Search

Malignant tumors continue to pose a significant threat to human life and safety and their development is primarily due to the activation of proto-oncogenes and the inactivation of suppressor genes. Among these, the activation of proto-oncogenes possesses greater potential to drive the malignant transformation of cells. Targeting oncogenes involved in the malignant transformation of tumor cells has provided a novel approach for the development of current antitumor drugs. Several preclinical and clinical studies have revealed that the development pathway of B cells, and the malignant transformation of mature B cells into tumors have been regulated by oncogenes and their metabolites. Therefore, summarizing the key oncogenes involved in the process of malignant transformation of mature B cells and elucidating the mechanisms of action in tumor development hold significant importance for the clinical treatment of malignant tumors.

EVI1 is a zinc finger transcription factor encoded by the MECOM locus and is essential for the development and maintenance of hematopoietic stem cells. However, overexpression of EVI1 in various myeloid malignancies is associated with aggressive clinical behavior and poor outcome. The locus encodes multiple isoforms that are differentially acting and independently regulated. EVI1 interacts with a variety of transcription and epigenetic factors via different domains. It also regulates cell survival, differentiation, and proliferation through a variety of mechanisms, including transcriptional activation and repression, regulation of other transcription factors' activity, and chromatin remodeling. While the mechanism by which 3q26 translocation leads to high EVI1 expression through enhancer hijacking of genes active in myeloid development is now better understood, regulation of EVI1 expression in the absence of chromosomal translocations and in normal hematopoiesis remains unclear. Recent studies have provided insight into the regulatory mechanisms of EVI1 expression and action, which may lead to development of targeted therapies in the near future.

Cancer genes are largely categorized into tumor suppressor gene (TSG) and proto-oncogene, but many have dual activities depending on the cellular context. In the present study, we analyzed DYRK1B, ESRP1, MTSS1, ADAMTS1, and INPP5F genes known to possess the dual activities in sporadic colon cancers (CCs). By the mutation analysis, we identified DYRK1B, ESRP1, MTSS1, ADAMTS1, and INPP5F frameshift mutations in 2, 2, 3, 3, and 1 CCs in instability-high (MSI-H) cases (1.1-3.2% of MSI-H CCs), respectively, but not microsatellite stable (MSS) cases. One CC showed regional heterogeneous mutations (RHM) of ESRP1 mutation. Immunohistochemistry identified protein expression of ESRP1, MTSS1, and ADAMTS1 in the CCs, revealing that approximately 30% of CCs lost the protein expression irrespective of the MSI status. Our study showed that dual TSG and proto-oncogene genes DYRK1B, ESRP1, MTSS1, ADAMTS1, and INPP5F harbored low incidences of inactivating mutations, but that the protein losses were frequent in CCs. Our study suggests a possibility that the dual-function genes could be altered mainly at the expression level, which might contribute to CC pathogenesis., Competing Interests: Declaration of Competing Interest There is no conflict of interest for the authors., (Copyright © 2023 Elsevier GmbH. All rights reserved.)

Chromosomal rearrangements involving the MDS1 and EVI1 complex locus (MECOM) on chromosome 3q26 define an aggressive subtype of acute myeloid leukemia (AML) that is associated with chemotherapy resistance and dismal prognosis. Established treatment regimens commonly fail in these patients, therefore, there is an urgent need for new therapeutic concepts that will require a better understanding of the molecular and cellular functions of the ecotropic viral integration site 1 (EVI1) oncogene. To characterize gene regulatory functions of EVI1 and associated dependencies in AML, we developed experimentally tractable human and murine disease models, investigated the transcriptional consequences of EVI1 withdrawal in vitro and in vivo, and performed the first genome-wide CRISPR screens in EVI1-dependent AML. By integrating conserved transcriptional targets with genetic dependency data, we identified and characterized the ETS transcription factor ERG as a direct transcriptional target of EVI1 that is aberrantly expressed and selectively required in both human and murine EVI1-driven AML. EVI1 controls the expression of ERG and occupies a conserved intragenic enhancer region in AML cell lines and samples from patients with primary AML. Suppression of ERG induces terminal differentiation of EVI1-driven AML cells, whereas ectopic expression of ERG abrogates their dependence on EVI1, indicating that the major oncogenic functions of EVI1 are mediated through aberrant transcriptional activation of ERG. Interfering with this regulatory axis may provide entry points for the development of rational targeted therapies., (© 2023 by The American Society of Hematology.)

In acute myeloid leukemia (AML), EVI1 rearrangement represented by inv(3)(q21q26) or t(3;3)(q21;q26) causes EVI1 overexpression via structural rearrangement of an enhancer, and confers poor prognosis. My colleagues and I performed a mutational analysis of EVI1-rearranged myeloid neoplasms and identified SF3B1, a core RNA splicing factor, as the most commonly co-mutated gene. Indeed, latent leukemia development in transgenic mice bearing the humanized inv(3)(q21q26) allele was significantly accelerated by co-occurrence of Sf3b1 mutation. Intriguingly, we found that this SF3B1 mutant induced mis-splicing of EVI1 itself, which generated an aberrant EVI1 isoform with in-frame insertion of 6 amino acids near the DNA-binding domain of EVI1. This aberrant EVI1 isoform exhibited DNA-binding activity different from wild-type EVI1 and significantly enhanced the self-renewal capacity of murine hematopoietic stem cells. We also identified the cryptic branch point and exonic splicing enhancer required for this EVI1 mis-splicing induced by the SF3B1 mutant. These data provide a basis for further elucidation of the molecular mechanism and potential therapeutic candidates for EVI1-rearranged AML.

Neoplasms originating from thymic T-cell progenitors and post-thymic mature T-cell subsets account for a minority of lymphoproliferative neoplasms. These T-cell derived neoplasms, while molecularly and genetically heterogeneous, exploit transcription factors and signaling pathways that are critically important in normal T-cell biology, including those implicated in antigen-, costimulatory-, and cytokine-receptor signaling. The transcription factor GATA-3 regulates the growth and proliferation of both immature and mature T cells and has recently been implicated in T-cell neoplasms, including the most common mature T-cell lymphoma observed in much of the Western world. Here we show that GATA-3 is a proto-oncogene across the spectrum of T-cell neoplasms, including those derived from T-cell progenitors and their mature progeny, and further define the transcriptional programs that are GATA-3 dependent, which include therapeutically targetable gene products. The discovery that p300-dependent acetylation regulates GATA-3 mediated transcription by attenuating DNA binding has novel therapeutic implications. As most patients afflicted with GATA-3 driven T-cell neoplasms will succumb to their disease within a few years of diagnosis, these findings suggest opportunities to improve outcomes for these patients., (© 2022. The Author(s).)

Detailed genomic and epigenomic analyses of MECOM (the MDS1 and EVI1 complex locus) have revealed that inversion or translocation of chromosome 3 drives inv(3)/t(3;3) myeloid leukemias via structural rearrangement of an enhancer that upregulates transcription of EVI1. Here, we identify a novel, previously unannotated oncogenic RNA-splicing derived isoform of EVI1 that is frequently present in inv(3)/t(3;3) acute myeloid leukemia (AML) and directly contributes to leukemic transformation. This EVI1 isoform is generated by oncogenic mutations in the core RNA splicing factor SF3B1, which is mutated in >30% of inv(3)/t(3;3) myeloid neoplasm patients and thereby represents the single most commonly cooccurring genomic alteration in inv(3)/t(3;3) patients. SF3B1 mutations are statistically uniquely enriched in inv(3)/t(3;3) myeloid neoplasm patients and patient-derived cell lines compared with other forms of AML and promote mis-splicing of EVI1 generating an in-frame insertion of 6 amino acids at the 3' end of the second zinc finger domain of EVI1. Expression of this EVI1 splice variant enhanced the self-renewal of hematopoietic stem cells, and introduction of mutant SF3B1 in mice bearing the humanized inv(3)(q21q26) allele resulted in generation of this novel EVI1 isoform in mice and hastened leukemogenesis in vivo. The mutant SF3B1 spliceosome depends upon an exonic splicing enhancer within EVI1 exon 13 to promote usage of a cryptic branch point and aberrant 3' splice site within intron 12 resulting in the generation of this isoform. These data provide a mechanistic basis for the frequent cooccurrence of SF3B1 mutations as well as new insights into the pathogenesis of myeloid leukemias harboring inv(3)/t(3;3)., (© 2022 by The American Society of Hematology.)

Genomic rearrangements are known to result in proto-oncogene deregulation in many cancers, but the link to 3D genome structure remains poorly understood. Here, we used the highly predictive heteromorphic polymer (HiP-HoP) model to predict chromatin conformations at the proto-oncogene CCND1 in healthy and malignant B cells. After confirming that the model gives good predictions of Hi-C data for the nonmalignant human B cell-derived cell line GM12878, we generated predictions for two cancer cell lines, U266 and Z-138. These possess genome rearrangements involving CCND1 and the immunoglobulin heavy locus ( IGH ), which we mapped using targeted genome sequencing. Our simulations showed that a rearrangement in U266 cells where a single IGH super-enhancer is inserted next to CCND1 leaves the local topologically associated domain (TAD) structure intact. We also observed extensive changes in enhancer-promoter interactions within the TAD, suggesting that it is the downstream chromatin remodeling which gives rise to the oncogene activation, rather than the presence of the inserted super-enhancer DNA sequence per se. Simulations of the IGH - CCND1 reciprocal translocation in Z-138 cells revealed that an oncogenic fusion TAD is created, encompassing CCND1 and the IGH super-enhancers. We predicted how the structure and expression of CCND1 changes in these different cell lines, validating this using qPCR and fluorescence in situ hybridization microscopy. Our work demonstrates the power of polymer simulations to predict differences in chromatin interactions and gene expression for different translocation breakpoints., (© 2022 Rico et al.; Published by Cold Spring Harbor Laboratory Press.)

The ETS-related gene ( ERG ) is proto-oncogene that is classified as a member of the ETS transcription factor family, which has been found to be consistently overexpressed in about half of the patients with clinically significant prostate cancer (PCa). The overexpression of ERG can mostly be attributed to the fusion of the ERG and transmembrane serine protease 2 ( TMPRSS2 ) genes, and this fusion is estimated to represent about 85% of all gene fusions observed in prostate cancer. Clinically, individuals with ERG gene fusion are mostly documented to have advanced tumor stages, increased mortality, and higher rates of metastasis in non-surgical cohorts. In the current review, we elucidate ERG's molecular interaction with downstream genes and the pathways associated with PCa. Studies have documented that ERG plays a central role in PCa progression due to its ability to enhance tumor growth by promoting inflammatory and angiogenic responses. ERG has also been implicated in the epithelial-mesenchymal transition (EMT) in PCa cells, which increases the ability of cancer cells to metastasize. In vivo, research has demonstrated that higher levels of ERG expression are involved with nuclear pleomorphism that prompts hyperplasia and the loss of cell polarity.

Background: Targeted therapy in adenocarcinoma is recommended. The use of immune check point inhibitors for the treatment of Non-small cell lung carcinoma (NSCLC) is used as both first-line and the second-line treatment strategy. The current study was undertaken to assess the frequency of programmed cell death ligand-1 (PD-L1) expression with anaplastic lymphoma kinase (ALK), proto-oncogene 1, receptor tyrosine kinase (ROS), epidermal growth factor receptor (EGFR), Kirsten rat sarcoma (KRAS), and v-Raf murine sarcoma viral oncogene homolog B (BRAF)V600E driver gene mutations in NSCLC adenocarcinoma phenotype. It assesses the frequencies of all markers in the cases where both treatment strategies can be implemented. Expression of the all markers was further compared with demographic, clinical parameters, and overall survival rate., Materials and Methods: The formalin-fixed paraffin-embedded (FFPE) tissue blocks were used in immunohistochemistry (IHC) staining and real-time polymerase chain reaction (RT-PCR) for determining the driver genes and PD-L1 expression in the 100 NSCLC-Adenocarcinoma cases., Results: PD-L1 positivity was observed in 26.36% (n=29/110) cases in adenocarcinoma. No significant differences in PD-L1 expression were observed among patients harboring ALK, ROS1, EGFR, KRAS, and BRAF mutations EGFR mutations had significant association with smoking status. (p= 0.008), Thyroid transcription factor 1 (TTF1) (p=0.0005) and Napsin (p=0.002) expression. ALK gene re-arrangement was significantly related to age (p= 0.001), gender (p= 0.009) and smoking status (p= 0.043). The single versus multiple driver mutations were significantly correlated with smoking status (p=0.005). In the survival rate analysis, EGFR (p=0.058), KRAS (p=0.021), and PD-L1 (p=0.039) were significantly high with the positive versus negative group., Conclusions: The current study is a novel attempt to document the co-expression of multiple driver mutations in the NSCLC-adenocarcinoma phenotype. PD-L1 immunopositivity in NSCLC-adenocarcinoma was higher with EGFR mutation as compared to those of KRAS, ALK, ROS, and BRAF driver genes.

Chromosomal rearrangements are a frequent cause of oncogene deregulation in human malignancies. Overexpression of EVI1 is found in a subgroup of acute myeloid leukemia (AML) with 3q26 chromosomal rearrangements, which is often therapy resistant. In AMLs harboring a t(3;8)(q26;q24), we observed the translocation of a MYC super-enhancer (MYC SE) to the EVI1 locus. We generated an in vitro model mimicking a patient-based t(3;8)(q26;q24) using CRISPR-Cas9 technology and demonstrated hyperactivation of EVI1 by the hijacked MYC SE. This MYC SE contains multiple enhancer modules, of which only one recruits transcription factors active in early hematopoiesis. This enhancer module is critical for EVI1 overexpression as well as enhancer-promoter interaction. Multiple CTCF binding regions in the MYC SE facilitate this enhancer-promoter interaction, which also involves a CTCF binding site upstream of the EVI1 promoter. We hypothesize that this CTCF site acts as an enhancer-docking site in t(3;8) AML. Genomic analyses of other 3q26-rearranged AML patient cells point to a common mechanism by which EVI1 uses this docking site to hijack enhancers active in early hematopoiesis., (© 2021. The Author(s).)

Background: The proliferative stage (tachyzoite) of Toxoplasma gondii (T. gondii) is critical for its transmission and pathogenesis, and a proto-oncogene eukaryotic translation initiation factor (eIF-5A) plays an important role in various cellular processes such as cell multiplication., Methods: We performed a proteomic study to evaluate the specific roles of eIF-5A involved in invasion and replication of T. gondii, and both in vivo and in vitro trials using eIF-5A-interfered and wild tachyzoites were performed to verify the proteomic results., Results: The results of our study showed that T. gondii eIF-5A affected tachyzoite growth and also participated in the synthesis of proteins through regulation of both ribosomal and splicing pathways. Inhibition of eIF-5A in T. gondii resulted in the downregulated expression of soluble adhesions, such as microneme protein 1 (MIC1) and MIC4, which in turn decreased the parasite population that adhered to the surface of host cells. The reduced attachment, combined with lower expression of some rhoptry proteins (ROPs) and dense granule antigens (GRAs) involved in different stages of T. gondii invasion such as ROP4 and GRA3, ultimately reduce the invasion efficiency. These processes regulated by eIF-5A eventually affect the replication of tachyzoites., Conclusions: Our findings showed that eIF-5A influenced tachyzoite survival and was also involved in the process of parasite invasion and replication. These results will provide new clues for further development of targeted drugs to control T. gondii infection.

The recent approvals by the Food and Drug Administration several tumor-agnostic drugs have resulted in a paradigm shift in cancer treatment from an organ/histology-specific strategy to biomarker-guided approaches. RET gene fusions are oncogenic drivers in multiple tumor types and are known to occur in 1-2% of non-squamous NSCLC patients. RET gene fusions give rise to chimeric, cytosolic proteins with constitutively active RET kinase domain. Standard therapeutic regimens provide limited benefit for NSCLC patients with RET fusion-positive tumors, and the outcomes with immunotherapy in the these patients are generally poor. Selpercatinib (LOXO-292) and pralsetinib (BLU-667) are potent and selective inhibitors that target RET alterations, including fusions and mutations, irrespective of the tissue of origin. Recently, the results from the LIBRETTO-001 and ARROW clinical trials demonstrated significant clinical benefits with selpercatinib and pralsetinib respectively, in NSCLC patients with RET gene fusions, with tolerable toxicity profiles. These studies also demonstrated that these RET-TKIs crossed the blood brain barrier with significant activity. As has been observed with other TKIs, the emergence of acquired resistance may limit long-term efficacy of these agents. Therefore, understanding the mechanisms of resistance is necessary for the development of strategies to overcome them.

Our mathematical model of integration site data in clinical gene therapy supported the existence of long-term lymphoid progenitors capable of surviving independently from hematopoietic stem cells. To date, no experimental setting has been available to validate this prediction. We here report evidence of a population of lymphoid progenitors capable of independently maintaining T and NK cell production for 15 years in humans. The gene therapy patients of this study lack vector-positive myeloid/B cells indicating absence of engineered stem cells but retain gene marking in both T and NK. Decades after treatment, we can still detect and analyse transduced naïve T cells whose production is likely maintained by a population of long-term lymphoid progenitors. By tracking insertional clonal markers overtime, we suggest that these progenitors can support both T and NK cell production. Identification of these long-term lymphoid progenitors could be utilised for the development of next generation gene- and cancer-immunotherapies.

Comparative genomic analyses have enormous potential for identifying key genes central to human health phenotypes, including those that promote cancers. In particular, the successful development of novel therapeutics using model species requires phylogenetic analyses to determine molecular homology. Accordingly, we investigate the evolutionary histories of anaplastic lymphoma kinase (ALK)-which can underlie tumorigenesis in neuroblastoma, nonsmall cell lung cancer, and anaplastic large-cell lymphoma-its close relative leukocyte tyrosine kinase (LTK) and their candidate ligands. Homology of ligands identified in model organisms to those functioning in humans remains unclear. Therefore, we searched for homologs of the human genes across metazoan genomes, finding that the candidate ligands Jeb and Hen-1 were restricted to nonvertebrate species. In contrast, the ligand augmentor (AUG) was only identified in vertebrates. We found two ALK-like and four AUG-like protein-coding genes in lamprey. Of these six genes, only one ALK-like and two AUG-like genes exhibited early embryonic expression that parallels model mammal systems. Two copies of AUG are present in nearly all jawed vertebrates. Our phylogenetic analysis strongly supports the presence of previously unrecognized functional convergences of ALK and LTK between actinopterygians and sarcopterygians-despite contemporaneous, highly conserved synteny of ALK and LTK. These findings provide critical guidance regarding the propriety of fish and mammal models with regard to model organism-based investigation of these medically important genes. In sum, our results provide the phylogenetic context necessary for effective investigations of the functional roles and biology of these critically important receptors., (© The Author(s) 2020. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.)

Background and Aims: The pattern of genetic alterations in cancer driver genes in patients with hepatocellular carcinoma (HCC) is highly diverse, which partially explains the low efficacy of available therapies. In spite of this, the existing mouse models only recapitulate a small portion of HCC inter-tumor heterogeneity, limiting the understanding of the disease and the nomination of personalized therapies. Here, we aimed at establishing a novel collection of HCC mouse models that captured human HCC diversity., Methods: By performing hydrodynamic tail-vein injections, we tested the impact of altering a well-established HCC oncogene (either MYC or β-catenin) in combination with an additional alteration in one of eleven other genes frequently mutated in HCC. Of the 23 unique pairs of genetic alterations that we interrogated, 9 were able to induce HCC. The established HCC mouse models were characterized at histopathological, immune, and transcriptomic level to identify the unique features of each model. Murine HCC cell lines were generated from each tumor model, characterized transcriptionally, and used to identify specific therapies that were validated in vivo., Results: Cooperation between pairs of driver genes produced HCCs with diverse histopathology, immune microenvironments, transcriptomes, and drug responses. Interestingly, MYC expression levels strongly influenced β-catenin activity, indicating that inter-tumor heterogeneity emerges not only from specific combinations of genetic alterations but also from the acquisition of expression-dependent phenotypes., Conclusions: This novel collection of murine HCC models and corresponding cell lines establishes the role of driver genes in diverse contexts and enables mechanistic and translational studies., (Copyright © 2020 AGA Institute. Published by Elsevier Inc. All rights reserved.)

Objectives: Plasma free metanephrines are commonly used for diagnosis of pheochromocytoma and paraganglioma (PPGLs), but can also provide other information. This multicenter study prospectively examined whether tumor size, location, and mutations could be predicted by these metabolites., Methods: Predictions of tumor location, size, and mutation type, based on measurements of plasma normetanephrine, metanephrine, and methoxytyramine were made without knowledge of disease in 267 patients subsequently determined to have PPGLs., Results: Predictions of adrenal vs. extra-adrenal locations according to increased plasma concentrations of metanephrine and methoxytyramine were correct in 93 and 97% of the respective 136 and 33 patients in who these predictions were possible. Predicted mean tumor diameters correlated positively (p<0.0001) with measured diameters; predictions agreed well for pheochromocytomas but were overestimated for paragangliomas. Considering only patients with mutations, 51 of the 54 (94%) patients with NF1 or RET mutations were correctly predicted with those mutations according to increased plasma metanephrine, whereas no or minimal increase in metanephrine correctly predicted all 71 patients with either VHL or SDHx mutations; furthermore, among the latter group increases in methoxytyramine correctly predicted SDHx mutations in 93% of the 29 cases for this specific prediction., Conclusions: Extents and patterns of increased plasma O-methylated catecholamine metabolites among patients with PPGLs allow predictions of tumor size, adrenal vs. extra-adrenal locations and general types of mutations. Predictions of tumor location are, however, only possible for patients with clearly increased plasma methoxytyramine or metanephrine. Where possible or clinically relevant the predictions are potentially useful for subsequent clinical decision-making.

Metabolic reprogramming of leukemia cells is important for survival, proliferation, and drug resistance under conditions of metabolic stress in the bone marrow. Deregulation of cellular metabolism, leading to development of leukemia, occurs through abnormally high expression of transcription factors such as MYC and Ecotropic Virus Integration site 1 protein homolog (EVI1). Overexpression of EVI1 in adults and children with mixed lineage leukemia-rearrangement acute myeloid leukemia (MLL-r AML) has a very poor prognosis. To identify a metabolic inhibitor for EVI1-induced metabolic reprogramming in MLL-r AML, we used an XFp extracellular flux analyzer to examine metabolic changes during leukemia development in mouse models of AML expressing MLL-AF9 and Evi1 (Evi1/MF9). Oxidative phosphorylation (OXPHOS) in Evi1/MF9 AML cells accelerated prior to activation of glycolysis, with a higher dependency on glutamine as an energy source. Furthermore, EVI1 played a role in glycolysis as well as driving production of metabolites in the tricarboxylic acid cycle. L-asparaginase (L-asp) exacerbated growth inhibition induced by glutamine starvation and suppressed OXPHOS and proliferation of Evi1/MF9 both in vitro and in vivo ; high sensitivity to L-asp was caused by low expression of asparagine synthetase (ASNS) and L-asp-induced suppression of glutamine metabolism. In addition, samples from patients with EVI1 + MF9 showed low ASNS expression, suggesting that it is a sensitive marker of L-asp treatment. Clarification of metabolic reprogramming in EVI1 + leukemia cells may aid development of treatments for EVI1 + MF9 refractory leukemia., (Copyright© 2020 Ferrata Storti Foundation.)

Deregulation of cytokine signaling is frequently associated with various pathological conditions, including malignancies. In patients with myeloproliferative neoplasms (MPNs), recurrent somatic mutations in the calreticulin (CALR) gene, which encodes a molecular chaperone that resides in the endoplasmic reticulum, have been reported. Studies have defined mutant CALR as an oncogene promoting the development of MPN, and deciphered a novel molecular mechanism by which mutant CALR constitutively activates thrombopoietin receptor MPL and its downstream molecules to induce cellular transformation. The mechanism of interaction and activation of MPL by mutant CALR is unique, not only due to the latter forming a homomultimeric complex through a novel mutant-specific sequence generated by frameshift mutation, but also for its ability to interact with immature asparagine-linked glycan for eventual engagement with immature MPL in the endoplasmic reticulum. The complex formed between mutant CALR and MPL is then transported to the cell surface, where it induces constitutive activation of downstream kinase JAK2 bound to MPL. Refined structural and cell biological studies can provide an in-depth understanding of this unusual mechanism of receptor activation by a mutant molecular chaperone. Mutant CALR is also involved in modulation of the immune response, transcription, and intracellular homeostasis, which could contribute to the development of MPN. In the present article, we comprehensively review the current understanding of the underlying molecular mechanisms for mutant molecular chaperone-induced cellular transformation., (© 2020 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.)

Zbtb7a is a transcription factor whose dysfunction is correlated to the development of several types of cancer, including hepatocellular carcinoma (HCC). It generally acts as a repressor of transcription downregulating the expression of several target genes including oncosuppressors ARF and Rb. In this study, Zbtb7a was found to suppress the expression of miR-125a, an oncosuppressive miRNA that is often downregulated in HCC. This effect is mediated by the binding of the transcription factor to a regulatory sequence in the promoter of the transcription unit of miR-125a located 14 bp upstream of the transcription start site. Consistent with this observation, the analysis of 370 HCC samples showed an upregulation of Zbtb7a compared to 50 normal liver tissues and a reverse correlation with miR-125a expression. These data suggest that miR-125a may support the oncogenic potential of Zbtb7a.

Smoking is indisputably linked to lung cancer, yet only a small fraction of smokers develops this disease. Although previously tobacco-derived carcinogens and enzyme polymorphisms have been identified to increase the risk for smokers, recent epidemiological data suggest even sex-specificity as a new and additional factor. Obviously, women have a higher risk to develop lung cancer upon smoking than men. Overall, the odds ratio to develop lung cancer was almost three times greater for women than for men, DNA adduct levels were higher among females than in males and mutations in the tumor suppressor gene p53 and the proto-oncogene K-RAS were more frequently found in women than in men. A growing number of studies suggest that the interaction between tobacco carcinogens and endogenous and exogenous sex steroids may be important. Women taking hormone replacement therapy (HRT) or oral contraceptives experienced to have an increased lung cancer incidence. Epidemiologic data on HRT show a significant association between both a younger median age at lung cancer diagnosis and a shorter median survival time. Another clue is the significantly higher number of lung cancer diagnosed women who are largely premenopausal in comparison to diagnosed men in the same age or women with shorter menstrual cycles. Finally, the Coronary Drug Project (men who received estrogen preparations to reduce future cardiac events) was stopped when increased lung cancer mortality was observed in the estrogen therapy group. The present review provides a short overview and discussion on lung cancer risk and the impact thereon of sex., (© 2019 UICC.)

Cell invasion allows cells to migrate across compartment boundaries formed by basement membranes. Aberrant cell invasion is a first step during the formation of metastases by malignant cancer cells. Anchor cell (AC) invasion in C. elegans is an excellent in vivo model to study the regulation of cell invasion during development. Here, we have examined the function of egl-43, the homolog of the human Evi1 proto-oncogene (also called MECOM), in the invading AC. egl-43 plays a dual role in this process, firstly by imposing a G1 cell cycle arrest to prevent AC proliferation, and secondly, by activating pro-invasive gene expression. We have identified the AP-1 transcription factor fos-1 and the Notch homolog lin-12 as critical egl-43 targets. A positive feedback loop between fos-1 and egl-43 induces pro-invasive gene expression in the AC, while repression of lin-12 Notch expression by egl-43 ensures the G1 cell cycle arrest necessary for invasion. Reducing lin-12 levels in egl-43 depleted animals restored the G1 arrest, while hyperactivation of lin-12 signaling in the differentiated AC was sufficient to induce proliferation. Taken together, our data have identified egl-43 Evi1 as an important factor coordinating cell invasion with cell cycle arrest., Competing Interests: The authors have declared that no competing interests exist.

Backgrounds and Aims: Microsatellite instability (MSI) is one of the promising biomarkers in human colorectal cancers (CRCs), and it is influenced by an intricate gene interaction network. Hence, we aimed to identify and validate hub genes associated with MSI CRC and to illustrate its underlying mechanisms., Methods: Weighted gene co-expression network analysis (WGCNA) was used to investigate potential regulatory targets and relationships between key modules and hub genes associated with MSI CRC., Results: In the red module (r = 0.83), SET nuclear proto-oncogene (SET) was selected due to its high intra-modular connectivity and module membership. In the test sets, SET expression was downregulated in MSI CRCs compared to that in microsatellite stability (MSS) CRCs. SET expression level had a good performance in stratifying patients into MSI or MSS CRCs (area under the curve = 0.953). Moreover, the BRAF V600E mutation was highly associated with SET expression, and MSI/HLA- samples showed lower levels of SET mRNA expression than MSS/HLA- samples. Finally, gene set enrichment analysis (GSEA) indicated that patients in the SET low expression group were enriched in base excision repair., Conclusion: SET was identified and validated as a novel potential biomarker in MSI CRCs, and SET probably acts through regulating the base excision repair pathway., (Copyright © 2019 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.)

Primary hepatic tumors mainly include hepatocellular carcinoma (HCC), which is one of the most frequent causes of cancer-related deaths worldwide. Thus far, HCC prognosis has remained extremely poor given the lack of effective treatments. Numerous studies have described the roles played by microRNAs (miRNAs) in cancer progression and the potential of these small noncoding RNAs for diagnostic or therapeutic applications. The current consensus supports the idea that direct repression of a wide range of oncogenes by a single key miRNA could critically affect the malignant properties of cancer cells in a synergistic manner. In this study, we aimed to investigate the oncogenes controlled by miR-493-5p, a major tumor suppressor miRNA that inactivates miR-483-3p oncomir in hepatic cancer cells. Using global gene expression analysis, we highlighted a set of candidate genes potentially regulated by miR-493-5p. In particular, the canonical MYCN protooncogene (MYCN) appeared to be an attractive target of miR-493-5p given its significant inhibition through 3'-UTR targeting in miR-493-5p-rescued HCC cells. We showed that MYCN was overexpressed in liver cancer cell lines and clinical samples from HCC patients. Notably, MYCN expression levels were inversely correlated with miR-493-5p in tumor tissues. We confirmed that MYCN knockdown mimicked the anticancer effect of miR-493-5p by inhibiting HCC cell growth and invasion, whereas MYCN rescue hindered miR-493-5p activity. In summary, miR-493-5p is a pivotal miRNA that modulates various oncogenes after its reexpression in liver cancer cells, suggesting that tumor suppressor miRNAs with a large spectrum of action could provide valuable tools for miRNA replacement therapies., (© 2019 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.)

Since its emergence, the application of CRISPR-associated nuclease 9 (Cas9) technology in cancer research has accelerated studies to investigate many aspects of treatment approaches for lung cancer, including the identification of target genes, construction of animal tumor models, and identification of drug resistance-related genes. Moreover, CRISPR/Cas9 can be used in gene therapy for lung cancer, specifically involving molecular targeted drugs and inhibitors. This article reviews the current landscape of CRISPR/Cas9 applications for lung cancer treatment as a basis for further studies. Given its promising performance, in-depth and systematic research on the application of CRISPR/Cas9 in lung cancer treatment will be necessary in future studies for its successful implementation in clinical practice., (Copyright © 2019 Elsevier Ltd. All rights reserved.)

Atypical protein kinase C (aPKC) isozymes, PKCλ/ι and PKCζ, are now considered fundamental regulators of tumorigenesis. However, the specific separation of functions that determine their different roles in cancer is still being unraveled. Both aPKCs have pleiotropic context-dependent functions that can translate into tumor-promoter or -suppressive functions. Here, we review early and more recent literature to discuss how the different tumor types, and their microenvironments, might account for the selective signaling of each aPKC isotype. This is of clinical relevance because a better understanding of the roles of these kinases is essential for the design of new anti-cancer treatments., (Copyright © 2019 Elsevier Inc. All rights reserved.)

Cancer is a disease of aging fueled by the accumulation of somatic mutations. While mutations in tumors are well characterized, little is known about the early mutational processes that initiate tumorigenesis. Recent advances in next-generation sequencing (NGS) have enabled the detection of mutations in normal tissue, revealing an unanticipated high level of age-related somatic mutations affecting most individuals and tissues. Surprisingly, many of these mutations are similar to mutations commonly found in tumors, suggesting an ongoing process of positive selection and clonal expansion akin to what occurs in cancer, but within normal tissue. Here we discuss some of the most important biological and clinical implications of these novel findings, with a special focus on their impact for cancer detection and prediction., (Copyright © 2019 Elsevier Inc. All rights reserved.)

circRNAs arise from back splicing events during mRNA processing, and when deregulated can play an active role in cancer. Here we characterize a new circRNA (circPOK) encoded by the Zbtb7a gene (also kown as POKEMON, LRF) in the context of mesenchymal tumor progression. circPOK functions as a non-coding proto-oncogenic RNA independently and antithetically to its linear transcript counterpart, which acts as a tumor suppressor by encoding the Pokemon transcription factor. We find that circPOK regulates pro-proliferative and pro-angiogenic factors by co-activation of the ILF2/3 complex. Importantly, the expression of Pokemon protein and circRNA is aberrantly uncoupled in cancer through differential post-transcriptional regulation. Thus, we identify a novel type of genetic unit, the iRegulon, that yields biochemically distinct RNA products, circular and linear, with diverse and antithetical functions. Our findings further expand the cellular repertoire towards the control of normal biological outputs, while aberrant expression of such components may underlie disease pathogenesis including cancer.

Mutations occur spontaneously, which can be induced by either chemicals (e.g. benzene) or biological factors (e.g. virus). Not all mutations cause noticeable changes in cellular functions. However, mutation in key cellular genes leads to developmental disorders. It is one of the main ways in which proto-oncogenes can be changed into their oncogenic state. The progressive accumulation of multiple mutations throughout life leads to cancer. In the past few decades, extensive research on cancer biology has discovered many genes and pathways having role in cancer development. In this review, we tried to summarize the current knowledge of mutational effect on different cancer types and its consequences in brief for future reference and guidance of researchers in cancer biology., (Copyright © 2019 Elsevier B.V. All rights reserved.)

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

Objective: To verify the physiological action of triiodothyronine T3 on the expression of transforming growth factor α (TGFA) mRNA in MCF7 cells by inhibition of RNA Polymerase II and the MAPK/ERK pathway., Materials and Methods: The cell line was treated with T3 at a physiological dose (10-9M) for 10 minutes, 1 and 4 hour (h) in the presence or absence of the inhibitors, α-amanitin (RNA polymerase II inhibitor) and PD98059 (MAPK/ERK pathway inhibitor). TGFA mRNA expression was analyzed by RT-PCR. For data analysis, we used ANOVA, complemented with the Tukey test and Student t-test, with a minimum significance of 5%., Results: T3 increases the expression of TGFA mRNA in MCF7 cells in 4 h of treatment. Inhibition of RNA polymerase II modulates the effect of T3 treatment on the expression of TGFA in MCF7 cells. Activation of the MAPK/ERK pathway is not required for T3 to affect the expression of TGFA mRNA., Conclusion: Treatment with a physiological concentration of T3 after RNA polymerase II inhibition altered the expression of TGFA. Inhibition of the MAPK/ERK pathway after T3 treatment does not interfere with the TGFA gene expression in a breast adenocarcinoma cell line.

The development of next generation sequencing (NGS) has led to marked advancement of our understanding of genetic events mediating the initiation and progression of thyroid cancers. The NGS studies have confirmed the previously reported high frequency of mutually-exclusive oncogenic alterations affecting BRAF and RAS proto-oncogenes in all stages of thyroid cancer. Initially identified by traditional sequencing approaches, the NGS studies also confirmed the acquisition of alterations that inactivate tumor protein p53 ( TP53 ) and activate phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha ( PIK3CA ) in advanced thyroid cancers. Novel alterations, such as those in telomerase reverse transcriptase ( TERT ) promoter and mating-type switching/sucrose non-fermenting (SWI/SNF) complex, are also likely to promote progression of the BRAF V600E -driven thyroid cancers. A number of genetically engineered mouse models (GEMM) of BRAF V600E -driven thyroid cancer have been developed to investigate thyroid tumorigenesis mediated by oncogenic BRAF and to explore the role of genetic alterations identified in the genomic analyses of advanced thyroid cancer to promote tumor progression. This review will discuss the various GEMMs that have been developed to investigate oncogenic BRAF V600E -driven thyroid cancers., Competing Interests: No potential conflict of interest relevant to this article was reported., (Copyright © 2019 Korean Endocrine Society.)

The molecular chaperone Hsp90 is an essential and highly abundant central node in the interactome of eukaryotic cells. Many of its large number of client proteins are relevant to cancer. A hallmark of Hsp90-dependent proteins is that their accumulation is compromised by Hsp90 inhibitors. Combined with the anecdotal observation that cancer cells may be more sensitive to Hsp90 inhibitors, this has led to clinical trials aiming to develop Hsp90 inhibitors as anti-cancer agents. However, the sensitivity to Hsp90 inhibitors has not been studied in rigorously matched normal versus cancer cells, and despite the discovery of important regulators of Hsp90 activity and inhibitor sensitivity, it has remained unclear, why cancer cells might be more sensitive. To revisit this issue more systematically, we have generated an isogenic pair of normal and oncogenically transformed NIH-3T3 cell lines. Our proteomic analysis of the impact of three chemically different Hsp90 inhibitors shows that these affect a substantial portion of the oncogenic program and that indeed, transformed cells are hypersensitive. Targeting the oncogenic signaling pathway reverses the hypersensitivity, and so do inhibitors of DNA replication, cell growth, translation and energy metabolism. Conversely, stimulating normal cells with growth factors or challenging their proteostasis by overexpressing an aggregation-prone sensitizes them to Hsp90 inhibitors. Thus, the differential sensitivity to Hsp90 inhibitors may not stem from any particular intrinsic difference between normal and cancer cells, but rather from a shift in the balance between cellular quiescence and activity., Competing Interests: The authors have declared that no competing interests exist.

Background: The eukaryotic unicellular protist Plasmodiophora brassicae is an endocellular parasite of cruciferous plants. In host cortical cells, this protist develops a unicellular structure that is termed the plasmodium. The plasmodium is actually a multinucleated cell, which subsequently splits and forms resting spores. The mechanism for the growth of this endocellular parasite in host cell is unclear., Results: Here, combining de novo genome sequence and transcriptome analysis of strain ZJ-1, we identified top five significant enriched KEGG pathways of differentially expressed genes (DEGs), namely translation, cell growth and death, cell communication, cell motility and cancers. We detected 171 proto-oncogenes from the genome of P. brassicae that were implicated in cancer-related pathways, of which 46 were differential expression genes. Three predicted proto-oncogenes (Pb-Raf1, Pb-Raf2, and Pb-MYB), which showed homology to the human proto-oncogenes Raf and MYB, were specifically activated during the plasmodial growth in host cortical cells, demonstrating their involvement in the multinucleate development stage of the unicellular protist organism. Gene networks involved in the tumorigenic-related signaling transduction pathways and the activation of 12 core genes were identified. Inhibition of phosphoinositol-3-kinase relieved the clubroot symptom and significantly suppressed the development process of plasmodia., Conclusions: Proto-oncogene-related regulatory mechanisms play an important role in the plasmodial growth of P. brassicae.

Krüppel-like factor 4 (KLF4) is an important transcription factor that is expressed in a variety of tissues and regulates many critical physiologic and cellular processes, including cell proliferation, differentiation, stem cell reprogramming, maintenance of genomic stability, and normal tissue homeostasis. KLF4 has both tumor suppressive and oncogenic functions in gastrointestinal and other cancers. These functions are thought to be context dependent, but how KLF4 exerts these differential functions and the molecular mechanisms behind them remain poorly understood. Recent studies have shown that the KLF4 gene undergoes alternative splicing, and the protein products of certain transcripts antagonize wild-type KLF4 function, suggesting an additional layer of regulation of KLF4 function. Therefore, detailed study of KLF4 alternative splicing may not only provide new insights into the complexity of KLF4 functions but also lead to rational targeting of KLF4 for cancer prevention and therapy., (Published by Elsevier B.V.)

Background: Pericardial and pleural cavities produce effusions with important clinical consequences. Metastases are one of the most common etiologies of both serosal effusions. However, data regarding the type of metastatic involvement of the pleura and the pericardium are lacking. This study investigated the histologic patterns of tumors involving the two cavities to better define their pathophysiology and possible consequences in molecular diagnostics., Methods: This was a retrospective study of patients diagnosed with pericardial (n = 75) and pleural (n = 70) metastases. Patterns of metastasis were characterized as (1) tumor cells floating inside the cavity (2) as lymphatic emboli and (3) as tumor cells frankly invading underlying fibrous tissue. Molecular analysis (EGFR, KRAS, BRAF, ALK, HER2) was performed in 44 metastases of lung adenocarcinomas., Results: The two serosal membranes differed significantly (p < 0.0001) in the pattern of metastasis. The pleura showed predominantly an invasive pattern (67 [95.7%]), whereas most pericardial metastases consisted of tumor cells floating inside the cavity or as lymphatic emboli (44 [58.6%]). The origin of the primary differed marginally between the two organs. Time to diagnosis of metastasis differed between the two organs, with pleural metastases presenting later than the pericardial ones. Molecular analysis failed more often in pericardial biopsy specimens and in specimens with emboli or surface involvement., Conclusions: Although pericardium and pleura share common embryologic and histologic features and are often regarded as giving similar effusions, they differ significantly in the type of metastases involving them. This can have important consequences in histologic, cytologic, and molecular diagnostics., (Copyright © 2018 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.)

Widespread mRNA 3' UTR shortening through alternative polyadenylation 1 promotes tumor growth in vivo 2 . A prevailing hypothesis is that it induces proto-oncogene expression in cis through escaping microRNA-mediated repression. Here we report a surprising enrichment of 3'UTR shortening among transcripts that are predicted to act as competing-endogenous RNAs (ceRNAs) for tumor-suppressor genes. Our model-based analysis of the trans effect of 3' UTR shortening (MAT3UTR) reveals a significant role in altering ceRNA expression. MAT3UTR predicts many trans-targets of 3' UTR shortening, including PTEN, a crucial tumor-suppressor gene 3 involved in ceRNA crosstalk 4 with nine 3'UTR-shortening genes, including EPS15 and NFIA. Knockdown of NUDT21, a master 3' UTR-shortening regulator 2 , represses tumor-suppressor genes such as PHF6 and LARP1 in trans in a miRNA-dependent manner. Together, the results of our analysis suggest a major role of 3' UTR shortening in repressing tumor-suppressor genes in trans by disrupting ceRNA crosstalk, rather than inducing proto-oncogenes in cis.

Exosomes are extracellular microvesicles released from cells, which are involved in many biological and pathological processes, mainly because of their role in intercellular communication. Exosomes derived from colorectal cancer (CRC) cells are related to oncogenesis, tumor cell survival, chemo-resistance, and metastasis. The role of the exosomes in these processes involves the transfer of proteins, RNAs, or mutant versions of proto-oncogenes to the target cells. In recent years, great efforts have been made to identify useful biomarkers in CRC exosomes for diagnosis, prediction of prognosis, and treatment response. This review focuses on recent studies on CRC exosomes, considering isolation, cargo, biomarkers, and the effects of exosomes on the development and progression of CRC, including resistance to antitumor therapy., (© 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.)

Cytology samples are increasingly used for comprehensive molecular testing. Although fine-needle aspirates are adequate substrates for high-throughput sequencing, the suitability of malignant body fluids remains largely unexplored. We investigated the adequacy and utility of performing targeted next-generation sequencing (NGS) on malignant effusions from patients with metastatic lung adenocarcinoma. Thirty-two effusion samples submitted for hybrid capture-based NGS using a clinically validated solid tumor genotyping panel were examined. All cases showed ≥5% tumor cellularity; however, 28 (88%) provided sufficient DNA for NGS (≥1 ng/μL). The sequencing reads showed satisfactory quality control statistics, and the variant allele frequencies were correlated with tumor cellularity. Furthermore, pathogenic or likely pathogenic genomic alterations were identified in 26 of 28 samples (93%), whereas clinically actionable alterations were present in 18 (64%). Notably, nine patients had additional molecular testing performed on preceding or subsequent biopsy specimens, and the results across multiple samples were compared. In two patients, the NGS-based fluid analysis identified clinically actionable alterations that were not detected by other hotspot testing. In four patients treated with tyrosine kinase inhibitors, malignant fluid sequencing confirmed driver alterations from prior testing and revealed new resistance mechanisms. Hence, given adequate DNA input and tumor cellularity, comprehensive genomic profiling of malignant effusions may be used to establish mutational status at diagnosis and inform treatment resistance during targeted therapy., (Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.)

Context: In 2013, an evidence-based guideline was published by the College of American Pathologists, the International Association for the Study of Lung Cancer, and the Association for Molecular Pathology to set standards for the molecular analysis of lung cancers to guide treatment decisions with targeted inhibitors. New evidence has prompted an evaluation of additional laboratory technologies, targetable genes, patient populations, and tumor types for testing., Objective: To systematically review and update the 2013 guideline to affirm its validity; to assess the evidence of new genetic discoveries, technologies, and therapies; and to issue an evidence-based update., Design: The College of American Pathologists, the International Association for the Study of Lung Cancer, and the Association for Molecular Pathology convened an expert panel to develop an evidence-based guideline to help define the key questions and literature search terms, review abstracts and full articles, and draft recommendations., Results: Eighteen new recommendations were drafted. The panel also updated 3 recommendations from the 2013 guideline., Conclusions: The 2013 guideline was largely reaffirmed with updated recommendations to allow testing of cytology samples, require improved assay sensitivity, and recommend against the use of immunohistochemistry for EGFR testing. Key new recommendations include ROS1 testing for all adenocarcinoma patients; the inclusion of additional genes (ERBB2, MET, BRAF, KRAS, and RET) for laboratories that perform next-generation sequencing panels; immunohistochemistry as an alternative to fluorescence in situ hybridization for ALK and/or ROS1 testing; use of 5% sensitivity assays for EGFR T790M mutations in patients with secondary resistance to EGFR inhibitors; and the use of cell-free DNA to "rule in" targetable mutations when tissue is limited or hard to obtain., (Copyright © 2018 College of American Pathologists, International Association for the Study of Lung Cancer, Association for Molecular Pathology, and American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.)

Gene therapy has been receiving widespread attention due to its unique advantage in regulating the expression of specific target genes. In the field of cancer gene therapy, modulation of gene expression has been shown to decrease oncogenic factors in cancer cells or increase immune responses against cancer. Due to the macromolecular size and highly negative physicochemical features of plasmid DNA, efficient delivery systems are an essential ingredient for successful gene therapy. To date, a variety of nanostructures and materials have been studied as nonviral gene delivery systems. In this review, we will cover nonviral delivery strategies for cancer gene therapy, with a focus on target cancer genes and delivery materials. Moreover, we will address current challenges and perspectives for nonviral delivery-based cancer gene therapeutics., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.)

Salamanders exhibit an extraordinary ability among vertebrates to regenerate complex body parts. However, scarce genomic resources have limited our understanding of regeneration in adult salamanders. Here, we present the ~20 Gb genome and transcriptome of the Iberian ribbed newt Pleurodeles waltl, a tractable species suitable for laboratory research. We find that embryonic stem cell-specific miRNAs mir-93b and mir-427/430/302, as well as Harbinger DNA transposons carrying the Myb-like proto-oncogene have expanded dramatically in the Pleurodeles waltl genome and are co-expressed during limb regeneration. Moreover, we find that a family of salamander methyltransferases is expressed specifically in adult appendages. Using CRISPR/Cas9 technology to perturb transcription factors, we demonstrate that, unlike the axolotl, Pax3 is present and necessary for development and that contrary to mammals, muscle regeneration is normal without functional Pax7 gene. Our data provide a foundation for comparative genomic studies that generate models for the uneven distribution of regenerative capacities among vertebrates.

Background: Colorectal cancer (CRC) develops through the alteration of several critical pathways. This study was aimed at evaluating the influence of critical pathways on survival outcomes for patients with CRC., Methods: Targeted next-generation sequencing of 40 genes included in the 5 critical pathways of CRC (WNT, P53, RTK-RAS, phosphatidylinositol-4,5-bisphosphate 3-kinase [PI3K], and transforming growth factor β [TGF-β]) was performed for 516 patients with stage III or high-risk stage II CRC treated with surgery followed by adjuvant fluoropyrimidine and oxaliplatin chemotherapy. The associations between critical pathway mutations and relapse-free survival (RFS) and overall survival were analyzed. The associations were further analyzed according to the tumor location., Results: The mutation rates for the WNT, P53, RTK-RAS, PI3K, and TGF-β pathways were 84.5%, 69.0%, 60.7%, 30.0%, and 28.9%, respectively. A mutation in the PI3K pathway was associated with longer RFS (adjusted hazard ratio [HR], 0.59; 95% confidence interval [CI], 0.36-0.99), whereas a mutation in the RTK-RAS pathway was associated with shorter RFS (adjusted HR, 1.60; 95% CI, 1.01-2.52). Proximal tumors showed a higher mutation rate than distal tumors, and the mutation profile was different according to the tumor location. The mutation rates of Kirsten rat sarcoma viral oncogene homolog (KRAS), phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit α (PIK3CA), and B-Raf proto-oncogene serine/threonine kinase (BRAF) were higher in proximal tumors, and the mutation rates of adenomatous polyposis coli (APC), tumor protein 53 (TP53), and neuroblastoma RAS viral oncogene homolog (NRAS) were higher in distal tumors. The better RFS with the PI3K pathway mutation was significant only for proximal tumors, and the worse RFS with the RTK-RAS pathway mutation was significant only for distal tumors., Conclusions: A PI3K pathway mutation was associated with better RFS for CRC patients treated with adjuvant chemotherapy, and an RTK-RAS pathway mutation was associated with worse RFS. The significance of the prognostic impact differed according to the tumor location. Cancer 2017;123:3513-23. © 2017 American Cancer Society., (© 2017 American Cancer Society.)

Chromosomal region 1p22 is deleted in ⩾20% of multiple myeloma (MM) patients, suggesting the presence of an unidentified tumor suppressor. Using high-resolution genomic profiling, we delimit a 58 kb minimal deleted region (MDR) on 1p22.1 encompassing two genes: ectopic viral integration site 5 (EVI5) and ribosomal protein L5 (RPL5). Low mRNA expression of EVI5 and RPL5 was associated with worse survival in diagnostic cases. Patients with 1p22 deletion had lower mRNA expression of EVI5 and RPL5, however, 1p22 deletion status is a bad predictor of RPL5 expression in some cases, suggesting that other mechanisms downregulate RPL5 expression. Interestingly, RPL5 but not EVI5 mRNA levels were significantly lower in relapsed patients responding to bortezomib and; both in newly diagnosed and relapsed patients, bortezomib treatment could overcome their bad prognosis by raising their progression-free survival to equal that of patients with high RPL5 expression. In conclusion, our genetic data restrict the MDR on 1p22 to EVI5 and RPL5 and although the role of these genes in promoting MM progression remains to be determined, we identify RPL5 mRNA expression as a biomarker for initial response to bortezomib in relapsed patients and subsequent survival benefit after long-term treatment in newly diagnosed and relapsed patients.

Solid pseudopapillary neoplasm (SPN) of the pancreas is a low-grade malignant neoplasm that accounts for ~5% of cystic pancreatic tumors and ~0.9‑2.7% of exocrine pancreatic tumors. The transcription profiling data (GSE43795) of 14 SPN and 6 control samples were downloaded from the Gene Expression Omnibus (GEO) database. Using the Limma package, Student's t‑tests were performed to identify differentially expressed genes (DEGs) between SPN and control samples [with the following criterion: False discovery rate (FDR)<0.01 and log2 fold‑change (FC)≥3]. Pathway and functional enrichment analyses were performed to investigate the biological processes that the DEGs were involved in. Protein‑protein interaction (PPI) network and sub‑network analyses were conducted to comprehensively understand the interactions between DEGs. The screened DEGs were further annotated according to information relating to transcription factors and tumor associated genes (TAGs). A total of 710 upregulated and 710 downregulated DEGs were observed, including 74 transcriptional factors and 124 TAGs. Membrane metallo‑endopeptidase (MME), matrix metalloproteinase (MMP)-2 and MMP‑9 were also identified as key TAGs. Following PPI network analysis, hub nodes of epidermal growth factor receptor (EGFR), proto‑oncogene tyrosine protein kinase Fyn (FYN), c‑JUN (JUN), glucagon (GCG), c‑Myc (MYC) and CD44 were identified, the majority of which participate in the epidermal growth factor receptor (ErbB) and gonadotropin-releasing hormone (GnRH) signaling pathways. A sub‑network involving 70 gene nodes was also identified, with EGFR as the central gene. MME, MMP‑2 and MMP‑9 contribute to proliferative diabetic retinopathy and also involved in SPN. The genes EGFR, FYN, JUN, GCG, MYC and CD44 may therefore be key genes in SPN, and the ErbB and GnRH signaling pathways may be an important contributor to SPN progression.

Neuroblastoma is a childhood cancer originating from embryonic neural crest cells. Amplification of the proto‑oncogene N-myc, seen in ~30% of neuroblastoma tumors, is a marker for poor prognosis. Recently discovered small regulatory RNAs, microRNAs (miRNAs), are implicated in cancers, including neuroblastoma. miRNAs downregulate the expression of genes by binding to the 3'-untranslated regions (3'-UTRs), thereby inhibiting translation or inducing degradation of cognate mRNAs. Our study sought to identify miRNAs that regulate N-myc expression and thereby malignancy in neuroblastoma. miRNAs whose expression negatively correlates with N-myc expression were identified from a miRNA microarray of 4 N-myc-amplified neuroblastoma cell lines. Three of these miRNAs (miR-17, miR-20a and miR-18a) belong to the miR-17-92 cluster, previously shown to be upregulated by N-myc. qPCR validation of these miRNAs in a larger panel of cell lines revealed that levels of miR-17 were inversely proportional to N-myc mRNA amounts in the N-myc-amplified cell lines. Notably, miR-17 also downregulated N-myc protein synthesis in the N-myc-amplified cells, thereby generating a negative feedback regulatory loop between the proto-oncogene and this miRNA. Moreover, the neuronal-specific RNA-binding protein HuD (ELAVL4), which regulates the processing/stability of N-myc mRNA, competes with miR-17 for a binding site in the 3'-UTR of N-myc. Thus, N-myc levels appear to be modulated by the antagonistic interactions of both miR-17, as a negative regulator, and HuD, as a positive regulator, providing further evidence of the complex cellular control mechanisms of this oncogene in N-myc-amplified neuroblastoma cells.

Transcriptional activation of the EVI1 oncogene (3q26) leads to aggressive forms of human acute myeloid leukemia (AML). However, the mechanism of EVI1-mediated leukemogenesis has not been fully elucidated. Previously, by characterizing the EVI1 promoter, we have shown that RUNX1 and ELK1 directly regulate EVI1 transcription. Intriguingly, bioinformatic analysis of the EVI1 promoter region identified the presence of several EVI1 potential binding sites. Thus, we hypothesized that EVI1 could bind to these sites regulating its own transcription. In this study, we show that there is a functional interaction between EVI1 and its promoter, and that the different EVI1 isoforms (EVI1-145kDa, EVI1-Δ324 and MDS1-EVI1) regulate the transcription of EVI1 transcripts through distinct promoter regions. Moreover, we determine that the EVI1-145kDa isoform activates EVI1 transcription, whereas EVI1-Δ324 and MDS1-EVI1 act as repressors. Finally, we demonstrate that these EVI1 isoforms are involved in cell transformation; functional experiments show that EVI1-145kDa prolongs the maintenance of hematopoietic stem and progenitor cells; conversely, MDS1-EVI1 repressed hematopoietic stem and progenitor colony replating capacity. We demonstrate for the first time that EVI1 acts as a regulator of its own expression, highlighting the complex regulation of EVI1, and open new directions to better understand the mechanisms of EVI1 overexpressing leukemias., (Copyright © 2017 Elsevier B.V. All rights reserved.)

Inhibitors of the mechanistic target of rapamycin (mTOR) are currently used to treat advanced metastatic breast cancer. However, whether an aggressive phenotype is sustained through adaptation or resistance to mTOR inhibition remains unknown. Here, complementary studies in human tumors, cancer models and cell lines reveal transcriptional reprogramming that supports metastasis in response to mTOR inhibition. This cancer feature is driven by EVI1 and SOX9. EVI1 functionally cooperates with and positively regulates SOX9, and promotes the transcriptional upregulation of key mTOR pathway components (REHB and RAPTOR) and of lung metastasis mediators (FSCN1 and SPARC). The expression of EVI1 and SOX9 is associated with stem cell-like and metastasis signatures, and their depletion impairs the metastatic potential of breast cancer cells. These results establish the mechanistic link between resistance to mTOR inhibition and cancer metastatic potential, thus enhancing our understanding of mTOR targeting failure.