Search

Many bacteria harbour an incomplete quorum-sensing (QS) system, whereby they possess LuxR homologues without the QS acylhomoserine lactone (AHL) synthase, which is encoded by a luxl homologue. An artificial AHL-producing plasmid was constructed using a cvil gene encoding the C6-AHL [N-hexanoyl homoserine lactone (HHL)] synthase from Chromobacterium violaceum, and was introduced successfully into both the wild-type and a ppoR (luxR homologue) mutant of Pseudomonas putida. Our data provide evidence to suggest that the PpoR-HHL complex, but neither PpoR nor HHL alone, could attenuate growth, antibiotic resistance and biofilm formation ability. In contrast, swimming motility, siderophore production and indole degradation were enhanced by PpoR-HHL. The addition of exogenous indole increased biofilm formation and reduced swimming motility. Interestingly, indole proved ineffective in the presence of PpoR-HHL, thereby suggesting that the PpoR-HHL complex masks the effects of indole. Our data were supported by transcriptome analyses, which showed that the presence of the plasmid-encoded AHL synthase altered the expression of many genes on the chromosome in strain KT2440. Our results showed that heterologous luxl expression that occurs via horizontal gene transfer can regulate a broad range of specific target genes, resulting in alterations of the phenotype and physiology of host cells. DOI 10.1099/mic.0.041095-0

FinR is required for the induction of fpr (ferredoxin-[NADP.sup.+] reductase) under superoxide stress conditions in Pseudomonas putida. Many proteobacteria harbour FinR homologues in their genome as a putative LysR-type protein. Three cysteine residues (at positions 150, 239 and 289 in P. putida FinR) are conserved in all FinR homologues. When these conserved cysteines, along with two other cysteine residues present in FinR, were individually mutated to serines, the FinR remained active, unlike SoxR and OxyR in Escherichia coli. The results of our in vitro DNA-binding assay with cellular extracts showed that FinR binds directly to the fpr promoter region. In order to identify the FinR functional domain for sensing superoxide stress, we employed random and site-directed mutagenesis of FinR. Among 18 single amino acid mutants, three mutants (T39A, R194A and E225A) abolished fpr induction without any alteration of their DNA-binding ability, whereas other mutants also abrogated their DNA-binding abilities. Interestingly, two mutants (L215P and D51A) appeared to be constitutively active, regardless of superoxide stress conditions. Ferrous iron depletion, ferric iron addition and fdxA (ferredoxin) gene deletion also participate in the regulation of fpr. These data indicate that FinR has unusual residues for redox sensing and that the redox-sensing mechanism of FinR differs from the well-known mechanisms of OxyR and SoxR. DOI 10.1099/mic.0.034181-0

Pseudomonas putida DOT-T1E was used as a model to develop a 'phenomics' platform to investigate the ability of P. putida to grow using different carbon, nitrogen, and sulfur sources and in the presence of stress molecules. Results for growth of wild-type DOT-T1E on 90 different carbon sources revealed the existence of a number of previously uncharted catabolic pathways for compounds such as salicylate, quinate, phenylethanol, gallate, and hexanoate, among others. Subsequent screening on the subset of compounds on which wild-type DOT-TIE could grow with four knockout strains in the global regulatory genes [DELTA]crc, [DELTA]crp, [DELTA]cyoB, and [DELTA]ptsN allowed analysis of the global response to nutrient supply and stress. The data revealed that most global regulator mutants could grow in a wide variety of substrates, indicating that metabolic fluxes are physiologically balanced. It was found that the Crc mutant did not differ much from the wild-type regarding the use of carbon sources. However, certain pathways are under the preferential control of one global regulator, i.e., metabolism of succinate and D-fructose is influenced by CyoB, and L-arginine is influenced by PtsN. Other pathways can be influenced by more than one global regulator; i.e., L-valine catabolism can be influenced by CyoB and Crp (cyclic AMP receptor protein) while phenylethylamine is affected by Crp, CyoB, and PtsN. These results emphasize the cross talk required in order to ensure proper growth and survival. With respect to N sources, DOT-T1E can use a wide variety of inorganic and organic nitrogen sources. As with the carbon sources, more than one global regulator affected growth with some nitrogen sources; for instance, growth with nucleotides, dipeptides, D-amino acids, and ethanolamine is influenced by Crp, CyoB, and PtsN. A surprising finding was that the Crp mutant was unable to flourish on ammonium. Results for assayed sulfur sources revealed that CyoB controls multiple points in methionine/cysteine catabolism while PtsN and Crc are needed for N-acetyl-L-cysteamine utilization. Growth of global regulator mutants was also influenced by stressors of different types (antibiotics, oxidative agents, and metals). Overall and in combination with results for growth in the presence of various stressors, these phenomics assays provide multifaceted insights into the complex decision-making process involved in nutrient supply, optimization, and survival. doi: 10.1128/JB.01129-09

Pseudomonas putida GJ31 has been reported to grow on chlorobenzene using a meta-cleavage pathway with chlorocatechol 2,3-dioxygenase (CbzE) as a key enzyme. The CbzE-encoding gene was found to be localized on the 180 kb plasmid pKW1 in a cbzTEXGS cluster, which is flanked by transposases and encodes only a partial (chloro)catechol meta-cleavage pathway comprising ferredoxin reductase, chlorocatechol 2,3-dioxygenase, an unknown protein, 2-hydroxymuconic semialdehyde dehydrogenase and glutathione S-transferase. Downstream of cbzTEXGS are located cbzJ, encoding a novel type of 2-hydroxypent-2,4-dienoate hydratase, and a transposon region highly similar to Tn5501. Upstream of cbzTEXGS, traNEOFG transfer genes were found. The search for gene clusters possibly completing the (chloro)catechol metabolic pathway of GJ31 revealed the presence of two additional catabolic gene clusters on pKW1. The mhpRBCDFETP cluster encodes enzymes for the dissimilation of 2,3-dihydroxyphenylpropionate in a novel arrangement characterized by the absence of a gene encoding 3-(3-hydroxyphenyl)propionate monooxygenase and the presence of a GntR-type regulator, whereas the nahINLOMKJ cluster encodes part of the naphthalene metabolic pathway. Transcription studies supported their possible involvement in chlorobenzene degradation. The upper pathway cluster, comprising genes encoding a chlorobenzene dioxygenase and a chlorobenzene dihydrodiol dehydrogenase, was localized on the chromosome. A high level of transcription in response to chlorobenzene revealed it to be crucial for chlorobenzene degradation. The chlorobenzene degradation pathway in strain GJ31 is thus a mosaic encoded by four gene clusters. DOI 10.1099/mic.0.032110-0

A multidrug efflux pump, SrpaBC, plays a key role in Pseudomonas putida S12 tolerance to toxic organic solvents. SrpRS are putative regulators of the SrpaBC efflux pump encoded upstream of the srpaBC structural genes, and previous studies suggest that SrpS is a repressor of SrpaBC expression. An S12 isolate able to withstand extreme solvent stress carries a novel insertion sequence, ISPpu21, interrupting srpS. This insertion preadapts S12 to extreme solvent conditions through constitutive SrpaBC expression. doi: 10.1128/JB.00832-09

Pseudomonas putida CA-3 is a styrene-degrading bacterium capable of accumulating medium-chain-length polyhydroxyalkanoate (mcIPHA) when exposed to limiting concentrations of a nitrogen source in the growth medium. Using shotgun proteomics we analysed global proteome expression in P. putida CA-3 supplied with styrene as the sole carbon and energy source under N-limiting (condition permissive for mclPHA synthesis) and non-limiting (condition non-permissive for mclPHA accumulation) growth conditions in order to provide insight into the molecular response of P. putida CA-3 to limitation of nitrogen when grown on styrene. A total of 1761 proteins were identified with high confidence and the detected proteins could be assigned to functional groups including styrene degradation, energy, nucleotide metabolism, protein synthesis, transport, stress response and motility. Proteins involved in the upper and lower styrene degradation pathway were expressed throughout the 48 h growth period under both nitrogen limitation and excess. Proteins involved in polyhydroxyalkanoate (PHA) biosynthesis, nitrogen assimilation and amino acid transport, and outer membrane proteins were upregulated under nitrogen limitation. PHA accumulation and biosynthesis were only expressed under nitrogen limitation. Nitrogen assimilation proteins were detected on average at twofold higher amounts under nitrogen limitation. Expression of the branched-chain amino acid ABC transporter was up to 16-fold higher under nitrogen-limiting conditions. Branched chain amino acid uptake by nitrogen-limited cultures was also higher than that by non-limited cultures. Outer membrane lipoproteins were expressed at twofold higher levels under nitrogen limitation. This was confirmed by Western blotting (immunochemical detection) of cells grown under nitrogen limitation. Our study provides the first global description of protein expression changes during growth of any organism on styrene and accumulating mclPHA (nitrogen-limited growth). DOI 10.1099/mic.0.031153-0

Pseudomonasputida KT2440 is a model strain for studying bacterial biodegradation processes. However, very little is known about nitrogen regulation in this strain. Here, we show that the nitrogen regulatory NtrC proteins from P. putida and Escherichia coli are functionally equivalent and that substitutions leading to partially active forms of enterobacterial NtrC provoke the same phenotypes in P. putida NtrC. P. putida has only a single [P.sub.II]-like protein, encoded by glnK, whose expression is nitrogen regulated. Two contiguous NtrC binding sites located upstream of the [[sigma].sup.N]-dependent glnK promoter have been identified by footprinting analysis. In vitro experiments with purified proteins demonstrated that glnK transcription was directly activated by NtrC and that open complex formation at this promoter required integration host factor. Transcription of genes orthologous to enterobacterial codB, dppA, and ureD genes, whose transcription is dependent on [[sigma].sup.70] and which are activated by Nac in E. coli, has also been analyzed for P. putida. Whereas dppA does not appear to be regulated by nitrogen via NtrC, the codB and ureD genes have [[sigma].sup.N]-dependent promoters and their nitrogen regulation was exerted directly by NtrC, thus avoiding the need for Nac, which is missing in this bacterial species. Based upon these results, we propose a simplified nitrogen regulatory network in P. putida (compared to that in enterobacteria), which involves an indirect-feedback autoregulation of glnK using NtrC as an intermediary. doi: 10.1128/JB.00744-09

We report here the identification and characterization of mrdH, a novel chromosomal metal resistance determinant, located in the genomic island 55 of Pseudomonas putida KT2440. It encodes for MrdH, a predicted protein of ~40 kDa with a chimeric domain organization derived from the RcnA and RND (for resistance-nodulation-cell division) metal efflux proteins. The metal resistance function ofmrdHwas identified by the ability to confer nickel resistance upon its complementation into rcnA mutant (a nickel- and cobalt-sensitive mutant) of Escherichia coli. However, the disruption of mrdH in P. putida resulted in an increased sensitivity to cadmium and zinc apart from nickel. Expression studies using quantitative reverse transcription-PCR showed the induction of mrdH by cadmium, nickel, zinc, and cobalt. In association with mrdH, we also identified a conserved hypothetical gene mreA whose encoded protein showed significant homology to NreA and NreA-like proteins. Expression of the mreA gene in rcnA mutant of E. coli enhanced its cadmium and nickel resistance. Transcriptional studies showed that both mrdH and mreA underwent parallel changes in gene expression. The mobile genetic elements Tn4652 and IS1246, flanking mrdH and mreA were found to be induced by cadmium, nickel, and zinc, but not by cobalt. This study is the first report of a single-component metal efflux transporter, mrdH, showing chimeric domain organization, a broad substrate spectrum, and a location amid metal-inducible mobile genetic elements. doi: 10.1128/JB.00465-09

RpoS is a bacterial sigma factor of RNA polymerase which is involved in the expression of a large number of genes to facilitate survival under starvation conditions and other stresses. The results of our study demonstrate that the frequency of emergence of base substitution mutants is significantly increased in long-term-starved populations of rpoS-deficient Pseudomonas putida cells. The increasing effect of the lack of RpoS on the mutation frequency became apparent in both a plasmid-based test system measuring [Phe.sup.+] reversion and a chromosomal rpoB system detecting rifampin-resistant mutants. The elevated mutation frequency coincided with the death of about 95% of the cells in a population of rpoS-deficient P. putida. Artificial overexpression of superoxide dismutase or catalase in the rpoS-deficient strain restored the survival of cells and resulted in a decline in the mutation frequency. This indicated that, compared to wild-type bacteria, rpoS-deficient cells are less protected against damage caused by reactive oxygen species. 7,8-Dihydro-8-oxoguanine (GO) is known to be one of the most stable and frequent base modifications caused by oxygen radical attack on DNA. However, the spectrum of base substitution mutations characterized in rpoS-deficient P. putida was different from that in bacteria lacking the GO repair system: it was broader and more similar to that identified in the wild-type strain. Interestingly, the formation of large deletions was also accompanied by a lack of RpoS. Thus, the accumulation of DNA damage other than GO elevates the frequency of mutation in these bacteria. It is known that oxidative damage of proteins and membrane components, but not that of DNA, is a major reason for the death of cells. Since the increased mutation frequency was associated with a decline in the viability of bacteria, we suppose that the elevation of the mutation frequency in the surviving population of carbon-starved rpoS-deficient P. putida may be caused both by oxidative damage of DNA and enzymes involved in DNA replication and repair fidelity.

Pseudomonas putida KT2440 exhibits redundant formaldehyde dehydrogenases and formate dehydrogenases that contribute to the detoxification of formaldehyde, a highly toxic compound. Physical and transcriptional analyses showed that the open reading frame (ORF) PP0328, encoding one of the formaldehyde dehydrogenases, is self-sufficient, whereas the other functional formaldehyde dehydrogenase gene (ORF PP3970) forms an operon with another gene of unknown function. Two formate dehydrogenase gene clusters (PP0489 to PP0492 and PP2183 to PP2186) were identified, and genes in these clusters were found to form operons. All four transcriptional promoters were mapped by primer extension and revealed the presence of noncanonical promoters expressed at basal level in the exponential growth phase and at a higher level in the stationary phase regardless of the presence of extracellular formaldehyde or formate. These promoters were characterized by a 5'-AG-CCA-C/A-CT-3' conserved region between -7 and -16. To determine the contribution of the different gene products to formaldehyde and formate mineralization, mutants with single and double mutations of formaldehyde dehydrogenases were generated, and the effect of the mutations on formaldehyde catabolism was tested by measuring [sup.14]C[O.sub.2] evolution from [sup.14]C-labeled formaldehyde. The results showed that both enzymes contributed to formaldehyde catabolism. A double mutant lacking these two enzymes still evolved C[O.sub.2] from formaldehyde, suggesting the presence of one or more still-unidentified formaldehyde dehydrogenases. Mutants with single and double mutations in the clusters for formate dehydrogenases were also generated, and all of them were able to metabolize [[sup.14]C]formate to [sup.14]C[O.sub.2], suggesting a redundancy of functions that was not limited to only the annotated genes. Single and double mutants deficient in formaldehyde dehydrogenases and formate dehydrogenases exhibited longer lag phases than did the parental strain when confronted with concentrations of formaldehyde close to the MICs. This suggests a role for the detoxification system in tolerance to sublethal concentrations of formaldehyde.

Transposition activity in bacteria is generally maintained at a low level. The activity of mobile DNA elements can be controlled by bacterially encoded global regulators. Regulation of transposition of Tn4652 in Pseudomonas putida is one such example. Activation of transposition of Tn4652 in starving bacteria requires the stationary-phase sigma factor RpoS and integration host factor (IHF). IHF plays a dual role in Tn4652 translocation by activating transcription of the transposase gene tnpA of the transposon and facilitating TnpA binding to the inverted repeats of the transposon. Our previous results have indicated that besides IHF some other P. putida-encoded global regulator(s) might bind to the ends of Tn4652 and regulate transposition activity. In this study, employing a DNase I footprint assay we have identified a binding site of P. putida Fis (factor for inversion stimulation) centred 135 bp inside the left end of Tn4652. Our results of gel mobility shift and DNase I footprint studies revealed that Fis out-competes IHF from the left end of Tn4652, thereby abolishing the binding of TnpA. Thus, the results obtained in this study indicate that the transposition of Tn4652 is regulated by the cellular amount of P. putida global regulators Fis and IHF.

The transcriptional regulation of three distinct alcohol oxidation systems, alcohol dehydrogenase (ADH)-I, ADH-IIB and ADH-IIG, in Pseudomonas putida HK5 was investigated under various induction conditions. The promoter activities of the genes involved in alcohol oxidation were determined using a transcriptional lacZ fusion promoter-probe vector. Ethanol was the best inducer for the divergent promoters of qedA and qedC, encoding ADH-I and a cytochrome c, respectively. Primary and secondary C3 and C4 alcohols and butyraldehyde specifically induced the divergent promoters of qbdBA and aldA, encoding ADH-IIB and an NAD-dependent aldehyde dehydrogenase, respectively. The qgdA promoter of ADH-IIG responded well to (S)-(+)-1,2-propanediol induction. In addition, the roles of genes encoding the response regulators exaE and agmR, located downstream of qedA, were inferred from the properties of exaE- or agmR-disrupted mutants and gene complementation tests. The gene products of both exaE and agmR were strictly necessary for qedA transcription. The mutation and complementation studies also suggested a role for AgmR, but not ExaE, in the transcriptional regulation of qbdBA (ADH-IIB) and qgdA (AGH-IIG). A hypothetical scheme describing a regulatory network, which directs expression of the three distinct alcohol oxidation systems in P. putida HK5, was derived.

A two-component system formed by a sensor histidine kinase and a response regulator has been identified as an element participating in cell density signal transduction in Pseudomonas putida KT2440. It is a homolog of the Pseudomonas aeruginosa RoxS/RoxR system, which in turn belongs to the RegA/RegB family, described in photosynthetic bacteria as a key regulatory element. In KT2440, the two components are encoded by PP_0887 (roxS) and PP_0888 (roxR), which are transcribed in a single unit. Characterization of this two-component system has revealed its implication in redox signaling and cytochrome oxidase activity, as well as in expression of the cell density-dependent gene ddcA, involved in bacterial colonization of plant surfaces. Whole-genome transcriptional analysis has been performed to define the P. putida RoxS/RoxR regulon. It includes genes involved in sugar and amino acid metabolism and the sulfur starvation response and elements of the respiratory chain (a cbb3 cytochrome oxidase, Fe-S clusters, and cytochrome c-related proteins) or genes participating in the maintenance of the redox balance. A putative RoxR recognition element containing a conserved hexamer (TGCCAG) has also been identified in promoters of genes regulated by this two-component system.

Pseudomonas putida G7 carries a naphthalene-catabolic and self-transmissible plasmid, NAH7, which belongs to the IncP-9 incompatibility group. Adjacent to the putative origin of conjugative transfer (oriT) of NAH7 are three genes, traD, traE, and traF, whose functions and roles in conjugation were previously unclear. These three genes were transcribed monocistronically and thus were designated the traD operon. Mutation of the three genes in the traD operon resulted in 10- to [10.sup.5]-fold decreases in the transfer frequencies of the plasmids from Pseudomonas to Pseudomonas and Escherichia coli and from E. coli to E. coli. On the other hand, the traD operon was essential for the transfer of NAH7 from E. coli to Pseudomonas strains. These results indicated that the traD operon is a host-range modifier in the conjugative transfer of NAH7. The TraD, TraE, and TraF proteins were localized in the cytoplasm, periplasm, and membrane, respectively, in strain G7 cells. Our use of a bacterial two-hybrid assay system showed that TraE interacted in vivo with other essential components for conjugative transfer, including TraB (coupling protein), TraC (relaxase), and MpfH (a channel subunit in the mating pair formation system).

It has been demonstrated that plasmids are not randomly distributed but are located symmetrically in mid-cell, or 1/4, 3/4 positions in bacterial cells. In this work we compared the localization of broad-host-range plasmid RK2 mini-replicons, which lack an active partitioning system, in Escherichia coli and Pseudomonas putida cells. In E. coli the location of the plasmid mini-replicon cluster was at the cell poles. In contrast, in Pseudomonas cells, as a result of the interaction of chromosomally encoded ParB protein with RK2 centromere-like sequences, these mini-derivatives were localized in the proximity of mid-cell, or 1/4, 3/4 positions. The expression of the Pseudomonas parAB genes in E. coli resulted in a positional change in the RK2 mini-derivative to the mid-cell or 1/4, 3/4 positions. Moreover, in a P. putida parAB mutant, both RK2 mini-derivatives and the entire RK2 plasmid exhibited disturbances of subcellular localization. These observations raise the possibility that in certain bacteria chromosomally encoded partitioning machinery could affect subcellular plasmid positioning.

RNase R is a 3'-5' highly processive exoribonuclease that can digest RNAs with extensive secondary structure. We analyzed the global elect of eliminating RNase R on the Pseudomonas putida transcriptome and the expression of the rnr gene under diverse conditions. The absence of RNase R led to increased levels of many mRNAs, indicating that it plays an important role in mRNA turnover.

The aerobic catabolism of nicotinic acid (NA) is considered a model system for degradation of N-heterocyclic aromatic compounds, some of which are major environmental pollutants; however, the complete set of genes as well as the structural-functional relationships of most of the enzymes involved in this process are still unknown. We have characterized a gene cluster (nic genes) from Pseudomonas putida KT2440 responsible for the aerobic NA degradation in this bacterium and when expressed in heterologous hosts. The biochemistry of the NA degradation through the formation of 2,5-dihydroxypyridine and maleamic acid has been revisited, and some gene products become the prototype of new types of enzymes with unprecedented molecular architectures. Thus, the initial hydroxylation of NA is catalyzed by a two-component hydroxylase (NicAB) that constitutes the first member of the xanthine dehydrogenase family whose electron transport chain to molecular oxygen includes a cytochrome c domain. The [Fe.sup.2+]-dependent dioxygenase (NicX) converts 2,5-dihydroxypyridine into N-formylmaleamic acid, and it becomes the founding member of a new family of extradiol ring-cleavage dioxygenases. Further conversion of N-formylmaleamic acid to formic and maleamic acid is catalyzed by the NicD protein, the only deformylase described so far whose catalytic triad is similar to that of some members of the [alpha]/ [beta]-hydrolase fold superfamily. This work allows exploration of the existence of orthologous gene clusters in saprophytic bacteria and some pathogens, where they might stimulate studies on their role in virulence, and it provides a framework to develop new biotechnological processes for detoxification/ biotransformation of N-heterocyclic aromatic compounds. ring-cleavage dioxygenase | nicotinic acid hydroxylase | heterocyclic compounds

Pseudomonas putida PCL1445 secretes two cyclic lipopeptides, putisolvin I and putisolvin II, which possess a surface-tension-reducing ability, and are able to inhibit biofilm formation and to break down biofilms of Pseudomonas species including Pseudomonas aeruginosa. The putisolvin synthetase gene cluster (pso) and its surrounding region were isolated, sequenced and characterized. Three genes, termed psoA, psoB and psoC, were identified and shown to be involved in putisolvin biosynthesis. The gene products encode the 12 modules responsible for the binding of the 12 amino acids of the putisolvin peptide moiety. Sequence data indicate that the adenylation domain of the 11th module prioritizes the recognition of Val instead of Leu or lle and consequently favours putisolvin I production over putisolvin II. Detailed analysis of the thiolation domains suggests that the first nine modules recognize the D form of the amino acid residues while the two following modules recognize the L form and the last module the L or D form, indifferently. The psoR gene, which is located upstream of psoA, shows high similarity to luxR-type regulatory genes and is required for the expression of the pso cluster. In addition, two genes, macA and macB, located downstream of psoC were identified and shown to be involved in putisolvin production or export.

Pseudomonas putida DS1 is able to utilize dimethyl sulfone as a sulfur source. Expression of the sfnFG operon responsible for dimethyl sulfone oxygenation is directly regulated by a [sigma]54-dependent transcriptional activator, SfnR, which is encoded within the sfnECR operon. We investigated the transcription mechanism for the sulfate starvation-induced expression of these sfn operons. Using an in vivo transcription assay and in vitro DNA-binding experiments, we revealed that SfnR negatively regulates the expression of sfnECR by binding to the downstream region of the transcription start point. Additionally, we demonstrated that a LysR-type transcriptional regulator, CysB, directly activates the expression of sfnECR by binding to its upstream region. CysB is a master regulator that controls the sulfate starvation response of the sfn operons, as is the case for the sulfonate utilization genes of Escherichia coli, although [CySB.sub.Ds1] appeared to differ from that of E. coli CysB in terms of the effect of O-acetylserine on DNA-binding ability. Furthermore, we investigated what effector molecules repress the expression of sfnFG and sfnECR in vivo by using the disruptants of the sulfate assimilatory genes cysNC and cysI. The measurements of mRNA levels of the sfn operons in these gene disruptants suggested that the expression of sfnFG is repressed by sulfate itself while the expression of sfnECR is repressed by the downstream metabolites in the sulfate assimilatory pathway, such as sulfide and cysteine. These results indicate that SfnR plays a role independent of CysB in the sulfate starvation-induced expression of the sfn operons.

The genome of Pseudomonas putida KT2440 encodes only five recognizable proteins belonging to the phosphoenolpyruvate (PEP)-carbohydrate phosphotransferase system (PTS). Two of these PTS constituents (FruA and FruB) form a complete system for fructose intake. The other three products, encoded byptsP ([EI.sup.Ntr]),ptsO (NPr), and ptsN ([EIIA.sup.Ntr]), comprise a branch of the system unrelated to sugar traffic but thought to have an influence on coordination of N and C metabolism. We used a genetic approach to clarify the course of high-energy phosphate through this reduced set of PTS proteins. To this end, we monitored the phosphorylation state in vivo of the [EIIA.sup.Ntr] enzyme in various genetic backgrounds and growth conditions. Our results show that the source of phosphate available to the system is PEP and that the primary flow of phosphate through the N/C-sensing PTS proceeds from PEP to [EI.sup.Ntr] to NPr to [EIIA.sup.Ntr]. We also found that in the presence of fructose, unlike in the presence of succinate, [EIIA.sup.Ntr] can be phosphorylated in aptsP strain but not in aptsP fruB double mutant. This result revealed that the fructose transport system has the ability to cross talk in vivo with the N-related PTS branch. The data reported here thus document an unexpected connection in vivo between the sugar-dependent and sugar-independent PTSs.

Pseudomonas putida KT2440 channels glucose to the central Entner-Doudoroff intermediate 6-phosphogluconate through three convergent pathways. The genes for these convergent pathways are clustered in three independent regions on the host chromosome. A number of monocistronic units and operons coexist within each of these clusters, favoring coexpression of catabolic enzymes and transport systems. Expression of the three pathways is mediated by three transcriptional repressors, HexR, GnuR, and PtxS, and by a positive transcriptional regulator, GItR-2. In this study, we generated mutants in each of the regulators and carried out transcriptional assays using microarrays and transcriptional fusions. These studies revealed that HexR controls the genes that encode glucokinase/glucose 6-phosphate dehydrogenase that yield 6-phosphogluconate; the genes for the Entner-Doudoroff enzymes that yield glyceraldehyde-3-phosphate and pyruvate; and gap-1, which encodes glyceraldehyde-3-phosphate dehydrogenase. GItR-2 is the transcriptional regulator that controls specific porins for the entry of glucose into the periplasmic space, as well as the gtsABCD operon for glucose transport through the inner membrane. GnuR is the repressor of gluconate transport and gluconokinase responsible for the conversion of gluconate into 6-phosphogluconate. PtxS, however, controls the enzymes for oxidation of gluconate to 2-ketogluconate, its transport and metabolism, and a set of genes unrelated to glucose metabolism.

The unknown genetic basis for improved phenol production by a recombinant Pseudomonas putida S12 derivative bearing the tpl (tyrosine-phenol lyase) gene was investigated via comparative transcriptomics, nucleotide sequence analysis, and targeted gene disruption. We show upregulation of tyrosine biosynthetic genes and possibly decreased biosynthesis of tryptophan caused by a mutation in the trpE gene as the genetic basis for the enhanced phenol production. In addition, several genes in degradation routes connected to the tyrosine biosynthetic pathway were upregulated. This either may be a side effect that negatively affects phenol production or may point to intracellular accumulation of tyrosine or its intermediates. A number of genes identified by the transcriptome analysis were selected for targeted disruption in P. putida S12TPL3. Physiological and biochemical examination of P. putida S12TPL3 and these mutants led to the conclusion that the metabolic flux toward tyrosine in P. putida S12TPL3 was improved to such an extent that the heterologous tyrosine-phenol lyase enzyme had become the rate-limiting step in phenol biosynthesis.

According to in silico analysis, the genome of Pseudomonas putida KT2440 encodes at least four Zn/Cd/Pb efltux transporters--two P-type ATPases (CadA1 and CadA2) and two czc chemiosmotic transporters (Czc-CBA1 and CzcCBA2). In this study we showed that all these transporters are functional, but under laboratory conditions only two of them were involved in the mediation of heavy metal resistance in P. putida KT2440. CadA2 conferred [Cd.sup.2+] and [Pb.sup.2+] resistance, whereas CzcCBA1 was involved in export of [Zn.sup.2+], [Cd.sup.2+], and possibly [Pb.sup.2+]. CadA1, although nonfunctional in P. putida, improved [Zn.sup.2+] resistance and slightly improved [Cd.sup.2+] resistance when it was expressed in Escherichia coli. CzcCBA2 contributed to Zn resistance of a czcA1-defective P. putida strain or when the CzcA2 subunit was overexpressed in a transporter-deficient strain. It seemed that CzcA2 could complex with CzcCl and CzcB1 subunits and therefore complement the loss of CzcA1. The CzcCBA2 transporter itself, however, did not function. Expression of cadA1, cadA2, and czcCBA1 was induced by heavy metals, and the expression levels were dependent on the growth medium and growth phase. Expression of cadA2 and czcCBA1 was nonspecific; both genes were induced by [Zn.sup.2+], [Cd.sup.2+], [Pb.sup.2+], [Ni.sup.2+], [Co.sup.2+], and [Hg.sup.2+]. On the other hand, remarkably, expression of cadA1 was induced only by [Zn.sup.2+]. Possible roles of distinct but simultaneously functioning transporters are discussed.

We describe an ATP-binding cassette (ABC) transporter in Pseudomonas putida KT2440 that mediates the uptake of glutamate and aspartate. The system (AatJMQP, for acidic amino acid transport) is encoded by an operon involving genes PP1071-PP1068. A deletion mutant with inactivated solute-binding protein (KTaatJ) failed to grow on Glu and Gin as sole sources of carbon and nitrogen, while a mutant lacking a functional nucleotide-binding domain (KTaatP) was able to adapt to growth on Glu after an extended lag phase. Uptake of Glu and Asp by either mutant was greatly impaired at both low and high amino acid concentrations. The purified solute-binding protein AatJ exhibited high affinity towards Glu and Asp ([K.sub.d]=0.4 and 1.3 [micro]M, respectively), while Gin and Asn as well as dicarboxylates (succinate and fumarate) were bound with much lower affinity. We further show that the expression of AatJMQP is controlled by the [sigma].sup.54]-dependent two-component system AauRS. Binding of the response regulator AauR to the aat promoter was examined by gel mobility shift assays and DNase I footprinting. By in silico screening, the AauR-binding motif (the inverted repeat TTCGGNNNNCCGAA) was detected in further P. putida KT2440 genes with established or putative functions in acidic amino acid utilization, and also occurred in other pseudomonads. The products of these AauR-responsive genes include the [H.sup.+]/Glu symporter GltP, a periplasmic glutaminase/asparaginase, AnsB, and phosphoenolpyruvate synthase (PpsA), a key enzyme of gluconeogenesis in Gram-negative bacteria. Based on these findings, we propose that AauR is a central regulator of acidic amino acid uptake and metabolism in pseudomonads.

Crc protein is a global regulator involved in catabolite repression control of several pathways for the assimilation of carbon sources in pseudomonads when other preferred substrates are present. In Pseudomonas putida cells growing exponentially in a complete medium containing benzoate, Crc strongly inhibits the expression of the benzoate degradation genes. These genes are organized into several transcriptional units. We show that Crc directly inhibits the expression of the peripheral genes that transform benzoate into catechol (the ben genes) but that its effect on genes corresponding to further steps of the pathway (the cat and pca genes of the central catechol and [beta]-ketoadipate pathways) is indirect, since these genes are not induced because the degradation intermediates, which act as inducers, are not produced. Crc inhibits the translation of target genes by binding to mRNA. The expression of the ben, cat, and pca genes requires the BenR, CatR, and PcaR transcriptional activators, respectively. Crc significantly reduced benABCD mRNA levels but did not affect those of benR. Crc bound to the 5' end of benR mRNA but not to equivalent regions of catR and pcaR mRNAs. A translational fusion of the benR and lacZ genes was sensitive to Crc, but a transcriptional fusion was not. We propose that Crc acts by reducing the translation of benR mRNA, decreasing BenR levels below those required for the full expression of the benABCD genes. This strategy provides great metabolic flexibility, allowing the hierarchical assimilation of different structurally related compounds that share a common central pathway by selectively regulating the entry of each substrate into the central pathway.

This work describes a regulatory network of Pseudomonas putida controlled in response to nitrogen availability. We define NtrC as the master nitrogen regulator and suggest that it not only activates pathways for the assimilation of alternative nitrogen sources but also represses carbon catabolism under nitrogen-limited conditions, possibly to prevent excessive carbon and energy flow in the cell.

In contrast to the vast majority of the members of the domain Bacteria, several Pseudomonas and Xanthomonas species have two lexA genes, whose products have been shown to recognize different LexA binding motifs, making them an interesting target for studying the interplay between cohabiting LexA regulons in a single species. Here we report an analysis of the genetic composition of the two LexA regulons of Pseudomonas putida KT2440 performed with a genomic microarray. The data obtained indicate that one of the two LexA proteins (LexA1) seems to be in control of the conventional Escherichia coli-like SOS response, while the other LexA protein (LexA2) regulates only its own transcriptional unit, which includes the imuA, imuB, and dnaE2 genes, and a gene (PP_3901) from a resident P. putida prophage. Furthermore, PP_3901 is also regulated by LexA1 and is required for DNA damage-mediated induction of several P. putida resident prophage genes. In silico searches suggested that this marked asymmetry in regulon contents also occurs in other Pseudomonas species with two lexA genes, and the implications of this asymmetry in the evolution of the SOS network are discussed.

Pseudomonas putida CSV86 utilizes aromatic compounds in preference to glucose and coutilizes aromatics and organic acids. Protein analysis of cells grown on different carbon sources, either alone or in combination, revealed that a 43-kDa periplasmic-space protein was induced by glucose and repressed by aromatics and succinate. Two-dimensional gel electrophoresis and liquid chromatography-tandem mass spectrometry analysis identified this protein as closely resembling the sugar ABC transporter of Pseudomonas putida KT2440. A partially purified 43-kDa protein showed glucose binding activity and was specific for glucose. The results demonstrate that the aromatic- and organic acid-mediated repression of a periplasmic-space glucose binding protein and consequent inhibition of glucose transport are responsible for this strain's ability to utilize aromatics and organic acids in preference to glucose.

The IncP-7 plasmid pCAR1 of Pseudomonas resinovorans CA10 confers the ability to degrade carbazole upon transfer to the recipient strain P. putida KT2440. We designed a customized whole-genome oligonucleotide microarray to study the coordinated expression of pCAR1 and the chromosome in the transconjugant strain KT2440(pCAR1). First, the transcriptome of KT2440(pCAR1) during growth with carbazole as the sole carbon source was compared to that during growth with succinate. The carbazole catabolic car and ant operons were induced, along with the chromosomal eat and pea genes involved in the catechol branch of the [beta]-ketoadipate pathway. Additionally, the regulatory gene antR encoding the AraC/XylS family transcriptional activator specific for car and ant operons was upregulated. The characterization of the antR promoter revealed that antR is transcribed from an RpoN-dependent promoter, suggesting that the successful expression of the carbazole catabolic operons depends on whether the chromosome contains the specific RpoN-dependent activator. Next, to analyze whether the horizontal transfer of a plasmid alters the transcription network of its host chromosome, we compared the chromosomal transcriptomes of KT2440(pCAR1) and KT2440 under the same growth conditions. Only subtle changes were caused by the transfer of pCAR1, except for the significant induction of the hypothetical gene PP3700, designated parI, which encodes a putative ParA-like ATPase with an N-terminal Xre-type DNA-binding motif. Further transcriptional analyses showed that the parI promoter was positively regulated by ParI itself and the pCAR1-encoded protein ParA.

The [[sigma].sup.54]-dependent transcriptional regulator SfnR is essential for the use of dimethyl sulfone ([DMSO.sub.2]) as a sulfur source by Pseudomonas putida DS1. SfnR binds three SfnR-binding sites (sites 1,2 and 3) within an intergenic region of the divergently transcribed sfnAB and sfnFG gene clusters. The site 1 region, proximal to the sfnF gene, is indispensable for the expression of the sfnFG operon, which encodes components of [DMSO.sub.2] monooxygenase. We investigated the transcriptional regulation of the sfnAB operon and possible functions of the sfnA gene. RT-PCR analysis revealed that the sfnAB gene cluster, which is similar to homologues of the acyl-CoA dehydrogenase family, was transcribed as an operon, and its expression was regulated by SfnR under conditions of sulfate starvation. Deletion analyses using lacZ as a reporter demonstrated that the region up to at least -138 bp from the transcription start point of sfnA (containing sites 2 and 3) was necessary for the expression of the sfnAB operon. A growth test of the sfnA-disrupted mutant revealed the possibility that sfnA may be involved in the use of methanethiol as a sulfur source.

Pseudomonas putida KT2440(pWW0) can use toluene via the TOL plasmid-encoded catabolic pathways and can use glucose via a series of three peripheral chromosome-encoded routes that convert glucose into 6-phosphogluconate (6PG), namely, the glucokinase pathway, in which glucose is transformed to 6PG through the action of glucokinase and glucose-6-phosphate dehydrogenase. Alternatively, glucose can be oxidized to gluconate, which can be phosphorylated by gluconokinase to 6PG or oxidized to 2-ketogluconate, which, in turn, is converted into 6PG. Our results show that KT2440 metabolizes glucose and toluene simultaneously, as revealed by net flux analysis of [sup.13]C]glucose. Determination of glucokinase and gluconokinase activities in glucose metabolism, gene expression assays using a fusion of the promoter of the Pu TOL upper pathway to 'lacZ, and global transcriptomic assays revealed simultaneous catabolite repression in the use of these two carbon sources. The effect of toluene on glucose metabolism was directed to the glucokinase branch and did not affect gluconate metabolism. Catabolite repression of the glucokinase pathway and the TOL pathway was triggered by two different catabolite repression systems. Expression from Pu was repressed mainly via PtsN in response to high levels of 2-dehydro-3-deoxygluconate6-phosphate, whereas repression of the glucokinase pathway was channeled through Crc.

Oxidative damage of DNA is a source of mutation in living cells. Although all organisms have evolved mechanisms of defense against oxidative damage, little is known about these mechanisms in nonenteric bacteria, including pseudomonads. Here we have studied the involvement of oxidized guanine (GO) repair enzymes and DNA-protecting enzyme Dps in the avoidance of mutations in starving Pseudomonas putida. Additionally, we examined possible connections between the oxidative damage of DNA and involvement of the error-prone DNA polymerase (Pol)V homologue RulAB in stationary-phase mutagenesis in P. putida. Our results demonstrated that the GO repair enzymes MutY, MutM, and MutT are involved in the prevention of base substitution mutations in carbon-starved P. putida. Interestingly, the antimutator effect of MutT was dependent on the growth phase of bacteria. Although the lack of MutT caused a strong mutator phenotype under carbon starvation conditions for bacteria, only a twofold increased effect on the frequency of mutations was observed for growing bacteria. This indicates that MutT has a backup system which efficiently complements the absence of this enzyme in actively growing cells. The knockout of MutM affected only the spectrum of mutations but did not change mutation frequency. Dps is known to protect DNA from oxidative damage. We found that dps-defective P. putida cells were more sensitive to sudden exposure to hydrogen peroxide than wild-type cells. At the same time, the absence of Dps did not affect the accumulation of mutations in populations of starved bacteria. Thus, it is possible that the protective role of Dps becomes essential for genome integrity only when bacteria are exposed to exogenous agents that lead to oxidative DNA damage but not under physiological conditions. Introduction of the Y family DNA polymerase PolV homologue rulAB into P. putida increased the proportion of A-to-C and A-to-G base substitutions among mutations, which occurred under starvation conditions. Since PolV is known to perform translesion synthesis past damaged bases in DNA (e.g., some oxidized forms of adenine), our results may imply that adenine oxidation products are also an important source of mutation in starving bacteria.

The genome sequences of several pseudomonads have revealed a gene cluster containing genes for a two-component heavy metal histidine sensor kinase and response regulator upstream of cinA and cinQ, which we show herein to encode a copper-containing azurin-like protein and a pre-[Q.sub.0] reductase, respectively. In the presence of copper, Pseudomonas putida KT2440 produces the CinA and CinQ proteins from a bicistronic mRNA. UV-visible spectra of CinA show features at 439, 581, and 719 nm, which is typical of the plastocyanin family of proteins. The redox potential of the protein was shown to be 456 [+ or -] 4 mV by voltametric titrations. Surprisingly, CinQ is a pyridine nucleotide-dependent nitrile oxidoreductase that catalyzes the conversion of pre-[Q.sub.0] to pre-[Q.sub.1] in the nucleoside queuosine biosynthetic pathway. Gene disruptions of cinA and cinQ did not lead to a significant increase in the copper sensitivity of P. putida KT2440 under the conditions tested. Possible roles of CinA and CinQ to help pseudomonads adapt and survive under prolonged copper stress are discussed.

In this study, we show that glucose catabolism in Pseudomonas putida occurs through the simultaneous operation of three pathways that converge at the level of 6-phosphogluconate, which is metabolized by the Edd and Era Entner/Doudoroff enzymes to central metabolites. When glucose enters the periplasmic space through specific OprB porins, it can either be internalized into the cytoplasm or be oxidized to gluconate. Glucose is transported to the cytoplasm in a process mediated by an ABC uptake system encoded by open reading frames PPI015 to PPI018 and is then phosphorylated by glucoldnase (encoded by' the glk gene) and converted by glucose-6-phosphate dehydrogenase (encoded by the zwf genes) to 6-phosphogluconate. Gluconate in the periplasm can be transported into the cytoplasm and subsequently phosphorylated by gluconokinase to 6-phosphogluconate or oxidized to 2-ketogluconate, which is transported to the cytoplasm, and subsequently phosphorylated and reduced to 6-phosphoglnconate. In the wild-type strain, glucose was consumed at a rate of around 6 mmol [g.sup.-1] [h.sup.-1], which allowed a growth rate of 0.58 h J and a biomass yield of 0.44 g/g carbon used. Flux analysis of 13C-labeled glucose revealed that, in the Krebs cycle, most of the oxalacetate fraction was produced by the pyruvate shunt rather than by the direct oxidation of malate by malate dehydrogenase. Enzymatic and microarray assays revealed that the enzymes, regulators, and transport systems of the three peripheral glucose pathways were induced in response to glucose in the outer medium. We generated a series of isogenic mutants in one or more of the steps of all three pathways and found that, although all three functioned simultaneously, the glucokinase pathway and the 2-ketogluconate loop were quantitatively more important than the direct phosphorylation of gluconate. In physical terms, glucose catabolism genes were organized in a series of clusters scattered along the chromosome. Within each of the clusters, genes encoding porins, transporters, enzymes, and regulators formed operons, suggesting that genes in each cluster coevolved. The glk gene encoding glucokinase was located in an operon with the edd gene, whereas the zwf-1 gene, encoding glucose-6-phosphate dehydrogenase, formed an operon with the eda gene. Therefore, the enzymes of the glucokinase pathway and those of the Entner-Doudoroff pathway are physically linked and induced simultaneously. It can therefore be concluded that the glucokinase pathway is a sine qua non condition for P. putida to grow with glucose.

Genetic differentiation by natural selection is readily observed among microbial populations, but a more comprehensive understanding of evolutionary forces, genetic causes, and resulting phenotypic advantages is not often sought. Recently, a surface population of Pseudomonas putida bacteria was shown to evolve rapidly by natural selection of better-adapted variants in a mixed-species biofilm consortium (S. K. Hansen, P. B. Rainey, J. A. Haagensen, and S. Molin, Nature 445:533-536, 2007). Adaptation was caused by mutations in a wapH homolog (PP4943) involved in core lipopolysaccharide biosynthesis. Here we investigate further the biofilm physiology and the phenotypic characteristics of the selected P. putida rough colony variants. The coexistence of the P. putida population in a mixed-species biofilm with Acinetobacter sp. strain C6 is dependent on the benzoate excreted from Acinetobacter during the catabolism of benzyl alcohol, the sole carbon source. Examination of biofilm development and the dynamics of the wild-type consortium revealed that the biofilm environment became oxygen limited, possibly with low oxygen concentrations around Acinetobacter microcolonies. In contrast to P. putida wild-type cells, which readily dispersed from the mixed-species biofilm in response to oxygen starvation, the rough variant cells displayed a nondispersal phenotype. However, in monospecies biofilms proliferating on benzoate, the rough variant (like the wild-type population) dispersed in response to oxygen starvation. A key factor explaining this conditional, nondispersal phenotype is likely to be the acquired ability of the rough variant to coaggregate specifically with Acinetobacter cells. We further show that the P. putida rough variant displayed enhanced production of a cellulose-like polymer as a consequence of the mutation in wapH. The resulting phenotypic characteristics of the P. putida rough variant explain its enhanced fitness and ability to form tight structural associations with Acinetobacter microcolonies.

Transcription of the plasmid-borne phenol catabolic operon pheBA in Pseudomonas putida is activated by the LysR-family regulator CatR in the presence of the effector molecule cis, cis-muconate (CCM), which is an intermediate of the phenol degradation pathway. In addition to the positive control of the operon, several factors negatively affect transcription initiation from the pheBA promoter. First, the activation of the pheBA operon depends on the extracellular concentration of phenol. The pheBA promoter is rapidly activated in the presence of micromolar concentrations of phenol in minimal growth medium, but the initiation of transcription from this promoter is severely delayed after sudden exposure of bacteria to 2.5 mM phenol. Second, the transcriptional activation from this promoter is impeded when the growth medium of bacteria contains amino acids. The negative effects of amino acids can be suppressed either by overproducing CatR or by increasing, the intracellular amount of CCM. However, the intracellular amount of CCM is a major limiting factor for the transcriptional activation of the pheBA operon, as accumulation of CCM in a P. putida catB-defective strain, unable to metabolize CCM (but expressing CatR at a natural level), almost completely relieves the negative effects of amino acids. The intracellular amount of CCM is negatively affected by the catabolite repression control protein via downregulating at the post-transcriptional level the expression of the pheBA-encoded catechol 1,2-dioxygenase and the phenol monooxygenase, the enzymes needed for CCM production.

The genome of Pseudomonas putida KT2440 encodes five proteins of the phosphoenolpyruvate-earbohydrate phosphotransferase system. Two of these (FruA and FruB) form a dedicated system for fructose intake, while enzyme [I.sup.Ntr] (E[I.sup.Ntr]; encoded by ptsP), NPr (ptsO), and EI[I.sup.Ntr] (ptsN) act in concert to control the intracellular accumulation of polyhydroxyalkanoates, a typical product of carbon overflow.

We analyzed the target preferences of a Tn3 family transposon Tn4652. Alignment of 93 different insertion sites revealed a consensus sequence which resembles that of Tn3, indicating that despite a low similarity between Tn4652 and Tn3 transposases, their target site recognition is conserved. doi:10.1128/JB.01863-06

Pseudomonas putida uses L-lysine as the sole carbon and nitrogen source which preferentially requires its metabolism through two parallel pathways. In one of the pathways [delta]-aminovalerate is the key metabolite, whereas in the other L-lysine is racemized to D-lysine, and L-pipecolate and [alpha]-aminoadipate are the key metabolites. All the genes and enzymes involved in the D-lysine pathway, except for those involved in the conversion of D-lysine into [[DELTA].sup.1]-piperideine-2-carboxylate, have been identified previously (30). In this study we report that the conversion of D-lysine into [[DELTA].sup.1]-piperideine-2-carboxylate can be mediated by a D-lysine aminotransferase (PP3590) and a D-lysine dehydrogenase (PP3596). From a physiological point of view PP3596 plays a major role in the catabolism of D-lysine since its inactivation leads to a marked reduction in the growth rate with L- or D-lysine as the sole carbon and nitrogen source, whereas inactivation of PP3590 leads only to slowed growth. The gene encoding PP3590, called here amaC, forms an operon with dpkA, the gene encoding the enzyme involved in conversion of [[DELTA].sup.1]-piperideine-2-carboxylate to L-pipecolate in the D-lysine catabolic pathway. The gene encoding PP3596, called here amaD, is the fifth gene in an operon made up of seven open reading frames (ORFs) encoding PP3592 through PP3597. The dpkA amaC operon was transcribed divergently from the operon ORF3592 to ORF3597. Both promoters were mapped by primer extension analysis, which showed that the divergent -35 hexamers of these operon promoters were adjacent to each other. Transcription of both operons was induced in response to L- or D-lysine in the culture medium.

Pseudomonas putida encodes 20 extracytoplasmic sigma factors (ECFs). In this study, we show that one of these ECFs, known as ECF-Pp12 (PP3006), plays a role in tolerance of toluene and other organic solvents. Based on this finding, we have called the gene that encodes this new ECF rpoT. The rpoT gene forms an operon with the preceding gene and with the gene located downstream. The translated gene product of the open reading frame PP3005 is an inner membrane protein, whereas the PP3007 protein is periplasmic. A nonpolar [DELTA]rpoT mutant was generated by homologous recombination, and survival of the mutant was tested under various stress conditions. The mutant strain was hypersensitive to toluene and other solvents but just as tolerant as the wild type of stress imposed by heat, antibiotics, NaCI, paraquat, sodium dodecyl sulfate, [H.sub.2][O.sub.2], and benzoate. In the [DELTA]rpoT mutant background, expression of around 50 transcriptional units was affected: 31 cistrons were upregulated, and 23 cistrons were downregulated. This indicates that about 1% of all P. putida genes are under the direct or indirect influence of RpoT. The rpoT gene controls the expression of a number of membrane proteins, including components of the respiratory chains, porins, transporters, and multidrug efflux pumps. Hypersensitivity of the P. putida RpoT-deficient mutant to organic solvents can be attributed to the fact that in the [DELTA]rpoT strain, expression of the toluene etflux pump ttgGHI genes is severalfold lower than in the parental strain.

As reported, the two-component system ColRS is involved in two completely different processes. It facilitates the root colonization ability of Pseudomonas fluorescens and is necessary for the Tn4652 transposition-dependent accumulation of phenol-utilizing mutants in Pseudomonas putida. To determine the role of the ColRS system in P. putida, we searched for target genes of response regulator ColR by use of a promoter library. Promoter screening was performed on phenol plates to mimic the conditions under which the effect of ColR on transposition was detected. The library screen revealed the porin-encoding gene oprQ and the alginate biosynthesis gene algD occurring under negative control of ColR. Binding of ColR to the promoter regions of oprQ and algD in vitro confirmed its direct involvement in regulation of these genes. Additionally, the porin-encoding gene omp[A.sub.PP0773] and the type I pilus gene csuB were also identified in the promoter screen. However, it turned out that omp[A.sub.PP0773] and csuB were actually affected by phenol and that the influence of ColR on these promoters was indirect. Namely, our results show that ColR is involved in phenol tolerance of P. putida. Phenol MIC measurement demonstrated that a colR mutant strain did not tolerate elevated phenol concentrations. Our data suggest that increased phenol susceptibility is also the reason for inhibition of transposition of Tn4652 in phenol-starving colR mutant bacteria. Thus, the current study revealed the role of the ColRS two-component system in regulation of membrane functionality, particularly in phenol tolerance of P. putida.

The Pseudomonas putida KT2440 TOL upper pathway is repressed under nonlimiting conditions in cells growing in chemostat with succinate as a carbon source. A demonstration that the ptsN gene product [IIA.sup.Ntr] participates in this repression is presented.

Hydrogenophaga intermedia strain S1 and Agrobacterium radiobacter strain $2 form a mixed bacterial culture which degrades sulfanilate (4-aminobenzenesulfonate) by a novel variation of the [beta]-ketoadipate pathway via 4-sulfocatechol and 3-sulfomuconate. It was previously proposed that the further metabolism of 3-sulfomuconate is catalysed by modified 3-carboxy-cis, cis-muconate-lactonizing enzymes (CMLEs) and that these 'type 2' enzymes were different from the conventional CMLEs ('type 1') from the protocatechuate pathway in their ability to convert 3-sulfomuconate in addition to 3-carboxy-cis,cis-muconate. In the present study the genes for two CMLEs (pcaB2S1 and pcaB2S2) were cloned from H. intermedia S1 and A. radiobacter S2, respectively. In both strains, these genes were located close to the previously identified genes encoding the 4-sulfocatechol-converting enzymes. The gene products of pcaB2Sl and pcaB2S2 were therefore tentatively identified as type 2 enzymes involved in the metabolism of 3-sulfomuconate. The genes were functionally expressed and the gene products were shown to convert 3-carboxy-cis,cis-muconate and 3-sulfomuconate. 4-Carboxymethylene-4-sulfo-but-2en-olide (4-sulfomuconolactone) was identified by HPLC-MS as the product, which was enzymically formed from 3-sulfomuconate. His-tagged variants of both CMLEs were purified and compared with the CMLE from the protocatechuate pathway of Pseudomonas putida PRS2000 for the conversion of 3-carboxy-cis,cis-muconate and 3-sulfomuconate. The CMLEs from the 4-sulfocatechol pathway converted 3-sulfomuconate with considerably higher activities than 3-carboxy-cis,cis-muconate. Also the CMLE from P. putida converted 3-sulfomuconate, but this enzyme demonstrated a clear preference for 3-carboxy-cis, cis-muconate as substrate. Thus it was demonstrated that in the 4-sulfocatechol pathway, distinct CMLEs are formed, which are specifically adapted for the preferred conversion of sulfonated substrates.

Toluene and other fuel hydrocarbons are commonly found in association with radionuclides at numerous US Department of Energy sites, frequently occurring together with Cr(VI) and other heavy metals. In this study, the extremely radiation-resistant bacterium Deinococcus radiodurans, which naturally reduces Cr(VI) to the less mobile and less toxic Cr(III), was engineered for complete toluene degradation by cloned expression of tod and xyl genes of Pseudomonas putida. The recombinant Tod/Xyl strain showed incorporation of carbon from 14C-labelled toluene into cellular macromolecules and carbon dioxide, in the absence or presence of chronic ionizing radiation. The engineered bacteria were able to oxidize toluene under both minimal and complex nutrient conditions, and recombinant cells reduced Cr(VI) in sediment microcosms. As such, the Tod/Xyl strain could provide a model for examining the reduction of metals coupled to organic contaminant oxidation in aerobic radionuclide-contaminated sediments.

Biphasic systems are exploited for biocatalysis and can overcome the problem of low productivity in conventional media. A significant step in exploring the biotechnological potential of novel biocatalysis to develop an efficient biodesulfurization process in biphasic reaction mixtures containing toxic organic solvents is studied.

The solvent tolerant strain Pseudomonas putida DOT-TIE was grown in batch fermentations in a 5-liter bioreactor in the presence and absence of 10% (vol/vol) of the organic solvent 1-decanol. The results give clear physiological indications that the process with P. putida DOT-TIE as the biocatalyst and 1-decanol as the solvent is a stable system for two-phase biotransformations that will allow the production of fine chemicals in economically sound amounts.

Pseudomonas putida strain PCLI445 produces two cyclic lipopeptides, putisolvin I and putisolvin II, which possess surface tension-reducing abilities and are able to inhibit biofilm formation and to break down existing biofilms of several Pseudomonas spp., including P. aeruginosa. Putisolvins are secreted in the culture medium during growth at late exponential phase, indicating that production is possibly regulated by quorum sensing. In the present study, we identified a quorum-sensing system in PCL1445 that is composed of ppuI, rsaL, and ppuR and shows very high similarity with gene clusters of P. putida strains IsoF and WCS358. Strains with mutations in ppuI and ppuR showed a severe reduction of putisolvin production. Expression analysis of the putisolvin blosynthetic gene in appuI background showed decreased expression, which could be complemented by the addition of synthetic 3-oxo-[C.sub.10]-N-acyl homoserine lactone (3-oxo-[C.sub.10]-AHL) or 3-oxo-[C.sub.12]-AHL to the medium. An rsaL mutant overproduces AHLs, and production of putisolvins is induced early during growth. Analysis of biofilm formation on polyvinylchloride showed that ppul and ppuR mutants produce a denser biofilm than PCL1445, which correlates with decreased production of putisolvins, whereas an rsaL mutant shows a delay in biofilm production, which correlates with early production of putisolvins. The results demonstrate that quorum-sensing signals induce the production of cyclic lipopeptides putisolvin I and II and consequently control biofilm formation by Pseudomonas putida.

A study is conducted to quantify changes in the macromolecular composition of cellular and extracellular polymeric substances fractions of unsaturated Pseudomonas putida mt-2 biofilms exposed to iron and Cr to relate such changes to Cr fates in the soil environment. The results show that Cr accumulation in unsaturated biofilms occurs with enzymatic reduction of Cr(VI), cellular lysis, cellular association, and extracellular DNA binding of Cr(III), which altogether could facilitate localized biotic stabilization of Cr in contaminated vadose zones.

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGD EF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the ISl10/IS492 family. The same duplication was observed after transposition of ISPpul0 from a plasmid to the chromosome of P. putida DOT-TIE, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.