Search

The genetic control of many plant traits can be highly complex. Both allelic variation (sequence change) and dosage variation (copy number change) contribute to a plants phenotype. While numerous studies have investigated the effect of allelic or dosage variation, very few have documented both within the same system, leaving their relative contribution to phenotypic effects unclear. The Populus genome is highly polymorphic, and poplars are fairly tolerant of gene dosage variation. Here, using a previously established Populus hybrid F1 population, we assessed and compared the effect of natural allelic variation and induced dosage variation on biomass, phenology, and leaf morphology traits. We identified QTLs for many of these traits, but our results indicate limited overlap between the QTLs associated with natural allelic variation and induced dosage variation. Additionally, the integration of data from both allelic and dosage variation identifies a larger set of QTLs that together explain a larger percentage of the phenotypic variance. Finally, our results suggest that the effect of the large indels might mask that of allelic QTLs. Our study helps clarify the relationship between allelic and dosage variation and their effects on quantitative traits.

Effector secretion is crucial for root endophytes to establish and protect their ecological niche. We used time-resolved transcriptomics to monitor effector gene expression dynamics in two closely related Sebacinales, Serendipita indica and Serendipita vermifera, during symbiosis with three plant species, competition with the phytopathogenic fungus Bipolaris sorokiniana, and cooperation with root-associated bacteria. We observed increased effector gene expression in response to biotic interactions, particularly with plants, indicating their importance in host colonization. Some effectors responded to both plants and microbes, suggesting dual roles in intermicrobial competition and plant-microbe interactions. A subset of putative antimicrobial effectors, including a GH18-CBM5 chitinase, was induced exclusively by microbes. Functional analyses of this chitinase revealed its antimicrobial and plant-protective properties. We conclude that dynamic effector gene expression underpins the ability of Sebacinales to thrive in diverse ecological niches with a single fungal chitinase contributing substantially to niche defense.

Intragenomic mutation rates can vary dramatically due to transcription-associated mutagenesis or transcription-coupled repair, which vary based on local epigenomic modifications that are nonuniformly distributed across genomes. One feature associated with decreased mutation is higher expression level, which depends on environmental cues. To understand the magnitude of expression-dependent mutation rate variation, we perturbed expression through a heat treatment in Arabidopsis thaliana. We quantified gene expression to identify differentially expressed genes, which we then targeted for mutation detection using duplex sequencing. This approach provided a highly accurate measurement of the frequency of rare somatic mutations in vegetative plant tissues, which has been a recent source of uncertainty. Somatic mutations in plants may be useful for understanding drivers of DNA damage and repair in the germline since plants experience late germline segregation and both somatic and germline cells share common repair machinery. We included mutant lines lacking mismatch repair (MMR) and base excision repair (BER) capabilities to understand how repair mechanisms may drive biased mutation accumulation. We found wild-type (WT) and BER mutant mutation frequencies to be very low (mean variant frequency 1.8 × 10-8 and 2.6 × 10-8, respectively), while MMR mutant frequencies were significantly elevated (1.13 × 10-6). Interestingly, in the MMR mutant lines, there was no difference in the somatic mutation frequencies between temperature treatments or between highly versus lowly expressed genes. The extremely low somatic variant frequencies in WT plants indicate that larger datasets will be needed to address fundamental evolutionary questions about whether environmental change leads to gene-specific changes in mutation rate.

Selfish genetic elements contribute to hybrid incompatibility and bias or drive their own transmission1,2. Chromosomal drive typically functions in asymmetric female meiosis, whereas gene drive is normally post-meiotic and typically found in males. Here, using single-molecule and single-pollen genome sequencing, we describe Teosinte Pollen Drive, an instance of gene drive in hybrids between maize (Zea mays ssp. mays) and teosinte mexicana (Z. mays ssp. mexicana) that depends on RNA interference (RNAi). 22-nucleotide small RNAs from a non-coding RNA hairpin in mexicana depend on Dicer-like 2 (Dcl2) and target Teosinte Drive Responder 1 (Tdr1), which encodes a lipase required for pollen viability. Dcl2, Tdr1 and the hairpin are in tight pseudolinkage on chromosome 5, but only when transmitted through the male. Introgression of mexicana into early cultivated maize is thought to have been critical to its geographical dispersal throughout the Americas3, and a tightly linked inversion in mexicana spans a major domestication sweep in modern maize4. A survey of maize traditional varieties and sympatric populations of teosinte mexicana reveals correlated patterns of admixture among unlinked genes required for RNAi on at least four chromosomes that are also subject to gene drive in pollen from synthetic hybrids. Teosinte Pollen Drive probably had a major role in maize domestication and diversification, and offers an explanation for the widespread abundance of self small RNAs in the germ lines of plants and animals.

Low iron (Fe) bioavailability can limit the biosynthesis of Fe-containing proteins, which are especially abundant in photosynthetic organisms, thus negatively affecting global primary productivity. Understanding cellular coping mechanisms under Fe limitation is therefore of great interest. We surveyed the temporal responses of Chlamydomonas (Chlamydomonas reinhardtii) cells transitioning from an Fe-rich to an Fe-free medium to document their short and long-term adjustments. While slower growth, chlorosis and lower photosynthetic parameters are evident only after one or more days in Fe-free medium, the abundance of some transcripts, such as those for genes encoding transporters and enzymes involved in Fe assimilation, change within minutes, before changes in intracellular Fe content are noticeable, suggestive of a sensitive mechanism for sensing Fe. Promoter reporter constructs indicate a transcriptional component to this immediate primary response. With acetate provided as a source of reduced carbon, transcripts encoding respiratory components are maintained relative to transcripts encoding components of photosynthesis and tetrapyrrole biosynthesis, indicating metabolic prioritization of respiration over photosynthesis. In contrast to the loss of chlorophyll, carotenoid content is maintained under Fe limitation despite a decrease in the transcripts for carotenoid biosynthesis genes, indicating carotenoid stability. These changes occur more slowly, only after the intracellular Fe quota responds, indicating a phased response in Chlamydomonas, involving both primary and secondary responses during acclimation to poor Fe nutrition.

Modification of lignin in feedstocks via genetic engineering aims to reduce biomass recalcitrance to facilitate efficient conversion processes. These improvements can be achieved by expressing exogenous enzymes that interfere with native biosynthetic pathways responsible for the production of the lignin precursors. In planta expression of a bacterial 3-dehydroshikimate dehydratase in poplar trees reduced lignin content and altered the monomer composition, which enabled higher yields of sugars after cell wall polysaccharide hydrolysis. Understanding how plants respond to such genetic modifications at the transcriptional and metabolic levels is needed to facilitate further improvement and field deployment. In this work, we acquired fundamental knowledge on lignin-modified poplar expressing 3-dehydroshikimate dehydratase using RNA-seq and metabolomics. The data clearly demonstrate that changes in gene expression and metabolite abundance can occur in a strict spatiotemporal fashion, revealing tissue-specific responses in the xylem, phloem, or periderm. In the poplar line that exhibited the strongest reduction in lignin, we found that 3% of the transcripts had altered expression levels and ~19% of the detected metabolites had differential abundance in the xylem from older stems. The changes affected predominantly the shikimate and phenylpropanoid pathways as well as secondary cell wall metabolism, and resulted in significant accumulation of hydroxybenzoates derived from protocatechuate and salicylate.

The red and far-red light photoreceptor phytochrome B (phyB) transmits light signals following cytosol-to-nuclear translocation to regulate transcriptional networks therein. This necessitates changes in protein-protein interactions of phyB in the cytosol, about which little is presently known. Via introduction of a nucleus-excluding G767R mutation into the dominant, constitutively active phyBY276H (YHB) allele, we explore the functional consequences of expressing a cytosol-localized YHBG767R variant in transgenic Arabidopsis seedlings. We show that YHBG767R elicits selective constitutive photomorphogenic phenotypes in dark-grown phyABCDE null mutants, wild type and other phy-deficient genotypes. These responses include light-independent apical hook opening, cotyledon unfolding, seed germination and agravitropic hypocotyl growth with minimal suppression of hypocotyl elongation. Such phenotypes correlate with reduced PIF3 levels, which implicates cytosolic targeting of PIF3 turnover or PIF3 translational inhibition by YHBG767R. However, as expected for a cytoplasm-tethered phyB, YHBG767R elicits reduced light-mediated signaling activity compared with similarly expressed wild-type phyB in phyABCDE mutant backgrounds. YHBG767R also interferes with wild-type phyB light signaling, presumably by formation of cytosol-retained and/or otherwise inactivated heterodimers. Our results suggest that cytosolic interactions with PIFs play an important role in phyB signaling even under physiological conditions.

Genetic dissection of a QTL from wild emmer wheat, QGpc.huj.uh-5B.2, introgressed into bread wheat, identified candidate genes associated with tolerance to nitrogen deficiency, and potentially useful for improving nitrogen-use efficiency. Nitrogen (N) is an important macronutrient critical to wheat growth and development; its deficiency is one of the main factors causing reductions in grain yield and quality. N availability is significantly affected by drought or flooding, that are dependent on additional factors including soil type or duration and severity of stress. In a previous study, we identified a high grain protein content QTL (QGpc.huj.uh-5B.2) derived from the 5B chromosome of wild emmer wheat, that showed a higher proportion of explained variation under water-stress conditions. We hypothesized that this QTL is associated with tolerance to N deficiency as a possible mechanism underlying the higher effect under stress. To validate this hypothesis, we introgressed the QTL into the elite bread wheat var. Ruta, and showed that under N-deficient field conditions the introgression IL99 had a 33% increase in GPC (p

Maintenance of water homeostasis is a fundamental cellular process required by all living organisms. Here, we use the single-celled green alga Chlamydomonas reinhardtii to establish a foundational understanding of osmotic-stress signaling pathways through transcriptomics, phosphoproteomics, and functional genomics approaches. Comparison of pathways identified through these analyses with yeast and Arabidopsis allows us to infer their evolutionary conservation and divergence across these lineages. 76 genes, acting across diverse cellular compartments, were found to be important for osmotic-stress tolerance in Chlamydomonas through their functions in cytoskeletal organization, potassium transport, vesicle trafficking, mitogen-activated protein kinase and chloroplast signaling. We show that homologs for five of these genes have conserved functions in stress tolerance in Arabidopsis and reveal a novel PROFILIN-dependent stage of acclimation affecting the actin cytoskeleton that ensures tissue integrity upon osmotic stress. This study highlights the conservation of the stress response in algae and land plants, and establishes Chlamydomonas as a unicellular plant model system to dissect the osmotic stress signaling pathway.

We studied the D3-type cyclin function during gynoecium development in Arabidopsis and how they are related to the hormone cytokinin and the transcription factor SPATULA. Growth throughout the life of plants is sustained by cell division and differentiation processes in meristematic tissues. In Arabidopsis, gynoecium development implies a multiphasic process where the tissues required for pollination, fertilization, and seed development form. The Carpel Margin Meristem (CMM) is a mass of undifferentiated cells that gives rise to the gynoecium internal tissues, such as septum, ovules, placenta, funiculus, transmitting tract, style, and stigma. Different genetic and hormonal factors, including cytokinin, control the CMM function. Cytokinin regulates the cell cycle transitions through the activation of cell cycle regulators as cyclin genes. D3-type cyclins are expressed in proliferative tissues, favoring the mitotic cell cycle over the endoreduplication. Though the role of cytokinin in CMM and gynoecium development is highly studied, its specific role in regulating the cell cycle in this tissue remains unclear. Additionally, despite extensive research on the relationship between CYCD3 genes and cytokinin, the regulatory mechanism that connects them remains elusive. Here, we found that D3-type cyclins are expressed in proliferative medial and lateral tissues. Conversely, the depletion of the three CYCD3 genes showed that they are not essential for gynoecium development. However, the addition of exogenous cytokinin showed that they could control the division/differentiation balance in gynoecium internal tissues and outgrowths. Finally, we found that SPATULA can be a mechanistic link between cytokinin and the D3-type cyclins. The data suggest that the role of D3-type cyclins in gynoecium development is related to the cytokinin response, and they might be activated by the transcription factor SPATULA.

Excessive nitrogen promotes the formation of nonproductive tillers in rice, which decreases nitrogen use efficiency (NUE). Developing high-NUE rice cultivars through balancing nitrogen uptake and the formation of productive tillers remains a long-standing challenge, yet how these two processes are coordinated in rice remains elusive. Here we identify the transcription factor OsGATA8 as a key coordinator of nitrogen uptake and tiller formation in rice. OsGATA8 negatively regulates nitrogen uptake by repressing transcription of the ammonium transporter gene OsAMT3.2. Meanwhile, it promotes tiller formation by repressing the transcription of OsTCP19, a negative modulator of tillering. We identify OsGATA8-H as a high-NUE haplotype with enhanced nitrogen uptake and a higher proportion of productive tillers. The geographical distribution of OsGATA8-H and its frequency change in historical accessions suggest its adaption to the fertile soil. Overall, this study provides molecular and evolutionary insights into the regulation of NUE and facilitates the breeding of rice cultivars with higher NUE.

P/TGMS (Photo/thermo-sensitive genic male sterile) lines are crucial resources for two-line hybrid rice breeding. Previous studies revealed that slow development is a general mechanism for sterility-fertility conversion of P/TGMS in Arabidopsis. However, the difference in P/TGMS genes between rice and Arabidopsis suggests the presence of a distinct P/TGMS mechanism in rice. In this study, we isolated a novel P/TGMS line, ostms19, which shows sterility under high-temperature conditions and fertility under low-temperature conditions. OsTMS19 encodes a novel pentatricopeptide repeat (PPR) protein essential for pollen formation, in which a point mutation GTA(Val) to GCA(Ala) leads to ostms19 P/TGMS phenotype. It is highly expressed in the tapetum and localized to mitochondria. Under high temperature or long-day photoperiod conditions, excessive ROS accumulation in ostms19 anthers during pollen mitosis disrupts gene expression and intine formation, causing male sterility. Conversely, under low temperature or short-day photoperiod conditions, ROS can be effectively scavenged in anthers, resulting in fertility restoration. This indicates that ROS homeostasis is critical for fertility conversion. This relationship between ROS homeostasis and fertility conversion has also been observed in other tested rice P/TGMS lines. Therefore, we propose that ROS homeostasis is a general mechanism for the sterility-fertility conversion of rice P/TGMS lines.

Cowpea is a highly drought-adapted leguminous crop with great promise for improving agricultural sustainability and food security. Here, we report analyses derived from array-based genotyping of 2,021 accessions constituting a core subset of the worlds largest cowpea collection, held at the International Institute of Tropical Agriculture (IITA) in Ibadan, Nigeria. We used this dataset to examine genetic variation and population structure in worldwide cowpea. We confirm that the primary pattern of population structure is two geographically defined subpopulations originating in West and East Africa, respectively, and that population structure is associated with shifts in phenotypic distribution. Furthermore, we establish the cowpea core collection as a resource for genome-wide association studies by mapping the genetic basis of several phenotypes, with a focus on seed coat pigmentation patterning and color. We anticipate that the genotyped IITA Cowpea Core Collection will serve as a powerful tool for mapping complex traits, facilitating the acceleration of breeding programs to enhance the resilience of this crop in the face of rapid global climate change.

Cotton (Gossypium hirsutum L.) is the key renewable fibre crop worldwide, yet its yield and fibre quality show high variability due to genotype-specific traits and complex interactions among cultivars, management practices and environmental factors. Modern breeding practices may limit future yield gains due to a narrow founding gene pool. Precision breeding and biotechnological approaches offer potential solutions, contingent on accurate cultivar-specific data. Here we address this need by generating high-quality reference genomes for three modern cotton cultivars (UGA230, UA48 and CSX8308) and updating the TM-1 cotton genetic standard reference. Despite hypothesized genetic uniformity, considerable sequence and structural variation was observed among the four genomes, which overlap with ancient and ongoing genomic introgressions from Pima cotton, gene regulatory mechanisms and phenotypic trait divergence. Differentially expressed genes across fibre development correlate with fibre production, potentially contributing to the distinctive fibre quality traits observed in modern cotton cultivars. These genomes and comparative analyses provide a valuable foundation for future genetic endeavours to enhance global cotton yield and sustainability.

Inheritance of the presence/absence of seeds in Annona squamosa is mediated by a single fully recessive gene and is caused by a deletion of the INNER NO OUTER (INO) locus. For some fruits, seedless varieties are desirable for consumption and processing. In the sugar apple tree (Annona squamosa L.), the seedless trait in the Thai seedless (Ts) and Brazilian seedless (Bs) accessions was associated with defective ovules and an apparent deletion of the INNER NO OUTER (INO) ovule development gene locus. Segregation analysis of F2 and backcross descendants of crosses of Bs to fertile wild-type varieties in this species with a multi-year generation time showed that seedlessness was recessive and controlled by a single locus. Comparison of whole genome sequence of a wild-type plant and a third accession, Hawaiian seedless (Hs), identified a 16 kilobase deletion including INO in this line. Ts and Bs lines were shown to have an identical deletion, indicating a common origin from a single deletion event. Analysis of microsatellite markers could not preclude the possibility that all three seedless accessions are vegetatively propagated clones. The sequence of the deletion site enabled a codominant assay for the wild-type and mutant genes allowing observation of complete cosegregation of the seedless/defective ovule phenotype with the INO deletion, showing maximal separation of less than 3.5 cM. The observed deletion is the only significant difference between the wild-type and Hs line over 587 kilobases, likely encompassing much more than 3.5 cM, showing that the deletion is the cause of seedless trait. The codominant markers and obtained progenies will be useful for introgression of the seedless trait into elite sugar apple lines and into other Annonas through interspecific crossings.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Reproductive phasiRNAs (phased, small interfering RNAs) are broadly present in angiosperms and play crucial roles in sustaining male fertility. While the premeiotic 21-nt (nucleotides) phasiRNAs and meiotic 24-nt phasiRNA pathways have been extensively studied in maize (Zea mays) and rice (Oryza sativa), a third putative category of reproductive phasiRNAs-named premeiotic 24-nt phasiRNAs-have recently been reported in barley (Hordeum vulgare) and wheat (Triticum aestivum). To determine whether premeiotic 24-nt phasiRNAs are also present in maize and related species and begin to characterize their biogenesis and function, we performed a comparative transcriptome and degradome analysis of premeiotic and meiotic anthers from five maize inbred lines and three teosinte species/subspecies. Our data indicate that a substantial subset of the 24-nt phasiRNA loci in maize and teosinte are already highly expressed at the premeiotic phase. The premeiotic 24-nt phasiRNAs are similar to meiotic 24-nt phasiRNAs in genomic origin and dependence on DCL5 (Dicer-like 5) for biogenesis, however, premeiotic 24-nt phasiRNAs are unique in that they are likely i) not triggered by microRNAs, ii) not loaded by AGO18 proteins, and iii) not capable of mediating PHAS precursor cleavage. In addition, we also observed a group of premeiotic 24-nt phasiRNAs in rice using previously published data. Together, our results indicate that the premeiotic 24-nt phasiRNAs constitute a unique class of reproductive phasiRNAs and are present more broadly in the grass family (Poaceae) than previously known.

Tanoak (Notholithocarpus densiflorus) is an evergreen tree in the Fagaceae family found in California and southern Oregon. Historically, tanoak acorns were an important food source for Native American tribes, and the bark was used extensively in the leather tanning process. Long considered a disjunct relictual element of the Asian stone oaks (Lithocarpus spp.), phylogenetic analysis has determined that the tanoak is an example of convergent evolution. Tanoaks are deeply divergent from oaks (Quercus) of the Pacific Northwest and comprise a new genus with a single species. These trees are highly susceptible to sudden oak death (SOD), a plant pathogen (Phytophthora ramorum) that has caused widespread deaths of tanoaks. In this study, we set out to assemble the genome and perform comparative studies among a number of individuals that demonstrated varying levels of susceptibility to SOD. First, we sequenced and de novo assembled a draft reference genome of N. densiflorus using cobarcoded library processing methods and an MGI DNBSEQ-G400 sequencer. To increase the contiguity of the final assembly, we also sequenced Oxford Nanopore long reads to 30× coverage. To our knowledge, the draft genome reported here is one of the more contiguous and complete genomes of a tree species published to date, with a contig N50 of ∼1.2 Mb, a scaffold N50 of ∼2.1 Mb, and a complete gene score of 95.5% through BUSCO analysis. In addition, we sequenced 11 genetically distinct individuals and mapped these onto the draft reference genome, enabling the discovery of almost 25 million single nucleotide polymorphisms and ∼4.4 million small insertions and deletions. Finally, using cobarcoded data, we were able to generate a complete haplotype coverage of all 11 genomes.

Whitebark pine (WBP, Pinus albicaulis) is a white pine of subalpine regions in the Western contiguous United States and Canada. WBP has become critically threatened throughout a significant part of its natural range due to mortality from the introduced fungal pathogen white pine blister rust (WPBR, Cronartium ribicola) and additional threats from mountain pine beetle (Dendroctonus ponderosae), wildfire, and maladaptation due to changing climate. Vast acreages of WBP have suffered nearly complete mortality. Genomic technologies can contribute to a faster, more cost-effective approach to the traditional practices of identifying disease-resistant, climate-adapted seed sources for restoration. With deep-coverage Illumina short reads of haploid megagametophyte tissue and Oxford Nanopore long reads of diploid needle tissue, followed by a hybrid, multistep assembly approach, we produced a final assembly containing 27.6 Gb of sequence in 92,740 contigs (N50 537,007 bp) and 34,716 scaffolds (N50 2.0 Gb). Approximately 87.2% (24.0 Gb) of total sequence was placed on the 12 WBP chromosomes. Annotation yielded 25,362 protein-coding genes, and over 77% of the genome was characterized as repeats. WBP has demonstrated the greatest variation in resistance to WPBR among the North American white pines. Candidate genes for quantitative resistance include disease resistance genes known as nucleotide-binding leucine-rich repeat receptors (NLRs). A combination of protein domain alignments and direct genome scanning was employed to fully describe the 3 subclasses of NLRs. Our high-quality reference sequence and annotation provide a marked improvement in NLR identification compared to previous assessments that leveraged de novo-assembled transcriptomes.

Vitamin A deficiency remains prevalent on a global scale, including in regions where maize constitutes a high percentage of human diets. One solution for alleviating this deficiency has been to increase grain concentrations of provitamin A carotenoids in maize (Zea mays ssp. mays L.)-an example of biofortification. The International Maize and Wheat Improvement Center (CIMMYT) developed a Carotenoid Association Mapping panel of 380 inbred lines adapted to tropical and subtropical environments that have varying grain concentrations of provitamin A and other health-beneficial carotenoids. Several major genes have been identified for these traits, 2 of which have particularly been leveraged in marker-assisted selection. This project assesses the predictive ability of several genomic prediction strategies for maize grain carotenoid traits within and between 4 environments in Mexico. Ridge Regression-Best Linear Unbiased Prediction, Elastic Net, and Reproducing Kernel Hilbert Spaces had high predictive abilities for all tested traits (β-carotene, β-cryptoxanthin, provitamin A, lutein, and zeaxanthin) and outperformed Least Absolute Shrinkage and Selection Operator. Furthermore, predictive abilities were higher when using genome-wide markers rather than only the markers proximal to 2 or 13 genes. These findings suggest that genomic prediction models using genome-wide markers (and assuming equal variance of marker effects) are worthwhile for these traits even though key genes have already been identified, especially if breeding for additional grain carotenoid traits alongside β-carotene. Predictive ability was maintained for all traits except lutein in between-environment prediction. The TASSEL (Trait Analysis by aSSociation, Evolution, and Linkage) Genomic Selection plugin performed as well as other more computationally intensive methods for within-environment prediction. The findings observed herein indicate the utility of genomic prediction methods for these traits and could inform their resource-efficient implementation in biofortification breeding programs.

Zygnematophyceae are the algal sisters of land plants. Here we sequenced four genomes of filamentous Zygnematophyceae, including chromosome-scale assemblies for three strains of Zygnema circumcarinatum. We inferred traits in the ancestor of Zygnematophyceae and land plants that might have ushered in the conquest of land by plants: expanded genes for signaling cascades, environmental response, and multicellular growth. Zygnematophyceae and land plants share all the major enzymes for cell wall synthesis and remodifications, and gene gains shaped this toolkit. Co-expression network analyses uncover gene cohorts that unite environmental signaling with multicellular developmental programs. Our data shed light on a molecular chassis that balances environmental response and growth modulation across more than 600 million years of streptophyte evolution.

Plants rely on Nucleotide-binding, Leucine-rich repeat Receptors (NLRs) for pathogen recognition. Highly variable NLRs (hvNLRs) show remarkable intraspecies diversity, while their low-variability paralogs (non-hvNLRs) are conserved between ecotypes. At a population level, hvNLRs provide new pathogen-recognition specificities, but the association between allelic diversity and genomic and epigenomic features has not been established. Our investigation of NLRs in Arabidopsis Col-0 has revealed that hvNLRs show higher expression, less gene body cytosine methylation, and closer proximity to transposable elements than non-hvNLRs. hvNLRs show elevated synonymous and nonsynonymous nucleotide diversity and are in chromatin states associated with an increased probability of mutation. Diversifying selection maintains variability at a subset of codons of hvNLRs, while purifying selection maintains conservation at non-hvNLRs. How these features are established and maintained, and whether they contribute to the observed diversity of hvNLRs is key to understanding the evolution of plant innate immune receptors.

Tremendous plant metabolic diversity arises from phylogenetically restricted specialized metabolic pathways. Specialized metabolites are synthesized in dedicated cells or tissues, with pathway genes sometimes colocalizing in biosynthetic gene clusters (BGCs). However, the mechanisms by which spatial expression patterns arise and the role of BGCs in pathway evolution remain underappreciated. In this study, we investigated the mechanisms driving acylsugar evolution in the Solanaceae. Previously thought to be restricted to glandular trichomes, acylsugars were recently found in cultivated tomato roots. We demonstrated that acylsugars in cultivated tomato roots and trichomes have different sugar cores, identified root-enriched paralogs of trichome acylsugar pathway genes, and characterized a key paralog required for root acylsugar biosynthesis, SlASAT1-LIKE (SlASAT1-L), which is nested within a previously reported trichome acylsugar BGC. Last, we provided evidence that ASAT1-L arose through duplication of its paralog, ASAT1, and was trichome-expressed before acquiring root-specific expression in the Solanum genus. Our results illuminate the genomic context and molecular mechanisms underpinning metabolic diversity in plants.

Photoactivation of the plant photoreceptor and thermosensor phytochrome B (PHYB) triggers its condensation into subnuclear membraneless organelles named photobodies (PBs). However, the function of PBs in PHYB signaling remains frustratingly elusive. Here, we found that PHYB recruits PHYTOCHROME-INTERACTING FACTOR 5 (PIF5) to PBs. Surprisingly, PHYB exerts opposing roles in degrading and stabilizing PIF5. Perturbing PB size by overproducing PHYB provoked a biphasic PIF5 response: while a moderate increase in PHYB enhanced PIF5 degradation, further elevating the PHYB level stabilized PIF5 by retaining more of it in enlarged PBs. Conversely, reducing PB size by dim light, which enhanced PB dynamics and nucleoplasmic PHYB and PIF5, switched the balance towards PIF5 degradation. Together, these results reveal that PB formation spatially segregates two antagonistic PHYB signaling actions - PIF5 stabilization in PBs and PIF5 degradation in the surrounding nucleoplasm - which could enable an environmentally sensitive, counterbalancing mechanism to titrate nucleoplasmic PIF5 and environmental responses.

Sugarcane, the world's most harvested crop by tonnage, has shaped global history, trade and geopolitics, and is currently responsible for 80% of sugar production worldwide1. While traditional sugarcane breeding methods have effectively generated cultivars adapted to new environments and pathogens, sugar yield improvements have recently plateaued2. The cessation of yield gains may be due to limited genetic diversity within breeding populations, long breeding cycles and the complexity of its genome, the latter preventing breeders from taking advantage of the recent explosion of whole-genome sequencing that has benefited many other crops. Thus, modern sugarcane hybrids are the last remaining major crop without a reference-quality genome. Here we take a major step towards advancing sugarcane biotechnology by generating a polyploid reference genome for R570, a typical modern cultivar derived from interspecific hybridization between the domesticated species (Saccharum officinarum) and the wild species (Saccharum spontaneum). In contrast to the existing single haplotype ('monoploid') representation of R570, our 8.7 billion base assembly contains a complete representation of unique DNA sequences across the approximately 12 chromosome copies in this polyploid genome. Using this highly contiguous genome assembly, we filled a previously unsized gap within an R570 physical genetic map to describe the likely causal genes underlying the single-copy Bru1 brown rust resistance locus. This polyploid genome assembly with fine-grain descriptions of genome architecture and molecular targets for biotechnology will help accelerate molecular and transgenic breeding and adaptation of sugarcane to future environmental conditions.

Plants shed organs such as leaves, petals, or fruits through the process of abscission. Monitoring cues such as age, resource availability, and biotic and abiotic stresses allow plants to abscise organs in a timely manner. How these signals are integrated into the molecular pathways that drive abscission is largely unknown. The INFLORESCENCE DEFICIENT IN ABSCISSION (IDA) gene is one of the main drivers of floral organ abscission in Arabidopsis and is known to transcriptionally respond to most abscission-regulating cues. By interrogating the IDA promoter in silico and in vitro, we identified transcription factors that could potentially modulate IDA expression. We probed the importance of ERF- and WRKY-binding sites for IDA expression during floral organ abscission, with WRKYs being of special relevance to mediate IDA up-regulation in response to biotic stress in tissues destined for separation. We further characterized WRKY57 as a positive regulator of IDA and IDA-like gene expression in abscission zones. Our findings highlight the promise of promoter element-targeted approaches to modulate the responsiveness of the IDA signaling pathway to harness controlled abscission timing for improved crop productivity.

BACKGROUND: Sulfur (S) is a mineral nutrient essential for plant growth and development, which is incorporated into diverse molecules fundamental for primary and secondary metabolism, plant defense, signaling, and maintaining cellular homeostasis. Although, S starvation response is well documented in the dicot model Arabidopsis thaliana, it is not clear if the same transcriptional networks control the response also in the monocots. RESULTS: We performed series of physiological, expression, and metabolite analyses in two model monocot species, one representing the C3 plants, Oryza sativa cv. kitaake, and second representing the C4 plants, Setaria viridis. Our comprehensive transcriptomic analysis revealed twice as many differentially expressed genes (DEGs) in S. viridis than in O. sativa under S-deficiency, consistent with a greater loss of sulfur and S-containing metabolites under these conditions. Surprisingly, most of the DEGs and enriched gene ontology terms were species-specific, with an intersect of only 58 common DEGs. The transcriptional networks were different in roots and shoots of both species, in particular no genes were down-regulated by S-deficiency in the roots of both species. CONCLUSIONS: Our analysis shows that S-deficiency seems to have different physiological consequences in the two monocot species and their nutrient homeostasis might be under distinct control mechanisms.

Biological nitrogen fixation by free-living bacteria and rhizobial symbiosis with legumes plays a key role in sustainable crop production. Here, we study how different crop combinations influence the interaction between peanut plants and their rhizosphere microbiota via metabolite deposition and functional responses of free-living and symbiotic nitrogen-fixing bacteria. Based on a long-term (8 year) diversified cropping field experiment, we find that peanut co-cultured with maize and oilseed rape lead to specific changes in peanut rhizosphere metabolite profiles and bacterial functions and nodulation. Flavonoids and coumarins accumulate due to the activation of phenylpropanoid biosynthesis pathways in peanuts. These changes enhance the growth and nitrogen fixation activity of free-living bacterial isolates, and root nodulation by symbiotic Bradyrhizobium isolates. Peanut plant root metabolites interact with Bradyrhizobium isolates contributing to initiate nodulation. Our findings demonstrate that tailored intercropping could be used to improve soil nitrogen availability through changes in the rhizosphere microbiome and its functions.

Duckweeds are among the fastest reproducing plants, able to clonally divide at exponential rates. However, the genetic and epigenetic impact of clonality on plant genomes is poorly understood. 5-methylcytosine (5mC) is a modified base often described as necessary for the proper regulation of certain genes and transposons and for the maintenance of genome integrity in plants. However, the extent of this dogma is limited by the current phylogenetic sampling of land plant species diversity. Here we analyzed DNA methylomes, small RNAs, mRNA-seq, and H3K9me2 histone modification for Spirodela polyrhiza. S. polyrhiza has lost highly conserved genes involved in de novo methylation of DNA at sites often associated with repetitive DNA, and within genes, however, symmetrical DNA methylation and heterochromatin are maintained during cell division at certain transposons and repeats. Consequently, small RNAs that normally guide methylation to silence repetitive DNA like retrotransposons are diminished. Despite the loss of a highly conserved methylation pathway, and the reduction of small RNAs that normally target repetitive DNA, transposons have not proliferated in the genome, perhaps due in part to the rapid, clonal growth lifestyle of duckweeds.

Long terminal repeat retrotransposons (LTR-RTs) are powerful mutagens regarded as a major source of genetic novelty and important drivers of evolution. Yet, the uncontrolled and potentially selfish proliferation of LTR-RTs can lead to deleterious mutations and genome instability, with large fitness costs for their host. While population genomics data suggest that an ongoing LTR-RT mobility is common in many species, the understanding of their dual role in evolution is limited. Here, we harness the genetic diversity of 320 sequenced natural accessions of the Mediterranean grass Brachypodium distachyon to characterize how genetic and environmental factors influence plant LTR-RT dynamics in the wild. When combining a coverage-based approach to estimate global LTR-RT copy number variations with mobilome-sequencing of nine accessions exposed to eight different stresses, we find little evidence for a major role of environmental factors in LTR-RT accumulations in B. distachyon natural accessions. Instead, we show that loss of RNA polymerase IV (Pol IV), which mediates RNA-directed DNA methylation in plants, results in high transcriptional and transpositional activities of RLC_BdisC024 (HOPPLA) LTR-RT family elements, and that these effects are not stress-specific. This work supports findings indicating an ongoing mobility in B. distachyon and reveals that host RNA-directed DNA methylation rather than environmental factors controls their mobility in this wild grass model.

Mutant populations are crucial for functional genomics and discovering novel traits for crop breeding. Sorghum, a drought and heat-tolerant C4 species, requires a vast, large-scale, annotated, and sequenced mutant resource to enhance crop improvement through functional genomics research. Here, we report a sorghum large-scale sequenced mutant population with 9.5 million ethyl methane sulfonate (EMS)-induced mutations that covered 98% of sorghum's annotated genes using inbred line BTx623. Remarkably, a total of 610 320 mutations within the promoter and enhancer regions of 18 000 and 11 790 genes, respectively, can be leveraged for novel research of cis-regulatory elements. A comparison of the distribution of mutations in the large-scale mutant library and sorghum association panel (SAP) provides insights into the influence of selection. EMS-induced mutations appeared to be random across different regions of the genome without significant enrichment in different sections of a gene, including the 5' UTR, gene body, and 3'-UTR. In contrast, there were low variation density in the coding and UTR regions in the SAP. Based on the Ka /Ks value, the mutant library (~1) experienced little selection, unlike the SAP (0.40), which has been strongly selected through breeding. All mutation data are publicly searchable through SorbMutDB (https://www.depts.ttu.edu/igcast/sorbmutdb.php) and SorghumBase (https://sorghumbase.org/). This current large-scale sequence-indexed sorghum mutant population is a crucial resource that enriched the sorghum gene pool with novel diversity and a highly valuable tool for the Poaceae family, that will advance plant biology research and crop breeding.

Cowpea, Vigna unguiculata L. Walp., is a diploid warm-season legume of critical importance as both food and fodder in sub-Saharan Africa. This species is also grown in Northern Africa, Europe, Latin America, North America, and East to Southeast Asia. To capture the genomic diversity of domesticates of this important legume, de novo genome assemblies were produced for representatives of six subpopulations of cultivated cowpea identified previously from genotyping of several hundred diverse accessions. In the most complete assembly (IT97K-499-35), 26,026 core and 4963 noncore genes were identified, with 35,436 pan genes when considering all seven accessions. GO terms associated with response to stress and defense response were highly enriched among the noncore genes, while core genes were enriched in terms related to transcription factor activity, and transport and metabolic processes. Over 5 million single nucleotide polymorphisms (SNPs) relative to each assembly and over 40 structural variants >1 Mb in size were identified by comparing genomes. Vu10 was the chromosome with the highest frequency of SNPs, and Vu04 had the most structural variants. Noncore genes harbor a larger proportion of potentially disruptive variants than core genes, including missense, stop gain, and frameshift mutations; this suggests that noncore genes substantially contribute to diversity within domesticated cowpea.

Homosporous lycophytes (Lycopodiaceae) are a deeply diverged lineage in the plant tree of life, having split from heterosporous lycophytes (Selaginella and Isoetes) ~400 Mya. Compared to the heterosporous lineage, Lycopodiaceae has markedly larger genome sizes and remains the last major plant clade for which no chromosome-level assembly has been available. Here, we present chromosomal genome assemblies for two homosporous lycophyte species, the allotetraploid Huperzia asiatica and the diploid Diphasiastrum complanatum. Remarkably, despite that the two species diverged ~350 Mya, around 30% of the genes are still in syntenic blocks. Furthermore, both genomes had undergone independent whole genome duplications, and the resulting intragenomic syntenies have likewise been preserved relatively well. Such slow genome evolution over deep time is in stark contrast to heterosporous lycophytes and is correlated with a decelerated rate of nucleotide substitution. Together, the genomes of H. asiatica and D. complanatum not only fill a crucial gap in the plant genomic landscape but also highlight a potentially meaningful genomic contrast between homosporous and heterosporous species.

Plant root-nodule symbiosis (RNS) with mutualistic nitrogen-fixing bacteria is restricted to a single clade of angiosperms, the Nitrogen-Fixing Nodulation Clade (NFNC), and is best understood in the legume family. Nodulating species share many commonalities, explained either by divergence from a common ancestor over 100 million years ago or by convergence following independent origins over that same time period. Regardless, comparative analyses of diverse nodulation syndromes can provide insights into constraints on nodulation-what must be acquired or cannot be lost for a functional symbiosis-and the latitude for variation in the symbiosis. However, much remains to be learned about nodulation, especially outside of legumes. Here, we employed a large-scale phylogenomic analysis across 88 species, complemented by 151 RNA-seq libraries, to elucidate the evolution of RNS. Our phylogenomic analyses further emphasize the uniqueness of the transcription factor NIN as a master regulator of nodulation and identify key mutations that affect its function across the NFNC. Comparative transcriptomic assessment revealed nodule-specific upregulated genes across diverse nodulating plants, while also identifying nodule-specific and nitrogen-response genes. Approximately 70% of symbiosis-related genes are highly conserved in the four representative species, whereas defense-related and host-range restriction genes tend to be lineage specific. Our study also identified over 900 000 conserved non-coding elements (CNEs), over 300 000 of which are unique to sampled NFNC species. NFNC-specific CNEs are enriched with the active H3K9ac mark and are correlated with accessible chromatin regions, thus representing a pool of candidate regulatory elements for genes involved in RNS. Collectively, our results provide novel insights into the evolution of nodulation and lay a foundation for engineering of RNS traits in agriculturally important crops.

The cytoplasm of Aegilops kotschyi is known for the induction of male sterility and haploidy in wheat. Both systems originally appeared rather simple, but manipulation of the standard chromosome constitution of the nuclear genome revealed additional interactions. This study shows that while there is little or no allelic variation at the main fertility restorer locus Rfmulti on chromosome arm 1BS, additional genes may also be involved in the nuclear-mitochondrial genome interactions, affecting not only male fertility but also the growth rate, from pollen competition for fertilization and early endosperm divisions all the way to seed size and plant maturity. Some of these effects appear to be of a sporophytic nature; others are gametophytic. Induction of parthenogenesis by a rye inducer in conjunction with the Ae. kotschyi cytoplasm is well known. However, here we show that the cytoplasmic-nuclear interactions affect all aspects of double fertilization: producing maternal haploids from unfertilized eggs, diploids from fertilized eggs or synergids, embryo-less kernels, and fertilized eggs without fertilization of the double nucleus in the embryo sack. It is unclear how frequent the inducers of parthenogenesis are, as variation, if any, is obscured by suppressors present in the wheat genome. Genetic dissection of a single wheat accession revealed five distinct loci affecting the rate of maternal haploid production: four acting as suppressors and one as an enhancer. Only when the suppressing haplotypes are confirmed may it be possible to the identify genetic variation of haploidy inducers, map their position(s), and determine their nature and the mode of action.

UNLABELLED: Invasive plants along transportation corridors can significantly threaten ecosystems and biodiversity if they spread beyond anthropogenic environments. Rapid evolution may increase the ability of invading plant populations to establish in resident plant communities over time, posing a challenge to invasion risk assessment. We tested for adaptive differentiation in Dittrichia graveolens (stinkwort), an invasive species of ruderal habitat in California that is increasingly spreading away from roadsides into more established vegetation. We collected seeds from eight pairs of vegetated sites and their nearest (presumed progenitor) roadside population. We assessed differentiation between populations in roadside and vegetated habitat for germination behavior and for response to competition in a greenhouse experiment. We also tested for increased performance in vegetated habitat with a grassland field experiment including a neighbor removal treatment. Germination rates were slightly reduced in seeds from vegetated sites, which may indicate lower seed viability. Otherwise, plants did not show consistent differences between the two habitat types. Competition strongly reduced performance of D. graveolens in both the greenhouse and in the field, but plants originating from vegetated sites did not show enhanced competitive ability. Our findings show no evidence of adaptive differentiation between D. graveolens populations from roadside and vegetated habitats to date, suggesting that invasiveness in grasslands has not been enhanced by rapid evolution in the 40 + years since this species was introduced to California. Evolutionary constraints or potentially high levels of gene flow at this small scale may limit adaptation to novel habitats along roadsides. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s10530-024-03359-6.

Wheat (Triticum aestivum) is one of the most important food crops with an urgent need for increase in its production to feed the growing world. Triticum timopheevii (2n = 4x = 28) is an allotetraploid wheat wild relative species containing the At and G genomes that has been exploited in many pre-breeding programmes for wheat improvement. In this study, we report the generation of a chromosome-scale reference genome assembly of T. timopheevii accession PI 94760 based on PacBio HiFi reads and chromosome conformation capture (Hi-C). The assembly comprised a total size of 9.35 Gb, featuring a contig N50 of 42.4 Mb and included the mitochondrial and plastid genome sequences. Genome annotation predicted 166,325 gene models including 70,365 genes with high confidence. DNA methylation analysis showed that the G genome had on average more methylated bases than the At genome. In summary, the T. timopheevii genome assembly provides a valuable resource for genome-informed discovery of agronomically important genes for food security.

Gene cloning in repeat-rich polyploid genomes remains challenging. Here, we describe a strategy for overcoming major bottlenecks in cloning of the powdery mildew resistance gene (R-gene) Pm69 derived from tetraploid wild emmer wheat. A conventional positional cloning approach was not effective owing to suppressed recombination. Chromosome sorting was compromised by insufficient purity. A Pm69 physical map, constructed by assembling Oxford Nanopore Technology (ONT) long-read genome sequences, revealed a rapidly evolving nucleotide-binding leucine-rich repeat (NLR) R-gene cluster with structural variations. A single candidate NLR was identified by anchoring RNA sequencing reads from susceptible mutants to ONT contigs and was validated by virus-induced gene silencing. Pm69 is likely a newly evolved NLR and was discovered in only one location across the wild emmer wheat distribution range in Israel. Pm69 was successfully introgressed into cultivated wheat, and a diagnostic molecular marker was used to accelerate its deployment and pyramiding with other R-genes.

Over the course of evolution, land plant mitochondrial genomes have lost many transfer RNA (tRNA) genes and the import of nucleus-encoded tRNAs is essential for mitochondrial protein synthesis. By contrast, plastidial genomes of photosynthetic land plants generally possess a complete set of tRNA genes and the existence of plastidial tRNA import remains a long-standing question. The early vascular plants of the Selaginella genus show an extensive loss of plastidial tRNA genes while retaining photosynthetic capacity, and represent an ideal model for answering this question. Using purification, northern blot hybridization, and high-throughput tRNA sequencing, a global analysis of total and plastidial tRNA populations was undertaken in Selaginella kraussiana. We confirmed the expression of all plastidial tRNA genes and, conversely, observed that nucleus-encoded tRNAs corresponding to these plastidial tRNAs were generally excluded from the chloroplasts. We then demonstrated a selective and differential plastidial import of around forty nucleus-encoded tRNA species, likely compensating for the insufficient coding capacity of plastidial-encoded tRNAs. In-depth analysis revealed differential import of tRNA isodecoders, leading to the identification of specific situations. This includes the expression and import of nucleus-encoded tRNAs expressed from plastidial or bacterial-like genes inserted into the nuclear genome. Overall, our results confirm the existence of molecular processes that enable tRNAs to be selectively imported not only into mitochondria, as previously described, but also into chloroplasts, when necessary. [ABSTRACT FROM AUTHOR]

We have demonstrated high-speed, super-resolution infrared (IR) spectroscopy and chemical imaging of autofluorescent biomaterials and organisms using camera-based widefield photothermal detection that takes advantage of temperature-dependent modulations of autofluorescent emission. A variety of biological materials and photosynthetic organisms exhibit strong autofluorescence emission under ultraviolet excitation and the autofluorescent emission has a very strong temperature dependence, of order 1%/K. Illuminating a sample with pulses of IR light from a wavelength-tunable laser source causes periodic localized sample temperature increases that result in a corresponding transient decrease in autofluorescent emission. A low-cost light-emitting diode-based fluorescence excitation source was used in combination with a conventional fluorescence microscopy camera to detect localized variations in autofluorescent emission over a wide area as an indicator of localized IR absorption. IR absorption image stacks were acquired over a range of IR wavelengths, including the fingerprint spectral range, enabling extraction of localized IR absorption spectra. We have applied widefield fluorescence detected photothermal IR (FL-PTIR) to an analysis of autofluorescent biological materials including collagen, leaf tissue, and photosynthetic organisms including diatoms and green microalgae cells. We have also demonstrated the FL-PTIR on live microalgae in water, demonstrating the potential for label-free dynamic chemical imaging of autofluorescent cells. [ABSTRACT FROM AUTHOR]

Plant-based biotechnology is crucial for developing renewable biofuels, enhancing bioremediation, and improving the food supply chain. Modern agricultural technologies often face limitations due to variable weather conditions and significant infrastructure costs. Addressing these challenges, smaller-scale biotechnologies optimize plant production through controlled lighting and nutrient supply, mitigating the impact of adverse weather. In vitro technologies are particularly effective for promoting plant growth with desirable phenotypic traits under controlled conditions, though they bring challenges related to sustainability and costs. Recent innovations in microfabrication have led to the miniaturization of traditional in vitro technologies, significantly reducing both sample volumes and costs. This review explores the advancements in microfluidic systems for plant studies, covering a range from single plant cells to mature plants, and discusses the common materials and integrated technologies employed in microfabrication for in-depth in vitro studies. • Small-scale biotechnologies address agricultural problems. • Single-plant cell positioning and observation are possible with microfluidics. • Miniaturized Optimized in vitro conditions improve plant development. • Advanced miniaturized in vitro technology reduced sample volume and cost. • Plant research uses microfluidics for macro and micro inspection. [ABSTRACT FROM AUTHOR]

Uridine diphosphate-glucose (UDP-Glc) plays a pivotal role as an essential precursor in cytoplasmic sucrose biosynthesis and provides Glc as a critical building block for synthesizing various macromolecules such as polysaccharides, proteins, and lipids through glycosylation reactions. These include the synthesis of cellulose, hemicellulose, and cell wall polysaccharides. Moreover, UDP-Glc acts as a signaling molecule implicated in both biotic and abiotic stress responses by triggering the MAP kinase cascade and ROS signaling pathways. The synthesis of UDP-Glc in plants is primarily catalyzed by the UDP-Glc pyrophosphorylase (UGPase) enzyme, exhibiting tissue-specific variations in catalytic direction. In source tissues such as leaves, UGPase uses Glucose-1-phosphate (Glc-1-P) and UTP as substrates to produce UDP-Glc and PPi. In non-photosynthetic sink tissues, UGPase catalyzes a pyrophospholytic reaction on UDP-Glc to Glc-1-P for the demand of metabolic processes. Plants possess two distinct types of UGPases, UGPase-A and UGPase-B. The former has an approximate molecular weight of 50-55 kDa and predominantly localizes within the cytoplasm, while the latter weighs around 90 kDa and resides within chloroplasts. UGPase exists in both monocotyledonous and dicotyledonous plants, functioning as monomers when active. The UGPase gene family in plants typically consists of a number of two or three genes, encoding two types of UGPases. Deficiency in UGPase leads to growth inhibition, developmental constraints, reduced levels of soluble sugars and starch, impaired callose deposition in pollen resulting in male sterility, and compromised cell wall integrity. Conversely, overexpression of the UGPase gene promotes accelerated growth rate, increased plant height, significantly elevated levels of soluble sugars and cellulose content, as well as enhanced stress tolerance. Consequently, UGPase emerges as a promising candidate gene for agricultural improvement. [ABSTRACT FROM AUTHOR]

Quantum dots (QDs), also known as nanoparticle-based fluorescent probes, are luminescent semiconductor particles with a size range of 2-20 nm. The unique optical and electronic capabilities of QDs have led to expanded applications in several fields such as optoelectronics, transistors, sensors, photodetection, catalysis, and medicine. The distinct quantum effects of nanocrystals can be controlled by changing their sizes and shapes using a variety of top-down and bottom-up tactics. QDs were traditionally fabricated using complex, expensive, toxic, and aggressive chemical techniques, which limited their application in a variety of disciplines. A unique approach for the biosynthesis of nanomaterials has been devised, which employs living organisms in the synthesis process and adheres to green chemistry principles. Biogenic QDs have favorable physicochemical features, biocompatibility, and fewer cytotoxic effects as a result of using natural biomolecules and enzymatic processes for mineralization, detoxification, and nucleation of metals and nonmetals to synthesize QDs. This is the first comprehensive review of its kind that highlights the synthesis of several doped and undoped QDs, including graphene QDs, carbon dots, silicon QDs, N/S-CDs, silver-CDs, cadmium-selenium QDs, and zinc oxide QDs, exclusively using photoautotrophic algae and plants. The different plausible mechanisms behind phyco- and phyto-fabrication of QDs are also discussed in detail along with their applications that include detection of organic and inorganic compounds, degradation of hazardous dyes, free radical scavenging, antimicrobial activity, cytotoxicity and bioimaging. Thus, this review aims to give valuable insights for the rational fabrication of photoluminescent nanomaterials with tunable structural and functional properties. [ABSTRACT FROM AUTHOR]

Pesticides constitute a major threat to biodiversity, but our understanding of the complex interactions between local and landscape factors influencing their distribution in agroecosystems remains limited. We conducted a pioneering study where we screened spiders, rodents, plants and soils for multiple pesticide residues in perennial crops (orchards and vineyards) managed under organic (N = 8) and integrated pest management (N = 8) systems. We then quantified the proportional representation of major habitat types in surrounding landscapes. Additionally, we conducted interviews with farmers to gain precise insights into pesticide applications. We expected that landscape factors would be more important for mobile entities (i.e. spiders and rodents), while management type would be relatively more important for the sedentary entities (i.e. soils and plants). We detected various pesticides within studied crop types, including several forbidden in the European Union. We found that pesticide distribution in spiders was influenced by the proportion of semi‐natural habitats in the landscape, with pesticide concentration decreasing as the proportion of semi‐natural habitats increased. Additionally, we observed that the spectrum of pesticides in spiders increased with the dominance of web‐building spiders. In contrast, pesticide levels in rodents were not affected by either landscape composition or local management type. For plants, pesticide distribution was affected by the proportion of forests and shrublands and, to some extent, by local management practices. In the case of soil, pesticide distribution was primarily determined by local management. This study marks an effort in demonstrating that both local and landscape factors play crucial roles in shaping pesticide distribution within perennial crops. Importantly, the relative importance of these factors varied across the four matrices investigated. Synthesis and applications: To comprehend the factors that determine pesticide distribution in crops, it is crucial to monitor diverse ecosystem components rather than focusing on a few model species. This approach underscores the necessity for ecologically sensitive management at landscape scale. Such management should involve the preservation and enhancement of (semi)natural habitats around crops. These combined insights can form the foundation for conservation and management initiatives aimed at mitigating the impact of pesticides on biodiversity within crops. [ABSTRACT FROM AUTHOR]

The presence of pollutants in water sources, particularly dyes coming by way of the textile industry, represents a major challenge with far-reaching environmental consequences, including increased scarcity. This phenomenon endangers the health of living organisms and the natural system. Numerous biosorbents have been utilized for the removal of dyes from the textile industry. The aim of this study was to optimize discarded Zygophyllum gaetulum stems as constituting an untreated natural biosorbent for the efficient removal of C.I. Direct Black 80, an azo textile dye, from an aqueous solution, thus offering an ecological and low-cost alternative while recovering the waste for reuse. The biosorbent was subjected to a series of characterization analyses: scanning electron microscopy (SEM), thermogravimetric analysis (TGA), Brunauer–Emmett–Teller (BET) method, X-ray diffraction (XRD), and infrared spectroscopy (IR) were employed to characterize the biosorbent. Additionally, the moisture and ash content of the plant stem were also examined. The absorption phenomenon was studied for several different parameters including the effect of the absorption time (0 to 360 min), the sorbent mass (3 to 40 g/L), the pH of the solution (3 to 11), the dye concentration (5 to 300 mg/L), and the pH of the zero-charge point (2–12). Thermodynamic studies and desorption studies were also carried out. The results showed that an increase in plant mass from 3 to 40 g/L resulted in a notable enhancement in dye adsorption rates, with an observed rise from 63.96% to 97.08%. The pH at the zero-charge point (pHpzc) was determined to be 7.12. The percentage of dye removal was found to be highest for pH values ≤ 7, with a subsequent decline in removal efficiency as the pH increased. Following an initial increase in the amount of adsorbed dye, equilibrium was reached within 2 h of contact. The kinetic parameters of adsorption were investigated using the pseudo-first-order, pseudo-second-order and Elovich models. The results indicated that the pseudo-first-order kinetic model was the most appropriate for the plant adsorbent. The isotherm parameters were determined using the Langmuir, Frendlich, Temkin, and Dubinin–Radushkevich models. The experimental data were more satisfactory and better fitted using the Langmuir model for the adsorption of dye on the plant. This study demonstrated that Zygophyllum gaetulum stems could be employed as an effective adsorbent for the removal of our organic dye from an aqueous solution. [ABSTRACT FROM AUTHOR]

Background: Superoxide dismutase (SOD) is an essential enzyme that protects cells from oxidative stress and maintains redox balance. Many studies have explored the role of SOD in various genotypes of algae and plants, but a comprehensive review of the current literature is still lacking. Aims: This review investigates the different SOD isoforms and their roles in adapting and surviving under stressful environmental conditions. We focus on two model organisms: the higher plant Arabidopsis and the unicellular green alga Chlamydomonas. We show that different plant and algal genotypes have unique SOD classes with different metal cofactors, such as Cu/Zn, Mn, and Fe, that help them deal with specific stress conditions. The activity of each SOD class depends on the availability of these metals in the cells. Moreover, we discuss how alternative splicing, RNA-binding proteins, microRNAs, and DNA methylation can influence the expression of SOD genes and highlight the gaps in our knowledge of their mechanisms. Conclusions: We suggest that future studies should explore the genes related to Ni-SOD, examine their potential transfer into algae and legumes, and consider the consequences of SOD overactivity in plant cells. [ABSTRACT FROM AUTHOR]

The alternative splicing of pre-mRNA generates distinct mRNA variants from a pre-mRNA, thereby modulating a gene's function. The splicing of pre-mRNA depends on splice sites and regulatory elements in pre-mRNA, as well as the snRNA and proteins that recognize these sequences. Among these, RNA-binding proteins (RBPs) are the primary regulators of pre-mRNA splicing and play a critical role in the regulation of alternative splicing by recognizing the elements in pre-mRNA. However, little is known about the function of RBPs in stress response in plants. Here, we summarized the RBPs involved in the alternative splicing of pre-mRNA and their recognizing elements in pre-mRNA, and the recent advance in the role of RBP-mediated alternative splicing in response to abiotic stresses in plants. This review proposes that the regulation of pre-mRNA alternative splicing by RBPs is an important way for plants to adapt to abiotic stresses, and the regulation of alternative splicing by RBPs is a promising direction for crop breeding. [ABSTRACT FROM AUTHOR]

Plant U-box genes play an important role in the regulation of plant hormone signal transduction, stress tolerance, and pathogen resistance; however, their functions in coffee (Coffea canephora L.) remain largely unexplored. In this study, we identified 47 CcPUB genes in the C. canephora L. genome, clustering them into nine groups via phylogenetic tree. The CcPUB genes were unevenly distributed across the 11 chromosomes of C. canephora L., with the majority (11) on chromosome 2 and none on chromosome 8. The cis-acting elements analysis showed that CcPUB genes were involved in abiotic and biotic stresses, phytohormone responsive, and plant growth and development. RNA-seq data revealed diverse expression patterns of CcPUB genes across leaves, stems, and fruits tissues. qRT-PCR analyses under dehydration, low temperature, SA, and Colletotrichum stresses showed significant up-regulation of CcPUB2, CcPUB24, CcPUB34, and CcPUB40 in leaves. Furthermore, subcellular localization showed CcPUB2 and CcPUB34 were located in the plasma membrane and nucleus, and CcPUB24 and CcPUB40 were located in the nucleus. This study provides valuable insights into the roles of PUB genes in stress responses and phytohormone signaling in C. canephora L., and provided basis for functional characterization of PUB genes in C. canephora L. [ABSTRACT FROM AUTHOR]

Chronic phalaris toxicity (CPT) is a neurological disease caused by animals ingesting toxins produced by early growth stages of Phalaris aquatica, a pasture plant introduced to the southeastern regions of Australia post colonization. Little is known about the clinical progression of CPT in wildlife, as incidents are sporadic and predominantly reported when animals are in the end stages of disease and in a poor welfare state. We studied a cohort of 35 eastern gray kangaroos (Macropus giganteus) affected by CPT to clarify clinical prognosis and survival rates. Kangaroos were captured in May, June, and July of 2022 at Plenty Gorge Parklands, Victoria, Australia. Each animal was radiotracked for 180 d, clinical progression and disease outcomes monitored twice a week. By the conclusion of the study, 24 animals had died (19 by euthanasia due to deterioration, five found dead). Ten animals survived, with two demonstrating a reduction in clinical signs and eight showing full resolution of clinical signs. One animal was disqualified from the study. The overall survival rate was 29.4% (95% confidence interval 17.5–49.5%). The survival duration of animals that died ranged from 5 to 133 d. There was no difference in survival rate based on sex (P¼0.2), age class (P¼0.49) or the month of capture (P¼0.49). These results suggest that CPT is an important health and welfare concern for at- risk macropod populations, with high case-fatality rates and prolonged clinical durations. Further research to manage the disease via methods such as reducing Phalaris aquatica plant coverage and preventative treatments for animals is warranted to reduce disease incidences and improve disease outcomes in wildlife populations. [ABSTRACT FROM AUTHOR]