Search

Huanglongbing (HLB) is a fatal citrus disease that is currently threatening citrus varieties worldwide. One putative causative agent, Candidatus Liberibacter asiaticus (CLas), is vectored by Diaphorina citri, known as the Asian citrus psyllid (ACP). Understanding the details of CLas infection in HLB disease has been hindered by its Candidatus nature and the inability to confidently detect it in diseased trees during the asymptomatic stage. To identify early changes in citrus metabolism in response to inoculation of CLas using its natural psyllid vector, leaves from Madam Vinous sweet orange (Citrus sinensis (L.) Osbeck) trees were exposed to CLas-positive ACP or CLas-negative ACP and longitudinally analyzed using transcriptomics (RNA sequencing), proteomics (liquid chromatography-tandem mass spectrometry; data available in Dryad: 10.25338/B83H1Z), and metabolomics (proton nuclear magnetic resonance). At 4 weeks postexposure (wpe) to psyllids, the initial HLB plant response was primarily to the ACP and, to a lesser extent, the presence or absence of CLas. Additionally, analysis of 4, 8, 12, and 16 wpe identified 17 genes and one protein as consistently differentially expressed between leaves exposed to CLas-positive ACP versus CLas-negative ACP. This study informs identification of early detection molecular targets and contributes to a broader understanding of vector-transmitted plant pathogen interactions.

Leaf litter microbes collectively degrade plant polysaccharides, influencing land-atmosphere carbon exchange. An open question is how substrate complexity-defined as the structure of the saccharide and the amount of external processing by extracellular enzymes-influences species interactions. We tested the hypothesis that monosaccharides (i.e. xylose) promote negative interactions through resource competition, and polysaccharides (i.e. xylan) promote neutral or positive interactions through resource partitioning or synergism among extracellular enzymes. We assembled a three-species community of leaf litter-degrading bacteria isolated from a grassland site in Southern California. In the polysaccharide xylan, pairs of species stably coexisted and grew equally in coculture and in monoculture. Conversely, in the monosaccharide xylose, competitive exclusion and negative interactions prevailed. These pairwise dynamics remained consistent in a three-species community: all three species coexisted in xylan, while only two species coexisted in xylose, with one species capable of using peptone. A mathematical model showed that in xylose these dynamics could be explained by resource competition. Instead, the model could not predict the coexistence patterns in xylan, suggesting other interactions exist during biopolymer degradation. Overall, our study shows that substrate complexity influences species interactions and patterns of coexistence in a synthetic microbial community of leaf litter degraders.

Background and aimsMany agricultural areas are expected to face hotter, drier conditions from climate change. Understanding the mechanisms that crops use to mitigate these stresses can guide breeding for more tolerant plant material. We tested relationships between traits, physiological function in hot conditions and historical climate associations to evaluate these mechanisms for winegrapes. We expected a more negative leaf osmotic potential at full hydration (πo), which reduces leaf turgor loss during drought, and either a metabolically cheaper or more osmoprotectant leaf chemical composition, to allow cultivars associated with hot, dry regions to maintain greater gas exchange in hot growing conditions.MethodsWe measured πo, gas exchange and leaf chemistry for seven commercially important winegrape cultivars that vary widely in historical climate associations. Vines were grown in common-garden field conditions in a hot wine-growing region (Davis, CA, USA) and measured over the hottest period of the growing season (July-September).Key resultsThe value of πo varied significantly between cultivars, and all cultivars significantly reduced πo (osmotically adjusted) over the study period, although osmotic adjustment did not vary across cultivars. The value of πo was correlated with gas exchange and climate associations, but in the direction opposite to expected. Photosynthesis and πo were higher in the cultivars associated with hotter, less humid regions. Leaf chemical composition varied between cultivars but was not related to climate associations.ConclusionsThese findings suggest that maintenance of leaf turgor is not a primary limitation on grapevine adaptation to hot or atmospherically dry growing conditions. Thus, selecting for a more negative πo or greater osmotic adjustment is not a promising strategy to develop more climate-resilient grape varieties, contrary to findings for other crops. Future work is needed to identify the mechanisms increasing photosynthesis in the cultivars associated with hot, dry regions.

Soil salinity is a major nutritional challenge with poor agriculture production characterized by high sodium (Na+) ions in the soil. Zinc oxide nanoparticles (ZnO NPs) and biochar have received attention as a sustainable strategy to reduce biotic and abiotic stress. However, there is a lack of information regarding the incorporation of ZnO NPs with biochar to ameliorate the salinity stress (0, 50,100 mM). Therefore, the current study aimed to investigate the potentials of ZnO NPs application (priming and foliar) alone and with a combination of biochar on the growth and nutrient availability of spinach plants under salinity stress. Results demonstrated that salinity stress at a higher rate (100 mM) showed maximum growth retardation by inducing oxidative stress, resulted in reduced photosynthetic rate and nutrient availability. ZnO NPs (priming and foliar) alone enhanced growth, chlorophyll contents and gas exchange parameters by improving the antioxidant enzymes activity of spinach under salinity stress. While, a significant and more pronounced effect was observed at combined treatments of ZnO NPs with biochar amendment. More importantly, ZnO NPs foliar application with biochar significantly reduced the Na+ contents in root 57.69%, and leaves 61.27% of spinach as compared to the respective control. Furthermore, higher nutrient contents were also found at the combined treatment of ZnO NPs foliar application with biochar. Overall, ZnO NPs combined application with biochar proved to be an efficient and sustainable strategy to alleviate salinity stress and improve crop nutritional quality under salinity stress. We inferred that ZnO NPs foliar application with a combination of biochar is more effectual in improving crop nutritional status and salinity mitigation than priming treatments with a combination of biochar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Many insects have evolved the ability to manipulate plant growth to generate extraordinary structures called galls, in which insect larva can develop while being sheltered and feeding on the plant. In particular, cynipid (Hymenoptera: Cynipidae) wasps have evolved to form morphologically complex galls and generate an astonishing array of gall shapes, colors, and sizes. However, the biochemical basis underlying these remarkable cellular and developmental transformations remains poorly understood. A key determinant in plant cellular development is cell wall deposition that dictates the physical form and physiological function of newly developing cells, tissues, and organs. However, it is unclear to what degree cell walls are restructured to initiate and support the formation of new gall tissue. Here, we characterize the molecular alterations underlying gall development using a combination of metabolomic, histological, and biochemical techniques to elucidate how valley oak (Quercus lobata) leaf cells are reprogrammed to form galls. Strikingly, gall development involves an exceptionally coordinated spatial deposition of lignin and xylan to form de novo gall vasculature. Our results highlight how cynipid wasps can radically change the metabolite profile and restructure the cell wall to enable the formation of galls, providing insights into the mechanism of gall induction and the extent to which plants can be entirely reprogrammed to form unique structures and organs.

Eucalyptus camaldulensis is a multifunctional tree and is globally used for the reclamation of problematic lands. Eucalyptus camaldulensis is prone to attack by a number of pathogens, but the most important threat is the Fusarium wilt (Fusarium oxysporum). Keeping in view the importance of E. camaldulensis and to manage this disease, five plant activators, i.e., salicylic acid (C7H6O3), benzoic acid (C7H6O2), citric acid (C6H8O7), dipotassium phosphate (K2HPO4), monopotassium phosphate (KH2PO4) and nutritional mixture namely Compound (NPK) and nutriotop (Fe, Zn, Cu, B, Mn) were evaluated in the Fusarium infested field under RCBD in the Research Area, Department of Forestry and Range Management, University of Agriculture, Faisalabad (UAF). Among plant activators, salicylic acid and a combination of compound + nutriotop exhibited the lowest disease incidence and enhanced fresh and dry weight of leaves compared to other treatments and control. Results of the environmental study indicated maximum disease incidence between 35-40 °C (max. T), 6-25 °C (mini. T), 70-80% relative humidity and 1.5-2.5 km/h wind speed while pan evaporation expressed weak correlation with disease development. It was concluded that Fusarium wilt of Eucalyptus camaldulensis could be managed through activation of the basal defense system of the host plant with provision of salicylic acid and balanced nutrition by considering environmental factors. Recent exploration is expected to be helpful for future research efforts on epidemiology and ecologically sound intervention of Fusarium wilt of Eucalyptus camaldulensis.

Hereditary factor VII (FVII) deficiency is an uncommon autosomal recessive disorder associated with mutations in the F7 gene, and laboratory investigations usually reveal isolated prolongation in prothrombin time (PT)/international normalized ratio (INR). Venom-induced consumptive coagulopathy (VICC) is distinguished by the activation of the coagulation pathway, which is triggered by procoagulant toxins in snake venom. Diagnosing snakebites in patients with hereditary FVII deficiency presents a challenge because prolonged time PT/INR is considered the most valuable diagnostic method for VICC. Therefore, it is possible that certain patients may not promptly receive an accurate diagnosis of hereditary FVII deficiency. We present a pedigree featuring hereditary FVII deficiency, which was diagnosed through Sanger sequencing, following a bamboo leaf green snake bite. [ABSTRACT FROM AUTHOR]

Nutrient stress can impose significant metabolic strain on plants, resulting in declining agricultural productivity. Nitrogen, phosphorus, and potassium are essential growth-limiting nutrients and are the primary building elements for amino acids, nucleic acids, proteins, and chlorophyll. The absence of these nutrients has observable effects on various plant characteristics, such as leaf size, color, and plant height. However, recent technological advances in imaging have given birth to computer vision-based plant phenomics, which holds great promise for plant research and management. The non-destructive, quick, automated assessments made possible by these imaging techniques are transforming the field of plant nutrient stress research and monitoring. This paper presents a hybrid quantum–classical model (HQCM) for identifying multi-nutrient stress and nutrient stress level quantification (NSLQ) for plant stress level identification by analyzing plant leaf images, utilizing the combined capabilities of classical and quantum computing systems. The HQCM model uses groundnut multi-nutrient stress (private), rice plant nutrient stress (public), and plant village (public) datasets for experimentation. The HQCM model exhibited impressive levels of accuracy, achieving rates of 97.79%, 97.37%, and 98.75% on the groundnut, rice, and plant village datasets, respectively. This performance surpasses conventional models, including Xception, DECM, DWC, and ResNet50V2. The proposed model showed significant advancements in accuracy, reaching the performance of state-of-art algorithms by 3.24%, 4.07%, and 6.73%, thus emphasizing its better performance. [ABSTRACT FROM AUTHOR]

Plant leaves contain multiple cell types which achieve distinct characteristics whilst still coordinating development within the leaf. The bundle sheath possesses larger individual cells and lower chloroplast content than the adjacent mesophyll, but how this morphology is achieved remains unknown. To identify regulatory mechanisms determining bundle sheath cell morphology we tested the effects of perturbing environmental (light) and endogenous signals (hormones) during leaf development of Oryza sativa (rice). Total chloroplast area in bundle sheath cells was found to increase with cell size as in the mesophyll but did not maintain a 'set‐point' relationship, with the longest bundle sheath cells demonstrating the lowest chloroplast content. Application of exogenous cytokinin and gibberellin significantly altered the relationship between cell size and chloroplast biosynthesis in the bundle sheath, increasing chloroplast content of the longest cells. Delayed exposure to light reduced the mean length of bundle sheath cells but increased corresponding leaf length, whereas premature light reduced final leaf length but did not affect bundle sheath cells. This suggests that the plant hormones cytokinin and gibberellin are regulators of the bundle sheath cell‐chloroplast relationship and that final bundle sheath length may potentially be affected by light‐mediated control of exit from the cell cycle. Summary statement: In rice (Oryza sativa) the timing of light exposure during leaf development changes mature bundle sheath morphology, reducing maximum cell length under extended darkness. Bundle sheath chloroplast biogenesis responds to changing cell size, with this relationship influenced by endogenous hormones. [ABSTRACT FROM AUTHOR]

Leaves harbor distinct microbial communities that can have an important impact on plant health and microbial ecosystems worldwide. Nevertheless, the ecological processes that shape the composition of leaf microbial communities remain unclear, with previous studies reporting contradictory results regarding the importance of bacterial dispersal versus host selection. This discrepancy could be driven in part because leaf microbiome studies typically consider the upper and lower leaf surfaces as a single entity despite these habitats possessing considerable anatomical differences. We characterized the composition of bacterial phyllosphere communities from the upper and lower leaf surfaces across 24 plant species. Leaf surface pH and stomatal density were found to shape phyllosphere community composition, and the underside of leaves had lower richness and higher abundances of core community members than upper leaf surfaces. We found fewer endemic bacteria on the upper leaf surfaces, suggesting that dispersal is more important in shaping these communities, with host selection being a more important force in microbiome assembly on lower leaf surfaces. Our study illustrates how changing the scale in which we observe microbial communities can impact our ability to resolve and predict microbial community assembly patterns on leaf surfaces. IMPORTANCE Leaves can harbor hundreds of different bacterial species that form unique communities for every plant species. Bacterial communities on leaves are really important because they can, for example, protect their host against plant diseases. Usually, bacteria from the whole leaf are considered when trying to understand these communities; however, this study shows that the upper and lower sides of a leaf have a very different impact on how these communities are shaped. It seems that the bacteria on the lower leaf side are more closely associated with the plant host, and communities on the upper leaf side are more impacted by immigrating bacteria. This can be really important when we want to treat, for example, crops in the field with beneficial bacteria or when trying to understand host-microbe interactions on the leaves.

Persian walnut is a drought-sensitive species with considerable genetic variation in the photosynthesis and water use efficiency of its populations, which is largely unexplored. Here, we aimed to elucidate changes in the efficiency of photosynthesis and water content using a diverse panel of 60 walnut families which were submitted to a progressive drought for 24 days, followed by two weeks of re-watering. Severe water-withholding reduced leaf relative water content (RWC) by 20%, net photosynthetic rate (Pn) by 50%, stomatal conductance (gs) by 60%, intercellular CO2 concentration (Ci) by 30%, and transpiration rate (Tr) by 50%, but improved water use efficiency (WUE) by 25%. Severe water-withholding also inhibited photosystem II functionality as indicated by reduced quantum yield of intersystem electron transport (φEo) and transfer of electrons per reaction center (ET0/RC), also enhanced accumulation of QA (VJ) resulted in the reduction of the photosynthetic performance (PIABS) and maximal quantum yield of PSII (FV/FM); while elevated quantum yield of energy dissipation (φDo), energy fluxes for absorption (ABS/RC) and dissipated energy flux (DI0/RC) in walnut families. Cluster analysis classified families into three main groups (tolerant, moderately tolerant, and sensitive), with the tolerant group from dry climates exhibiting lesser alterations in assessed parameters than the other groups. Multivariate analysis of phenotypic data demonstrated that RWC and biophysical parameters related to the chlorophyll fluorescence such as FV/FM, φEo, φDo, PIABS, ABS/RC, ET0/RC, and DI0/RC represent fast, robust and non-destructive biomarkers for walnut performance under drought stress. Finally, phenotype-environment association analysis showed significant correlation of some photosynthetic traits with geoclimatic factors, suggesting a key role of climate and geography in the adaptation of walnut to its habitat conditions.

Fundamental axes of variation in plant traits result from trade-offs between costs and benefits of resource-use strategies at the leaf scale. However, it is unclear whether similar trade-offs propagate to the ecosystem level. Here, we test whether trait correlation patterns predicted by three well-known leaf- and plant-level coordination theories - the leaf economics spectrum, the global spectrum of plant form and function, and the least-cost hypothesis - are also observed between community mean traits and ecosystem processes. We combined ecosystem functional properties from FLUXNET sites, vegetation properties, and community mean plant traits into three corresponding principal component analyses. We find that the leaf economics spectrum (90 sites), the global spectrum of plant form and function (89 sites), and the least-cost hypothesis (82 sites) all propagate at the ecosystem level. However, we also find evidence of additional scale-emergent properties. Evaluating the coordination of ecosystem functional properties may aid the development of more realistic global dynamic vegetation models with critical empirical data, reducing the uncertainty of climate change projections.

Plant response to pathogen infection varies within a leaf, yet this heterogeneity is not well resolved. We expose Arabidopsis to Pseudomonas syringae or mock treatment and profile >11,000 individual cells using single-cell RNA sequencing. Integrative analysis of cell populations from both treatments identifies distinct pathogen-responsive cell clusters exhibiting transcriptional responses ranging from immunity to susceptibility. Pseudotime analyses through pathogen infection reveals a continuum of disease progression from an immune to a susceptible state. Confocal imaging of promoter-reporter lines for transcripts enriched in immune cell clusters shows expression surrounding substomatal cavities colonized or in close proximity to bacterial colonies, suggesting that cells within immune clusters represent sites of early pathogen invasion. Susceptibility clusters exhibit more general localization and are highly induced at later stages of infection. Overall, our work shows cellular heterogeneity within an infected leaf and provides insight into plant differential response to infection at a single-cell level.

SUMMARY: Next‐generation sequencing (NGS) library construction often involves using restriction enzymes to decrease genome complexity, enabling versatile polymorphism detection in plants. However, plant leaves frequently contain impurities, such as polyphenols, necessitating DNA purification before enzymatic reactions. To overcome this problem, we developed a PCR‐based method for expeditious NGS library preparation, offering flexibility in number of detected polymorphisms. By substituting a segment of the simple sequence repeat sequence in the MIG‐seq primer set (MIG‐seq being a PCR method enabling library construction with low‐quality DNA) with degenerate oligonucleotides, we introduced variability in detectable polymorphisms across various crops. This innovation, named degenerate oligonucleotide primer MIG‐seq (dpMIG‐seq), enabled a streamlined protocol for constructing dpMIG‐seq libraries from unpurified DNA, which was implemented stably in several crop species, including fruit trees. Furthermore, dpMIG‐seq facilitated efficient lineage selection in wheat and enabled linkage map construction and quantitative trait loci analysis in tomato, rice, and soybean without necessitating DNA concentration adjustments. These findings underscore the potential of the dpMIG‐seq protocol for advancing genetic analyses across diverse plant species. Significance Statement: Given that plants contain impurities in their leaves, DNA purification is required to construct NGS libraries with reduced genomic complexity using restriction enzymes, which poses a hinderance to rapid genotyping. We developed degenerate oligonucleotide primer MIG‐seq and its accompanying protocol, a method for constructing NGS libraries with varying degrees of complexity reduction from unpurified plant DNA using PCR, and demonstrated the feasibility of expeditious genetic analysis across various crop species. [ABSTRACT FROM AUTHOR]

Stress experienced during development in organisms with bilateral structures could result in developmental instability, which is expressed as subtle non‐directional deviations from perfect symmetry, known as fluctuating asymmetry (FA). As such, FA has been proposed, and extensively used, as a trait indicating stress for many organisms with bilateral structures and many types of stress. However, while this concept may apply to animals, the evidence for plants' main vegetative structures, that is, leaves, remains equivocal, and a comprehensive synthesis on this topic is still missing.We designed observational field and controlled greenhouse studies, combining different growth and leaf forms across multiple stress gradients, comprising 21 species and 80 populations. We measured FA as the difference between the left and right area of the leaf, an approach that accommodates diverse leaf forms. We used high‐precision, blind, single‐person measurements and tested for other forms of symmetry and the effect of leaf size. We further complemented our study with a systematic literature review of FA in plant leaves, compiling 51 studies comprising 72 species, 23 stress types and 131 unique entries (species × stress type).We consistently found no effect of stress on leaf FA in any of the studied species in both our field and experimental gradients. In the systematic literature review, only 39% of the unique entries showed the expected increase in FA with stress, 53% showed no effect, 9% showed an opposite trend of a decrease in FA with stress and 1% showed a unimodal relationship. Importantly, only 40% of all entries fulfilled the crucial step of controlling for a high‐precision measurement, and of these 49% reported the expected increase in FA with stress.Both the results of our observational and experimental approaches and the systematic literature review failed to support a clear relationship between stress and FA in plant leaves. These results clearly show that FA in plant leaves cannot be used as a reliable trait indicating stress during development. Read the free Plain Language Summary for this article on the Journal blog. [ABSTRACT FROM AUTHOR]

Photosynthesis under oblique illumination has not been studied extensively despite being the prevailing light regime under natural conditions. We studied how photosynthetic rate (An) is affected by the geometrical arrangement between leaf lamina and light rays, in conjunction with key anatomical features; studied plant species selected based on the absence (homobaric) or the occurrence of bundle sheath extensions (BSEs; heterobaric) and the arrangement of these structures, that is, parallel (monocots) or reticulated (dicots). The direction of light ray affected leaf absorptance (Abs) and An; both were maximal when the angle of incidence of light on leaf surface (polar angle, θ) was 90°. For any lower θ, both Abs and An were higher when the angle between the leaf axis and the light rays (azimuthal angle, φ) was zero. The dependence of Abs and An from φ was only evident in monocots and, especially, in heterobaric compared to homobaric leaves. In some species, An was substantially higher than predicted from calculated photon flux density of oblique light. The occurrence of BSEs, especially in monocots, significantly alters leaf optical properties, resulting in more efficient photosynthesis under oblique illumination conditions. Summary statement: Plant leaves harvest light for photosynthesis, usually, in a non‐perpendicular position related to the sun. Leaf anatomy increases light use efficiency under these conditions so that the rate of photosynthesis recorded is often much higher than predicted by optical geometry. [ABSTRACT FROM AUTHOR]

Introduction Many people remove the tobacco leaf from cigars and replace it with cannabis (ie, blunts), but few studies have examined whether messages about the risks of cigars, like warnings on cigar packages, can affect blunt use. Methods Participants were 438 U.S. adults who reported past 30-day cigar use and ever blunt use, recruited from a probability-based national panel to take an online survey. In a 2 × 2 experiment with a between-subjects design, we manipulated two cigar warning characteristics: (1) warning type: text-only versus pictorial (ie, text + image) and (2) warning size: 30% (smaller) versus 50% (larger) of the product package. Participants then viewed six different warnings on a fictious cigarillo package, within their randomly assigned condition. After evaluating all stimuli, participants were asked the extent to which the warnings discouraged them from wanting to use cigars to smoke cannabis (ie, blunt perceived warning effectiveness). Response options ranged from "not at all" (1) to "a great deal" (5). Results We observed no main effects of warning type or size on blunt perceived warning effectiveness. However, a significant interaction existed between the two experimental manipulations (p =.009). Whereas adding images made no difference to blunt perceived warning effectiveness when warnings were smaller (simple effect: −0.22, p =.28), images mattered for larger warnings. Specifically, adding images increased blunt perceived warning effectiveness when warnings were 50% of the product package (simple effect: 0.52, p =.008). Conclusions This experiment provides preliminary evidence that larger pictorial cigar warnings may discourage blunt use relative to larger but text-only warnings. Implications Blunts, which are hollowed out cigars with tobacco leaf wrappers that are filled with cannabis leaf, are one of the most common ways in which tobacco and cannabis are used simultaneously, yet few studies have examined whether messages about the risks of cigars can affect blunt use. We conducted an online experiment concerning the perceived effectiveness of cigar warnings among people who use blunts recruited from a probability-based panel. Results provide novel, preliminary evidence that larger pictorial cigar warnings may discourage blunt use, relative to larger but text-only warnings. More research evaluating cigar warnings on blunt use is needed. [ABSTRACT FROM AUTHOR]

Fungi play a pivotal role in fermentation processes, influencing the breakdown and transformation of metabolites. However, studies focusing on the effects of fungal-metabolite correlations on leaf fermentation quality enhancement are limited. This study investigated specific metabolites and fungi associated with high- and low-quality fermented plant leaves. Their changes were monitored over fermentation periods of 0, 8, 16, and 24 days. The results indicated that organoheterocyclic compounds, lipids, lipid-like molecules, organic nitrogen compounds, phenylpropanoids, and polyketides were predominant in highquality samples. The fungi Saccharomyces (14.8%) and Thermoascus (4.6%) were predominantly found in these samples. These markers exhibited significant changes during the 24-day fermentation period. The critical influence of fungal community equilibrium was demonstrated by interspecies interactions (e.g., between Saccharomyces and Eurotium). A co-occurrence network analysis identified Saccharomyces as the primary contributor to highquality samples. These markers collectively enhance the quality and sensory characteristics of the final product. [ABSTRACT FROM AUTHOR]

Ecological theory posits that temporal stability patterns in plant populations are associated with differences in species ecological strategies. However, empirical evidence is lacking about which traits, or trade-offs, underlie species stability, especially across different biomes. We compiled a worldwide collection of long-term permanent vegetation records (greater than 7000 plots from 78 datasets) from a large range of habitats which we combined with existing trait databases. We tested whether the observed inter-annual variability in species abundance (coefficient of variation) was related to multiple individual traits. We found that populations with greater leaf dry matter content and seed mass were more stable over time. Despite the variability explained by these traits being low, their effect was consistent across different datasets. Other traits played a significant, albeit weaker, role in species stability, and the inclusion of multi-variate axes or phylogeny did not substantially modify nor improve predictions. These results provide empirical evidence and highlight the relevance of specific ecological trade-offs, i.e. in different resource-use and dispersal strategies, for plant populations stability across multiple biomes. Further research is, however, necessary to integrate and evaluate the role of other specific traits, often not available in databases, and intraspecific trait variability in modulating species stability.

Life on Earth depends on the conversion of solar energy to chemical energy by plants through photosynthesis. A fundamental challenge in optimizing photosynthesis is to adjust leaf angles to efficiently use the intercepted sunlight under the constraints of heat stress, water loss and competition. Despite the importance of leaf angle, until recently, we have lacked data and frameworks to describe and predict leaf angle dynamics and their impacts on leaves to the globe. We review the role of leaf angle in studies of ecophysiology, ecosystem ecology and earth system science, and highlight the essential yet understudied role of leaf angle as an ecological strategy to regulate plant carbon-water-energy nexus and to bridge leaf, canopy and earth system processes. Using two models, we show that leaf angle variations have significant impacts on not only canopy-scale photosynthesis, energy balance and water use efficiency but also light competition within the forest canopy. New techniques to measure leaf angles are emerging, opening opportunities to understand the rarely-measured intraspecific, interspecific, seasonal and interannual variations of leaf angles and their implications to plant biology and earth system science. We conclude by proposing three directions for future research.

In the plant sciences, results of laboratory studies often do not translate well to the field. To help close this lab-field gap, we developed a strategy for studying the wiring of plant traits directly in the field, based on molecular profiling and phenotyping of individual plants. Here, we use this single-plant omics strategy on winter-type Brassica napus (rapeseed). We investigate to what extent early and late phenotypes of field-grown rapeseed plants can be predicted from their autumnal leaf gene expression, and find that autumnal leaf gene expression not only has substantial predictive power for autumnal leaf phenotypes but also for final yield phenotypes in spring. Many of the top predictor genes are linked to developmental processes known to occur in autumn in winter-type B. napus accessions, such as the juvenile-to-adult and vegetative-to-reproductive phase transitions, indicating that the yield potential of winter-type B. napus is influenced by autumnal development. Our results show that single-plant omics can be used to identify genes and processes influencing crop yield in the field.

Water disinfection by copper vessels has been prevalent over thousands of years. Unfortunately, people are still suffering from the bacterial pollution in drinking water. Here we show that, only through steeping with tiny amounts of common plant leaves, the room-temperature water in copper pots has unexpectedly high antibacterial ability. Remarkably, copper ions released from copper pots into water are in concentrations lower than the WHO safety threshold for drinking water, and have effective antibacterial ability when water contains specific leave components (polyphenols and/or lignin). Our computations show that the key to enhance antibacterial ability is the great increase in the proportion of Cu+ induced by aromatic rings in these leave components, which has been demonstrated by our experiments. The findings may disclose the mystery of copper vessels for water disinfection, and more importantly, provide effective antibacterial applications in industries and daily lives, by safely using copper ions together with biocompatible natural substances.

MicroRNAs (miRNAs) play diverse roles in plant development, but whether and how miRNAs participate in thermomorphogenesis remain ambiguous. Here we show that HYPONASTIC LEAVES 1 (HYL1)-a key component of miRNA biogenesis-acts downstream of the thermal regulator PHYTOCHROME INTERACTING FACTOR 4 in the temperature-dependent plasticity of hypocotyl growth in Arabidopsis. A hyl1-2 suppressor screen identified a dominant dicer-like1 allele that rescues hyl1-2's defects in miRNA biogenesis and thermoresponsive hypocotyl elongation. Genome-wide miRNA and transcriptome analysis revealed microRNA156 (miR156) and its target SQUAMOSA PROMOTER-BINDING-PROTEIN-LIKE 9 (SPL9) to be critical regulators of thermomorphogenesis. Surprisingly, perturbation of the miR156/SPL9 module disengages seedling responsiveness to warm temperatures by impeding auxin sensitivity. Moreover, miR156-dependent auxin sensitivity also operates in the shade avoidance response at lower temperatures. Thus, these results unveil the miR156/SPL9 module as a previously uncharacterized genetic circuit that enables plant growth plasticity in response to environmental temperature and light changes.

Understanding climate change impacts on the Cape Floristic Region requires improved knowledge of plant physiological responses to the environment. Studies examining physiological responses of mountain fynbos have consisted of campaign-based measurements, capturing snapshots of plant water relations and photosynthesis. We examine conclusions drawn from prior studies by tracking in situ physiological responses of three species, representing dominant growth forms (proteoid, ericoid, restioid), over 2 years using miniature continuous sap flow technology, long-term observations of leaf/culm water potential and gas exchange, and xylem vulnerability to embolism. We observed considerable inter-specific variation in the timing and extent of seasonal declines in productivity. Shallow-rooted Erica monsoniana exhibited steep within-season declines in sap flow and water potentials, and pronounced inter-annual variability in total daily sap flux (Js). Protea repens showed steady reductions in Js across both years, despite deeper roots and less negative water potentials. Cannomois congesta-a shallow-rooted restioid-was least negatively impacted. Following rehydrating rain at the end of summer, gas exchange recovery was lower in the drier year compared with the normal year, but did not differ between species. Loss of function in the drier year was partially accounted for by loss of xylem transport capacity in Erica and Cannomois, but not Protea. Hitherto unseen water use patterns, including inter-annual variability of gas exchange associated with contrasting water uptake properties, reveal that species use different mechanisms to cope with summer dry periods. Revealing physiological responses of key growth forms enhances predictions of plant function within mountain fynbos under future conditions.

The spatial dispersion of photoelements within a vegetation canopy, quantified by the clumping index (CI), directly regulates the within-canopy light environment and photosynthesis rate, but is not commonly implemented in terrestrial biosphere models to estimate the ecosystem carbon cycle. A few global CI products have been developed recently with remote sensing measurements, making it possible to examine the global impacts of CI. This study deployed CI in the radiative transfer scheme of the Community Land Model version 5 (CLM5) and used the revised CLM5 to quantitatively evaluate the extent to which CI can affect canopy absorbed radiation and gross primary production (GPP), and for the first time, considering the uncertainty and seasonal variation of CI with multiple remote sensing products. Compared to the results without considering the CI impact, the revised CLM5 estimated that sunlit canopy absorbed up to 9%-15% and 23%-34% less direct and diffuse radiation, respectively, while shaded canopy absorbed 3%-18% more diffuse radiation across different biome types. The CI impacts on canopy light conditions included changes in canopy light absorption, and sunlit-shaded leaf area fraction related to nitrogen distribution and thus the maximum rate of Rubisco carboxylase activity (Vcmax ), which together decreased photosynthesis in sunlit canopy by 5.9-7.2 PgC year-1 while enhanced photosynthesis by 6.9-8.2 PgC year-1 in shaded canopy. With higher light use efficiency of shaded leaves, shaded canopy increased photosynthesis compensated and exceeded the lost photosynthesis in sunlit canopy, resulting in 1.0 ± 0.12 PgC year-1 net increase in GPP. The uncertainty of GPP due to the different input CI datasets was much larger than that caused by CI seasonal variations, and was up to 50% of the magnitude of GPP interannual variations in the tropical regions. This study highlights the necessity of considering the impacts of CI and its uncertainty in terrestrial biosphere models.

Cisplatin is a prominent chemotherapeutic agent that can induce significant damage to normal cells. Therefore, it is important to develop agents that protect normal cells without influencing the chemotherapeutic effect of cisplatin. The present study was conducted to explore the protective effects of Annona muricata leaf polysaccharides (ALPS) against cisplatin‑induced toxicity in macrophages. Apoptosis was assessed in macrophages and lung cancer cells to investigate the cytoprotective effect of ALPS, their effect on the production of cisplatin‑induced reactive oxygen species (ROS) and the loss of the mitochondrial transmembrane potential (MTP). Cisplatin, when used alone or in combination with ALPS, showed significant toxicity against A549 and H460 lung cancer cells. However, cisplatin‑induced cytotoxicity was suppressed by cotreatment of RAW 264.7 macrophages with ALPS. ALPS significantly inhibited the upregulation of Bax, cytosolic cytochrome c and caspases‑3, ‑8 and ‑9. Moreover, ALPS resulted in the cleavage of PARP and downregulation of Bcl‑2 levels in a concentration‑dependent manner, which ultimately led to a reduction in the apoptotic and necrotic populations of cisplatin‑treated RAW 264.7 macrophages. The suppression of the apoptotic signaling pathways was mediated through the reduction of ROS and MTP loss in cisplatin‑treated RAW 264.7 macrophages. In addition, ALPS alleviated cell damage by suppressing the mitochondrial apoptotic pathways in cisplatin‑treated bone marrow‑derived macrophages. Together, these findings suggested that ALPS may alleviate the toxic side effects of chemotherapeutic agents and act as a potential candidate for use as an effective adjuvant therapy.

Although plants and animals both assess their environment and respond to stimuli, this reaction is considered a behavior in animals and a response in plants. Responses in plants are seen within various timescales- from the nanosecond stimuli is presented to a lifelong progression. Within this study, we bridge the gap between animal behavioral studies and plant response. Sensitive plants (Mimosa pudica L.) are an ideal subject for this due to the rapid closure of their primary leaflets when touched. We designed a multimodal, or stress combination, experiment to test two hypotheses with sensitive plants: if they could be distracted and if they would alter their risk assessment when exposed to external stimuli (wind and sound). To evaluate the distraction hypothesis, we measured an individuals latency to close, hypothesizing that if the plants were distracted, they would take longer to close. To evaluate the uncertain risk hypothesis, we quantified the latency to reopen, hypothesizing that if the plants were uncertain, they would take longer to reopen. We also quantified the number of pinnae closed on the selected stem to test for changes in risk assessment across treatments. We expected the unimodal treatments would distract or alter risk assessment, and the multimodal treatment would elicit an enhanced response. Multimodal stimuli had a significant effect on the number of pinnae closed before the tap, but we found no evidence that plants were distracted by any stimulus tested. We found that temperature had a significant effect on the latency to close, and that plants modified their risk assessment when exposed to experimental wind stimuli. By manipulating environmental stimuli, we found that sensitive plants trade-off energy and perceived risk much in the way that is commonly found in animals. Framing the study of plants responses to environmental stimuli as behavioral questions may generate new insights.

Urbanization creates novel ecosystems comprised of species assemblages and environments with no natural analogue. Moreover, irrigation can alter plant function compared to non-irrigated systems. However, the capacity of irrigation to alter functional trait patterns across multiple species is unknown but may be important for the dynamics of urban ecosystems. We evaluated the hypothesis that urban irrigation influences plasticity in functional traits by measuring carbon-gain and water-use traits of 30 tree species planted in Southern California, USA spanning a coastal-to-desert gradient. Tree species respond to irrigation through increasing the carbon-gain trait relationship of leaf nitrogen per specific leaf area compared to their native habitat. Moreover, most species shift to a water-use strategy of greater water loss through stomata when planted in irrigated desert-like environments compared to coastal environments, implying that irrigated species capitalize on increased water availability to cool their leaves in extreme heat and high evaporative demand conditions. Therefore, irrigated urban environments increase the plasticity of trait responses compared to native ecosystems, allowing for novel response to climatic variation. Our results indicate that trees grown in water-resource-rich urban ecosystems can alter their functional traits plasticity beyond those measured in native ecosystems, which can lead to plant trait dynamics with no natural analogue.

Rising temperatures are influencing forests on many scales, with potentially strong variation vertically across forest strata. Using published research and new analyses, we evaluate how microclimate and leaf temperatures, traits, and gas exchange vary vertically in forests, shaping tree, and ecosystem ecology. In closed-canopy forests, upper canopy leaves are exposed to the highest solar radiation and evaporative demand, which can elevate leaf temperature (Tleaf ), particularly when transpirational cooling is curtailed by limited stomatal conductance. However, foliar traits also vary across height or light gradients, partially mitigating and protecting against the elevation of upper canopy Tleaf . Leaf metabolism generally increases with height across the vertical gradient, yet differences in thermal sensitivity across the gradient appear modest. Scaling from leaves to trees, canopy trees have higher absolute metabolic capacity and growth, yet are more vulnerable to drought and damaging Tleaf than their smaller counterparts, particularly under climate change. By contrast, understory trees experience fewer extreme high Tleaf 's but have fewer cooling mechanisms and thus may be strongly impacted by warming under some conditions, particularly when exposed to a harsher microenvironment through canopy disturbance. As the climate changes, integrating the patterns and mechanisms reviewed here into models will be critical to forecasting forest-climate feedback.

BACKGROUND AND AIMS: Our understanding of plant responses to biotic and abiotic drivers is largely based on above-ground plant traits, with little focus on below-ground traits despite their key role in water and nutrient uptake. Here, we aimed to understand the extent to which above- and below-ground traits are co-ordinated, and how these traits respond to soil moisture gradients and plant intraspecific competition. METHODS: We chose seedlings of five tropical tree species and grew them in a greenhouse for 16 weeks under a soil moisture gradient [low (drought), medium and high (well-watered) moisture levels] with and without intraspecific competition. At harvest, we measured nine above- and five below-ground traits of all seedlings based on standard protocols. KEY RESULTS: In response to the soil moisture gradient, above-ground traits are found to be consistent with the leaf economics spectrum, whereas below-ground traits are inconsistent with the root economics spectrum. We found high specific leaf area and total leaf area in well-watered conditions, while high leaf dry matter content, leaf thickness and stem dry matter content were observed in drought conditions. However, below-ground traits showed contrasting patterns, with high specific root length but low root branching index in the low water treatment. The correlations between above- and below-ground traits across the soil moisture gradient were variable, i.e. specific leaf area was positively correlated with specific root length, while it was negatively correlated with root average diameter across moisture levels. However, leaf dry matter content was unexpectedly positively correlated with both specific root length and root branching index. Intraspecific competition has influenced both above- and below-ground traits, but interacted with soil moisture to affect only below-ground traits. Consistent with functional equilibrium theory, more biomass was allocated to roots under drought conditions, and to leaves under sufficient soil moisture conditions. CONCLUSIONS: Our results indicate that the response of below-ground traits to plant intraspecific competition and soil moisture conditions may not be inferred using above-ground traits, suggesting that multiple resource use axes are needed to understand plant ecological strategies. Lack of consistent leaf-root trait correlations across the soil moisture gradient highlight the multidimensionality of plant trait relationships which needs more exploration.

Growth suppression and defence signalling are simultaneous strategies that plants invoke to respond to abiotic stress. Here, we show that the drought stress response of poplar trees (Populus trichocarpa) is initiated by a suppression in cell wall derived methanol (MeOH) emissions and activation of acetic acid (AA) fermentation defences. Temperature sensitive emissions dominated by MeOH (AA/MeOH

PremiseGenetic variation influences the potential for evolution to rescue populations from impacts of environmental change. Most studies of genetic variation in fitness-related traits focus on either vegetative or floral traits, with few on floral scent. How vegetative and floral traits compare in potential for adaptive evolution is poorly understood.MethodsWe measured variation across source populations, planting sites, and genetic families for vegetative and floral traits in a hybrid zone. Seeds from families of Ipomopsis aggregata, I. tenuituba, and F1 and F2 hybrids of the two species were planted into three common gardens. Measured traits included specific leaf area (SLA), trichomes, water-use efficiency (WUE), floral morphology, petal color, nectar, and floral volatiles.ResultsVegetative traits SLA and WUE varied greatly among planting sites, while showing weak or no genetic variation among source populations. Specific leaf area and trichomes responded plastically to snowmelt date, and SLA exhibited within-population genetic variation. All aspects of floral morphology varied genetically among source populations, and corolla length, corolla width, and sepal width varied genetically within populations. Heritability was not detected for volatiles due to high environmental variation, although one terpene had high evolvability, and high emission of two terpenes, a class of compounds emitted more strongly from the calyx than the corolla, correlated genetically with sepal width. Environmental variation across sites was weak for floral morphology and stronger for volatiles and vegetative traits. The inheritance of three of four volatiles departed from additive.ConclusionsResults indicate stronger genetic potential for evolutionary responses to selection in floral morphology compared with scent and vegetative traits and suggest potentially adaptive plasticity in some vegetative traits.

Fossilized leaves provide the longest running record of hyperdiverse plant-insect herbivore associations. Reconstructions of these relationships over deep time indicate strong links between environmental conditions, herbivore diversity, and feeding damage on leaves. However, herbivory has not been compared between the past and the modern era, which is characterized by intense anthropogenic environmental change. Here, we present estimates for damage frequencies and diversities on fossil leaves from the Late Cretaceous (66.8 Ma) through the Pleistocene (2.06 Ma) and compare these estimates with Recent (post-1955) leaves collected via paleobotanical methods from modern ecosystems: Harvard Forest, United States; the Smithsonian Environmental Research Center, United States; and La Selva, Costa Rica. Total damage frequency, measured as the percentage of leaves with any herbivore damage, within modern ecosystems is greater than any fossil locality within this record. This pattern is driven by increased frequencies across nearly all functional feeding groups within the Recent. Diversities of total, specialized, and mining damage types are elevated within the Recent compared with fossil floras. Our results demonstrate that plants in the modern era are experiencing unprecedented levels of insect damage, despite widespread insect declines. Human influence, such as the rate of global climate warming, influencing insect feeding and timing of life cycle processes along with urbanization and the introduction of invasive plant and insect species may drive elevated herbivory. This research suggests that the strength of human influence on plant-insect interactions is not controlled by climate change alone but rather, the way in which humans interact with terrestrial landscape.

Recent evidence suggests that, similar to larger organisms, dispersal is a key driver of microbiome assembly; however, our understanding of the rates and taxonomic composition of microbial dispersal in natural environments is limited. Here, we characterized the rate and composition of bacteria dispersing into surface soil via three dispersal routes (from the air above the vegetation, from nearby vegetation and leaf litter near the soil surface, and from the bulk soil and litter below the top layer). We then quantified the impact of those routes on microbial community composition and functioning in the topmost litter layer. The bacterial dispersal rate onto the surface layer was low (7900 cells/cm2/day) relative to the abundance of the resident community. While bacteria dispersed through all three routes at the same rate, only dispersal from above and near the soil surface impacted microbiome composition, suggesting that the composition, not rate, of dispersal influenced community assembly. Dispersal also impacted microbiome functioning. When exposed to dispersal, leaf litter decomposed faster than when dispersal was excluded, although neither decomposition rate nor litter chemistry differed by route. Overall, we conclude that the dispersal routes transport distinct bacterial communities that differentially influence the composition of the surface soil microbiome.

Contact electrification has attracted interest as a mechanism for generating electrical charges on surfaces. To explore the factors contributing to electrification by droplets impacting the leaf surface, high-speed image capture and current measurements were used to quantitatively characterize the electrical response under different droplet parameters and leaf surface conditions. Upon impact and rebound from the leaf surface, neutral droplets acquire a positive charge. While this electrification phenomenon has been observed previously, there has been limited understanding of the parameters influencing the extent of droplet charging. In this study, we examine the effects of four parameters (droplet size, impact velocity, droplet ion concentration, and various leaf surfaces) on the electrical response signal. The results indicate that this electrification phenomenon is contingent upon the droplet–leaf contact area and droplet ion concentration. We propose a theoretical model based on the electric double layer to elucidate the electrification process. [ABSTRACT FROM AUTHOR]

In this study, a novel system was designed to enhance the efficiency of data acquisition in a portable and compact instrument dedicated to the spectral analysis of various surfaces, including plant leaves, and materials requiring characterization within the 410 to 915 nm range. The proposed system incorporates two nine-band detectors positioned on the top and bottom of the target surface, each equipped with a digitally controllable LED. The detectors are capable of measuring both reflection and transmission properties, depending on the LED configuration. Specifically, when the upper LED is activated, the lower detector operates without its LED, enabling the precise measurement of light transmitted through the sample. The process is reversed in subsequent iterations, facilitating an accurate assessment of reflection and transmission for each side of the target surface. For reliability, the error estimation utilizes a color checker, followed by a multi-layer perceptron (MLP) implementation integrated into the microcontroller unit (MCU) using TinyML technology for real-time refined data acquisition. The system is constructed with 3D-printed components and cost-effective electronics. It also supports USB or Bluetooth communication for data transmission. This innovative detector marks a significant advancement in spectral analysis, particularly for plant research, offering the potential for disease detection and nutritional deficiency assessment. [ABSTRACT FROM AUTHOR]

Plants are especially useful as biological indicators to assess air pollution and the effects of urbanisation. The aim of this study was to investigate tree species' sensitivity to air pollution using the Air Pollution Tolerance Index (APTI), the dust content (PM10) of leaves, and the heavy metal concentration of leaves. Sampling sites were in a city park (urban area), a location on the edge of the city (suburban area), and a forested location (rural area) along an urbanisation gradient in the city of Vienna in Austria. Leaf samples were collected from Acer platanoides, Fraxinus excelsior, and Quercus robur tree species. The APTI was determined by measuring the content of relative water ascorbic acid and chlorophyll, and the pH of leaf extracts. We found significant difference among species in their relative water content, pH, and content of ascorbic acid and chlorophyll Additionally, we found significant differences in chlorophyll content and pH based on sampling site. The highest chlorophyll content was found in A. platanoides. There was a significant difference among species in Al, Ba, Cr, Ni, and Zn concentrations in each stage of urbanisation. Based on APTI values, the studied species were sensitive indicators of air pollution; thus, they are useful bioindicator species, and they are suitable for air pollution monitoring. We demonstrated the effects of urbanisation with these bioindicator species with elevated PM10, Al, Ba, Cu, Fe, Sr, and Zn concentrations in urban area samples. [ABSTRACT FROM AUTHOR]

Copyright of Arid Zone Research / Ganhanqu Yanjiu is the property of Arid Zone Research Editorial Office and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Baghdad Science Journal is the property of Republic of Iraq Ministry of Higher Education & Scientific Research (MOHESR) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Al-Academy is the property of Republic of Iraq Ministry of Higher Education & Scientific Research (MOHESR) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

This article comments on: Yi-Yi Meng, Wei Xiang, Yin Wen, Dong-Liu Huang, Kun-Fang Cao, and Shi-Dan Zhu, Correlations between leaf economics, mechanical resistance and drought tolerance across 41 cycad species, Annals of Botany, Volume 130, Issue 3, 1 September 2022, Pages 345–354 https://doi.org/10.1093/aob/mcab146

Leaf shape represents a vital agronomic trait for leafy vegetables such as lettuce. Some lettuce cultivars produce lobed leaves, varying from pinnately to palmately lobed, but the genetic mechanisms remain unclear. In this study, we cloned one major quantitative trait locus (QTL) controlling palmately lobed leaves. The candidate gene, LsKN1, encodes a homeobox transcription factor, and has been shown previously to be critical for the development of leafy heads in lettuce. The LsKN1 allele that is upregulated by the insertion of a transposon promotes the development of palmately lobed leaves. We demonstrated that LsKN1 upregulated LsCUC2 and LsCUC3 through different mechanisms, and their upregulation was critical for the development of palmately lobed leaves. LsKN1 binds the promoter of LsPID to promote auxin biosynthesis, which positively contributes to the development of palmately lobed leaves. In contrast, LsKN1 suppresses GA biosynthesis to promote palmately lobed leaves. LsKN1 also binds to the promoter of LsAS1, a dorsiventrality gene, to downregulate its expression. Overexpression of the LsAS1 gene compromised the effects of the LsKN1 gene changing palmately to pinnately lobed leaves. Our study illustrated that the upregulated LsKN1 gene led to palmately lobed leaves in lettuce by integrating several downstream pathways, including auxin, gibberellin, and leaf dorsiventrality pathways.

Nitrogen (N) limitation has been considered as a constraint on terrestrial carbon uptake in response to rising CO2 and climate change. By extension, it has been suggested that declining carboxylation capacity (Vcmax ) and leaf N content in enhanced-CO2 experiments and satellite records signify increasing N limitation of primary production. We predicted Vcmax using the coordination hypothesis and estimated changes in leaf-level photosynthetic N for 1982-2016 assuming proportionality with leaf-level Vcmax at 25°C. The whole-canopy photosynthetic N was derived using satellite-based leaf area index (LAI) data and an empirical extinction coefficient for Vcmax , and converted to annual N demand using estimated leaf turnover times. The predicted spatial pattern of Vcmax shares key features with an independent reconstruction from remotely sensed leaf chlorophyll content. Predicted leaf photosynthetic N declined by 0.27% yr-1 , while observed leaf (total) N declined by 0.2-0.25% yr-1 . Predicted global canopy N (and N demand) declined from 1996 onwards, despite increasing LAI. Leaf-level responses to rising CO2 , and to a lesser extent temperature, may have reduced the canopy requirement for N by more than rising LAI has increased it. This finding provides an alternative explanation for declining leaf N that does not depend on increasing N limitation.

PremiseAdaptive divergence across environmental gradients is a key driver of speciation. Precipitation seasonality gradients are common in the tropics, yet drought adaptation is nearly unexplored in neotropical understory herbs. Here, we examined two recently diverged neotropical spiral gingers, one adapted to seasonal drought and one reliant on perennial water, to uncover the basis of drought adaptation.MethodsWe combined ecophysiological trait measurements in the field and greenhouse with experimental and observational assessments of real-time drought response to determine how Costus villosissimus (Costaceae) differs from C. allenii to achieve drought adaptation.ResultsWe found that drought-adapted C. villosissimus has several characteristics indicating flexible dehydration avoidance via semi-drought-deciduousness and a fast economic strategy. Although the two species do not differ in water-use efficiency, C. villosissimus has a more rapid growth rate, lower leaf mass per area, lower stem density, higher leaf nitrogen, and a strong trend of greater light-saturated photosynthetic rates. These fast economic strategy traits align with both field-based observations and experimental dry-down results. During drought, C. villosissimus displays facultative drought-deciduousness, losing lower leaves during the dry season and rapidly growing new leaves in the wet season.ConclusionsWe revealed a drought adaptation strategy that has not, to our knowledge, previously been documented in tropical herbs. This divergent drought adaptation evolved recently and is an important component of reproductive isolation between C. villosissimus and C. allenii, indicating that adaptive shifts to survive seasonal drought may be an underappreciated axis of neotropical understory plant diversification.

Similar to other cropping systems, few walnut cultivars are used as scion in commercial production. Germplasm collections can be used to diversify cultivar options and hold potential for improving crop productivity, disease resistance and stress tolerance. In this study, we explored the anatomical and biochemical bases of photosynthetic capacity and response to water stress in 11 Juglans regia accessions in the U.S. department of agriculture, agricultural research service (USDA-ARS) National Clonal Germplasm. Net assimilation rate (An ) differed significantly among accessions and was greater in lower latitudes coincident with higher stomatal and mesophyll conductances, leaf thickness, mesophyll porosity, gas-phase diffusion, leaf nitrogen and lower leaf mass and stomatal density. High CO2 -saturated assimilation rates led to increases in An under diffusional and biochemical limitations. Greater An was found in lower-latitude accessions native to climates with more frost-free days, greater precipitation seasonality and lower temperature seasonality. As expected, water stress consistently impaired photosynthesis with the highest % reductions in lower-latitude accessions (A3, A5 and A9), which had the highest An under well-watered conditions. However, An for A3 and A5 remained among the highest under dehydration. J. regia accessions, which have leaf structural traits and biochemistry that enhance photosynthesis, could be used as commercial scions or breeding parents to enhance productivity.

The cuticle, a hydrophobic layer of cutin and waxes synthesized by plant epidermal cells, is the major barrier to water loss when stomata are closed. Dissecting the genetic architecture of natural variation for maize (Zea mays L.) leaf cuticular conductance (gc) is important for identifying genes relevant to improving crop productivity in drought-prone environments. To this end, we performed an integrated genome- and transcriptome-wide association studies (GWAS and TWAS) to identify candidate genes putatively regulating variation in leaf gc. Of the 22 plausible candidate genes identified, 4 were predicted to be involved in cuticle precursor biosynthesis and export, 2 in cell wall modification, 9 in intracellular membrane trafficking, and 7 in the regulation of cuticle development. A gene encoding an INCREASED SALT TOLERANCE1-LIKE1 (ISTL1) protein putatively involved in intracellular protein and membrane trafficking was identified in GWAS and TWAS as the strongest candidate causal gene. A set of maize nested near-isogenic lines that harbor the ISTL1 genomic region from eight donor parents were evaluated for gc, confirming the association between gc and ISTL1 in a haplotype-based association analysis. The findings of this study provide insights into the role of regulatory variation in the development of the maize leaf cuticle and will ultimately assist breeders to develop drought-tolerant maize for target environments.

Lianas, climbing woody plants, influence the structure and function of tropical forests. Climbing traits have evolved multiple times, including ancestral groups such as gymnosperms and pteridophytes, but the genetic basis of the liana strategy is largely unknown. Here, we use a comparative transcriptomic approach for 47 tropical plant species, including ten lianas of diverse taxonomic origins, to identify genes that are consistently expressed or downregulated only in lianas. Our comparative analysis of full-length transcripts enabled the identification of a core interactomic network common to lianas. Sets of transcripts identified from our analysis reveal features related to functional traits pertinent to leaf economics spectrum in lianas, include upregulation of genes controlling epidermal cuticular properties, cell wall remodeling, carbon concentrating mechanism, cell cycle progression, DNA repair and a large suit of downregulated transcription factors and enzymes involved in ABA-mediated stress response as well as lignin and suberin synthesis. All together, these genes are known to be significant in shaping plant morphologies through responses such as gravitropism, phyllotaxy and shade avoidance.

The basic mechanisms of leaf development have been revealed through a combination of genetics and intense analyses in select model species. The genetic basis for diversity in leaf morphology seen in nature is also being unraveled through recent advances in techniques and technologies related to genomics and transcriptomics, which have had a major impact on these comparative studies. However, this has led to the emergence of new unresolved questions about the mechanisms that generate the diversity of leaf form. Here, we provide a review of the current knowledge of the fundamental molecular genetic mechanisms underlying leaf development with an emphasis on natural variation and conserved gene regulatory networks involved in leaf development. Beyond that, we discuss open questions/enigmas in the area of leaf development, how recent technologies can best be deployed to generate a unified understanding of leaf diversity and its evolution, and what untapped fields lie ahead.