosphoinositide 3-kinase δ (PI3Kδ) is an important signaling biomolecule that controls immune cell differentiation, proliferation, migration, and survival. It also represents a potential and promising therapeutic approach for the management of numerous inflammatory and autoimmune diseases. We designed and assessed the biological activity of new fluorinated analogues of CPL302415, taking into account the therapeutic potential of our selective PI3K inhibitor and fluorine introduction as one of the most frequently used modifications of a lead compound to further improve its biological activity. In this paper, we compare and evaluate the accuracy of our previously described and validated in silico workflow with that of the standard (rigid) molecular docking approach. The findings demonstrated that a properly fitted catalytic (binding) pocket for our chemical cores at the induced-fit docking (IFD) and molecular dynamics (MD) stages, along with QM-derived atomic charges, can be used for activity prediction to better distinguish between active and inactive molecules. Moreover, the standard approach seems to be insufficient to score the halogenated derivatives due to the fixed atomic charges, which do not consider the response and indictive effects caused by fluorine. The proposed computational workflow provides a computational tool for the rational design of novel halogenated drugs.

The first zinc‐binding group (ZBG) to have been identified as inhibitor of the metallo‐enzymes carbonic anhydrases (CA, EC 4.2.1.1) was the sulfonamide. From then on several classes of zinc‐binders have been described. This work reports the benzenephosponamidates as a new chiral aromatic sulfonamide‐mimic ZBG able to meet the requirements for effectively binding the enzyme active site. Several low micromolar CA I, II, VII, IX inhibitors were thus detected. Kinetic studies, QM‐polarized ligand docking, and MM‐GBSA in silico methods were used to characterize this newly identified CA inhibitor chemotype. Phosphorus derivatives as carbonic anhydrase inhibitors (CAIs) were investigated in this work. The present study demonstrates that phosphonamidates can effectively inhibit human CAs as sulfonamide‐mimic chemotypes by using kinetic studies and QPLD/MM‐GBSA in silico methods. [ABSTRACT FROM AUTHOR]

Cell division is a crucial process for the growth and development of all living organisms. Unfortunately, uncontrolled cell division and growth is a hallmark of cancer, leading to the formation of tumors. The Human Eg5 protein, also known as the mitotic kinesin Eg5, plays a vital role in the regulation of cell division and its dysfunction has been linked to cancer development. This study aimed to identify new inhibitors of the Human Eg5 protein. Over 2000 Traditional Chinese Medicine (TCM) compounds were screened through a combination of virtual and structure-based screening methods. The top five compounds (Compounds 1–5) showed improved binding affinity to Human Eg5 compared to the standard drug Monastrol, as demonstrated by docking and MMGBSA scores, as well as interactions with key amino acids GLY 116 and GLY 118. The potential absorption and bioactivity of these compounds were also predicted through ADMET properties and a QSAR model, respectively, and showed improved results compared to the standard. Further quantum mechanics docking confirmed the better binding affinity of the lead compound, Compound 1. Our findings highlight Compound 1–5 as promising hits for inhibiting Human Eg5 and the need for experimental validation of their potential in treating cancer. [Display omitted] • Pharmacophore modeling, QSAR, and virtual screening identified potential Eg5 inhibitors from a TCM library. • Top-ranked compounds had better potential than Monastrol as Eg5 inhibitors based on pIC50, docking, MMGBSA, and ADME parameters. • Compound 1 was identified as the lead compound with stronger binding affinity to Eg5 than Monastrol using QPLD. • Molecular dynamics simulation supported QPLD, indicating Compound 1 has more stable binding and longer duration of action potential. [ABSTRACT FROM AUTHOR]

The high rate of drug resistance as well as the complex biochemical process of the parasite reproduction cycle makes development of new drugs for malaria a very important but challenging task. Falcipain 2 (FL2) and Falcipain 3 (FL3) are the major cysteine protease enzymes that play a central role in providing essential amino acids for the parasite’s protein biosynthesis through the hemoglobin hydrolysis process. Selective inhibition of these enzymes is considered as a promising chemotherapeutic target. In the present investigation, the highly efficient linear interaction energy (LIE) method has been parameterized for binding affinity predictions and assessed with a set of 244 compounds for FL2 and FL3 inhibition. The results revealed that the van der Waals energy is very important for ligands binding to Falcipain proteins and that, overall, the electrostatic energy contribution is minor. The best models obtained for FL2 and FL3 give root mean square errors (RMSE) of 1.82 and 1.33 kcal/mol respectively, for the test set. In this study, we also investigate how the choice of initial protein-ligand confirmation ( pose ) impacts the overall quality of the LIE models. Moreover, the transferability of LIE parameters is further discussed. [ABSTRACT FROM AUTHOR]

Phospholipase A2 (PLA2) is the most abundant protein found in snake venom. PLA2 induces a variety of pharmacological effects such as neurotoxicity, myotoxicity and cardiotoxicity as well as anticoagulant, hemolytic, anti-platelet, hypertensive, hemorrhagic and edema inducing effects. In this study, the three dimensional structure of PLA2 of Naja sputatrix (Malayan spitting cobra) was modeled by I-TASSER, SWISS-MODEL, PRIME and MODELLER programs. The best model was selected based on overall stereo-chemical quality. Further, molecular dynamics simulation was performed to know the stability of the modeled protein using Gromacs software. Average structure was generated during the simulation period of 10 ns. High throughput virtual screening was employed through different databases (Asinex, Hit finder, Maybridge, TOSLab and ZINC databases) against PLA2. The top seven compounds were selected based on the docking score and free energy binding calculations. These compounds were analyzed by quantum polarized ligand docking, induced fit docking and density functional theory calculation. Furthermore, the stability of lead molecules in the active site of PLA2 was employed by MD simulation. The results show that selected lead molecules were highly stable in the active site of PLA2. [ABSTRACT FROM AUTHOR]

Retroviruses HTLV-1 and HIV-1 are the primary causative agents of fatal adult T-cell leukemia and acquired immune deficiency syndrome (AIDS) disease. Both retroviruses are similar in characteristics mechanism, and it encodes for protease that mainly involved in the viral replication process. On the basis of the therapeutic success of HIV-1 PR inhibitors, the protease of HTLV-1 is mainly considered as a potential target for chemotherapy. At the same time, structural similarities in both enzymes that originate HIV PR inhibitors can also be an HTLV-1 PR inhibitor. But the expectations failed because of rejection of HIV PR inhibitors from the HTLV-1 PR binding pocket. In this present study, the reason for the HIV PR inhibitor rejection from the HTLV-1 binding site was identified through sequence analysis and molecular dynamics simulation method. Functional analysis of M37A mutation in HTLV PR clearly shows that the MET37 specificity and screening of potential inhibitors targeting MET37 is performed by using approved 90% similar HIV PR inhibitor compounds. From this approach, we report few compounds with a tendency to accept/donate electron specifically to an important site residue MET37 in HTLV-1 PR binding pocket. Copyright © 2014 John Wiley & Sons, Ltd. [ABSTRACT FROM AUTHOR]

Neisseria gonorrhoeae have progressively developed resistance to almost all antibiotics, and it has become imperative to develop novel approaches to combat its multi-drug resistance. Overexpression of the MtrCDE, an RND family efflux pump, is one of the primary causes of antibiotic resistance in the gonococcus and is considered an important target for combating anti-microbial resistance. PaβN, D13–9001, and other EPIs are identified to target the RND efflux pumps, but due to their cytotoxicity, they have failed in clinical trials. Herein, an extensive pharmacophore-based approach was performed to identify novel EPI inhibitors with improved pharmacology/safety profiles. An integrated computational framework comprising pharmacophore generation, virtual screening using HTVS, SP and XP Glide methodology, MM-GBSA analysis, Induced fit docking, QPLD, DFT, ADMET properties calculation, Molecular Dynamics, and MM-PBSA analysis was performed. The comprehensive study leads to the identification of five non-toxic bioactive compounds, namely - ZINC000008764610, ZINC000030879142, ZINC000030879358, ZINC000253414904, and ZINC000225394671, as potential EPIs for RND efflux pump of Neisseria gonorrhoeae. The five compounds were selected based on the pharmacophore mapping, higher dock score than the known EPIs, binding stability, molecular interactions with the critical residues of MtrD protein, higher ADMET properties, non-toxicity, and free energy estimations. In summary, the analysis led to the identification of five top hits from the natural compound subset of the ZINC database that has a higher binding affinity to the MtrD and adequate physiochemical/pharmacokinetic profile that can be used for the generation of novel EPIs against Neisseria gonorrhoeae. [Display omitted] • Neisseria gonorrheae have shown high multi-drug resistance & needs to be tackled on urgent basis. • Efflux pumps are novel drug targets that can potentiates the use of antibiotics against pathogens. • An extensive pharmacophore based screening was performed to identify novel EPIs for N. gonorrheae. • The lead molecules showed strong binding interactions with the active-site residues of MtrD Ng. • These lead molecules can be used to develop therapeutics for N. gonorrheae caused gonorrhea. [ABSTRACT FROM AUTHOR]

Retroviruses are most perilous viral family, which cause much damage to the Homo sapiens. HTLV-1 mechanism found to more similar with HIV-1 and both retroviruses are causative agents of severe and fatal diseases including adult T-cell leukemia (ATL) and the acquired immune deficiency syndrome (AIDS). Both viruses code for a protease (PR) that is essential for replication and therefore represents a key target for drugs interfering with viral infection. In this work, the comparative study of HIV-1 and HTLV-1 PR enzymes through sequence and structural analysis is reported along with approved drugs of HIV-PR. Conformation of each HIV PR drugs have been examined with different parameters of interactions and energy scorings parameters. MD simulations with respect to timescale event of 20 ns favors that, few HIV-PR inhibitors can be more active inside the HTLV-1 PR binding pocket. Overall results suggest that, some of HIV inhibitors like Tipranavir, Indinavir, Darunavir and Amprenavir are having good energy levels with HTLV-1. Due to absence of interactions with MET37, here we report that derivatives of these compounds can be much better inhibitors for targeting HTLV-1 proteolytic activity. [ABSTRACT FROM AUTHOR]

HIV-1 integrase (IN) is an essential enzyme in the viral replication cycle and represents a promising target for anti-HIV drug design. In the present study, pharmacophore modeling and atom-based 3D-QSAR studies were carried out on a series of compounds belonging to dihydroxy isoindole derivatives as HIV-1 IN strand transfer inhibitors. The best pharmacophore model generated consists of six features AADHRR: two hydrogen bond acceptors (A), a hydrogen bond donor (D), a hydrophobic group (H) and two aromatic rings (R). Based on the best pharmacophore model, a statistically valid atom-based 3D-QSAR model was developed. The obtained atom-based 3D-QSAR model has an excellent correlation coefficient value (R²=0.87) and also exhibited good predictive power (Q²=0.72). The best pharmacophore model was further validated through enrichment calculations and it shows strong predictive power with a high performance in identifying active ligands from the total hits (actives+decoys). QM-polarized ligand docking and molecular dynamics simulations of selected active compounds in the active site of prototype foamy virus intasome gave important insights into the chemical and structural basis involved in the molecular recognition process. The O,O,O donor atom triad of compounds show metal chelation with divalent Mg2+ ions bound to the three catalytic amino acids in the enzyme's active site and π-stacking interaction with the viral DNA residue DA17. The results might have implications for rational design of specific HIV-1 integrase strand transfer inhibitors with improved affinity and selectivity. [ABSTRACT FROM AUTHOR]

HIV-1 integrase (IN) is an important drug target over the years with diverse therapeutic potential with the objective of designing new chemical entities with enhanced inhibitory potencies against HIV-1 IN. We performed molecular docking, quantum polarized ligand docking (QPLD), ADME screening, and PASS biological activity prediction studies on Raltegravir, Elvitegravir, and newly searched compounds of Cambridge crystallographic database. Best docking and QPLD scores of known and unknown searched compounds were compared using docking score, docking energy, and emodel energy. Moreover, correlation between docking score, docking energy with emodel energy yielded a statistically significant correlation coefficient. The searched compounds were also evaluated with ADME properties and biological activity prediction analysis. These compounds also show good pharmacokinetic properties under the acceptable range including antiviral biological activity prediction. Hence, these compounds could be employed to design ligands with enhanced inhibitory potencies and to predict the potencies of analogs to guide synthesis/or prepare synthetic analogs for second generation drug development against HIV-1 IN. [ABSTRACT FROM AUTHOR]

Background: Diabetes mellitus is a serious global health issue, currently affecting 425 million people and is set to affect over 690 million people by 2045. It is a chronic disease characterized by hyperglycemia due to relative or absolute insulin hormone deficiency. Dipeptidyl peptidase- IV (DPP-IV) inhibitors are hypoglycemic agents augmenting the action of the incretin hormones that stimulate insulin secretion from the pancreatic beta cells., Objective: In this study, synthesis and biological evaluation of seven piperazine derivatives 3a-g was carried out., Methods: The synthesized molecules were characterized using proton-nuclear magnetic resonance, carbon-nuclear magnetic resonance, infrared spectroscopy and mass spectrometry., Results: In vitro biological evaluation study showed comparable DPP-IV inhibitory activity for the targeted compounds ranging from 19%-30% at 100 μM concentration. Furthermore, the in vivo hypoglycemic activity of 3d was evaluated using streptozotocin-induced diabetic mice. It was found that compound 3d significantly decreased the blood glucose level when the diabetic group treated with 3d was compared to the control diabetic group. Quantum-Polarized Ligand Docking (QPLD) studies demonstrate that 3a-g fit the binding site of DPP-IV enzyme and form H-bonding with the backbones of R125, E205, E206, K554, W629, Y631, Y662, R669, and Y752., Conclusion: Piperazine derivatives were successfully found to be new scaffolds as potential DPP-IV inhibitors., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.net.)

The enzyme Zmp1 is a zinc-containing peptidase that plays a critical role in the pathogenicity of Mycobacterium tuberculosis. Herein we describe the identification of a small set of Zmp1 inhibitors based on a novel 8-hydroxyquinoline-2-hydroxamate scaffold. Among the synthesized compounds, N-(benzyloxy)-8-hydroxyquinoline-2-carboxamide (1 c) was found to be the most potent Zmp1 inhibitor known to date, and its binding mode was analyzed both by kinetics studies and molecular modeling, identifying critical interactions of 1 c with the zinc ion and residues in the active site. The effect of 1 c on intracellular Mycobacterium survival was assayed in J774 murine macrophages infected with M. tuberculosis H37Rv or M. bovis BCG and human monocyte-derived macrophages infected with M. tuberculosis H37Rv. Cytotoxicity and genotoxicity were also assessed. Overall, inhibitor 1 c displays interesting in vitro antitubercular properties worthy of further investigation., (© 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Phospholipase A2 (PLA2) is the most abundant protein found in snake venom. PLA2 induces a variety of pharmacological effects such as neurotoxicity, myotoxicity and cardiotoxicity as well as anticoagulant, hemolytic, anti-platelet, hypertensive, hemorrhagic and edema inducing effects. In this study, the three dimensional structure of PLA2 of Naja sputatrix (Malayan spitting cobra) was modeled by I-TASSER, SWISS-MODEL, PRIME and MODELLER programs. The best model was selected based on overall stereo-chemical quality. Further, molecular dynamics simulation was performed to know the stability of the modeled protein using Gromacs software. Average structure was generated during the simulation period of 10 ns. High throughput virtual screening was employed through different databases (Asinex, Hit finder, Maybridge, TOSLab and ZINC databases) against PLA2. The top seven compounds were selected based on the docking score and free energy binding calculations. These compounds were analyzed by quantum polarized ligand docking, induced fit docking and density functional theory calculation. Furthermore, the stability of lead molecules in the active site of PLA2 was employed by MD simulation. The results show that selected lead molecules were highly stable in the active site of PLA2.

The development of SrtA inhibitors targeting the biothreat organism namely Bacillus anthracis was achieved by the combined approach of pharmacophore modeling, binding interactions, electron transferring capacity, ADME, and Molecular dynamics studies. In this study, experimentally reported Ba-SrtA inhibitors (pyridazinone and pyrazolethione derivatives) were considered for the development of enhanced pharmacophoric model. The obtained AAAHR hypothesis was a pure theoretical concept that accounts for common molecular interaction network present in experimentally active pyridazinone and pyrazolethione derivatives. Pharmacophore-based screening of AAAHR hypothesis provides several new compounds, and those compounds were treated with four phases of docking protocols with combined Glide-QPLD docking approach. In this approach, scoring and charge accuracy variations were seen to be dominated by QM/MM approach through the allocation of partial charges. Finally, we reported the best compounds from binding db, Chembridge db, and Toslab based on scoring values, energy parameters, electron transfer reaction, ADME, and cell adhesion inhibition activity. The dynamic state of interaction and binding energy assess that new compounds are more active inside the binding pocket and these compounds on experimental validations will survive as better inhibitors for targeting the cell adhesion mechanism of Ba-SrtA.

Compounds containing a quinuclidine scaffold are promising drug candidates for pharmacological management of the central nervous system (CNS) pathologies implicating nAChRs. We have carried out binding affinity and in-silico docking studies of arylmethylene quinuclidine-like derivatives at the α4β2 receptor using in-vitro receptor binding assay and comparative modeling, respectively. We found that introducing a hydrogen-bond acceptor into the 3-benzylidene quinuclidine derivative resulted in a 266-fold increase in binding affinity and confers agonism properties. By contrast, addition of a phenyl group to 3-benzylidene quinuclidine derivative only results in an 18-fold increase in binding affinity, without conferring agonism. We also found that docking into the orthosteric binding site of the α4β2 nAChR is consistent with the fact that the basic nitrogen atom donates a hydrogen-bond to the carbonyl group of the highly conserved Trp-149, as initially observed by Dougherty and co-workers.(1) The experimentally-observed trend in binding affinity at both α4β2 and α3β4 nAChRs was accurately and independently confirmed by quantum mechanics (QM)-polarized docking. The reduction in binding affinity to the α3β4 subtype primarily results from a dampening of both coulombic and cation-π interactions., (Copyright © 2013 Elsevier Ltd. All rights reserved.)

Embelin (2,5-dihydroxy-3-undecyl-1,4-benzoquinone) possesses anti-inflammatory and anti-carcinogenic properties in vivo, and these features have been related to interference with multiple targets including XIAPs, NFκB, STAT-3, Akt and mTOR. However, interference with these proteins requires relatively high concentrations of embelin (IC₅₀>4 μM) and cannot fully explain its bioactivity observed in several functional studies. Here we reveal human 5-lipoxygenase (5-LO) and microsomal prostaglandin E₂ synthase (mPGES)-1 as direct molecular targets of embelin. Thus, embelin potently suppressed the biosynthesis of eicosanoids by selective inhibition of 5-LO and mPGES-1 with IC₅₀=0.06 and 0.2 μM, respectively. In intact human polymorphonuclear leukocytes and monocytes, embelin consistently blocked the biosynthesis of various 5-LO products regardless of the stimulus (fMLP or A23187) with IC₅₀=0.8-2 μM. Neither the related human 12- and 15-LO nor the cyclooxygenases-1 and -2 or cytosolic phospholipase A₂ were significantly affected by 10 μM embelin. Inhibition of 5-LO and mPGES-1 by embelin was (I) essentially reversible after wash-out, (II) not impaired at higher substrate concentrations, (III) unaffected by inclusion of Triton X-100, and (IV) did not correlate to its proposed antioxidant properties. Docking simulations suggest concrete binding poses in the active sites of both 5-LO and mPGES-1. Because 5-LO- and mPGES-1-derived eicosanoids play roles in inflammation and cancer, the interference of embelin with these enzymes may contribute to its biological effects and suggests embelin as novel chemotype for development of dual 5-LO/mPGES-1 inhibitors., (Copyright © 2013 Elsevier Inc. All rights reserved.)