Search

Physalis angulata L. berries are green in the initial stage of maturity and turn yellow when fully mature due to an increase in carotenoids. However, the coloration of the epidermis of the berry should not be the reference for harvesting maturity, since the calyx is fully closed. The use of an edible chitosan coating delays the color changes in the berry by reducing the respiration rate. This work studies the effect of harvest maturity and chitosan on the shelf life and berry coloring in Physalis angulata L. Three factors were considered, being harvest maturity stage (green mature (GM), yellowish-green (YG) and yellow (Y)), chitosan coating (0, 0.5, and 1%), and storage time (10, 20, 30 days). The fruits were stored at 20 °C and 85% Rh. The results showed that on the harvesting stage, chitosan coating had a significant effect on the quality and shelf life of berries during storage time. The value of carotenoid and phenol contents, flavor index, chroma, and hue significantly increased with berry maturity. Chitosan delayed the decrease in chlorophyll, phenol contents, antioxidant capacity, berry maturity, and color change. The results show that in the berries coated with 1% chitosan during storage, changes in color were less in comparison with the control condition (no chitosan). The highest decrease of hue angle and color index (17.92°) was observed in the control. The highest total antioxidant (78.42%) was observed after 30 days of storage in MG berries treated with a 0.5% chitosan coating. [ABSTRACT FROM AUTHOR]

An efficient protocol to standardize the multiple shoot induction of plantlets from nodal explants of Physalis angulata L. using MS basal media with the combination of Cytokinin and auxin was studied in this research. Physalis angulata is a cosmopolitan plant found in tropical and sub tropical regions of the world. The plant has wide range of therapeutic abilities in fields like ethnobotany, phytochemistry, pharmacology, antimicrobial, anti-inflammatory, antioxidant, immunoregulatory, anti-diabetic, anticancerous and antilipidiamic function especially the compound Physalin. For large scale production and extraction of these functional compounds from the plant, a conservational technique namely plant tissue culture was employed in this study, where, node from elite mother plant is taken and inoculated in the MS medium supplemented with combinations of cytokinin (BAP+KIN) and auxin (NAA+IAA) in various range of concentration was used. The aseptic condition was maintained and data's were analysed by ANOVA. From the result it was observed that highest concentration provided best result of number and length of shoots and roots. From this study, it is evident that plant tissue culture plays a role in not only conservation of RET plants but also common plants and weeds with therapeutic ability that could be accessed for large scale production and also compound elucidation. [ABSTRACT FROM AUTHOR]

Background/Introduction: Since the start of civilization, human culture has used plants to treat illnesses. Many plant samples have been adulterated intentionally or unintentionally during processing or even misidentified during collection. This study aims at authenticating and standardizing of Physalis angulata by carrying out Pharmacognostic evaluation, HPLC and GCMS analysis. Methodology: The dried leaves of Physalis angulata was extracted with 70% ethanol. Phytochemical screening (qualitative and quantitative screening) analysis was carried out on the ethanolic leave extract using standard method, while the chemical compounds were established with HPLC-DAD and GCMS and Pharmacognostic evaluation was carried out on the powdered leave. Results and discussion: Qualitative phytochemical analysis of the leave extract reveals the presence of flavonoids, terpenes, alkaloid, tannins and saponin while carbohydrate, glycosides and resins were absent. Quantitative phytochemical screening shows alkaloid present to be 2.4±0.4% and saponin 2±1.32%. HPLC analysis reveals the presence of quercetin, rutin, catechin and ferulic acid while GCMS reveals the presence of cyclohexene, Palmitic acid, 17-Octadecynoic acid, 1,2-Benzenedicarboxylic acid and Phytol. Total Ash content is (15.23±0.43) %w/w with acid insoluble ash of (1.16 ±0.28) %w/w, water soluble ash of (8.13 ±0.32) %w/w, moisture content (5.67 ±0.14) %w/w, alcohol soluble extractive value of (5.76 ±0.40) %w/w and water-soluble extractive value of (10.96 ±0.35) %w/w. Chemomicroscopic evaluation indicate the presence of lignin, cellulose, tannins, starch, calcium oxalate, oils and protein. Microscopy, fluorescence and organoleptic analysis were also documented. Conclusion: From this study, the presence of valuable phytochemicals has been established from the plant, while HPLC and GCMS revealed the identities of these compounds. Thus, the physico chemical parameters established for Physalis angulata in this study falls within the range approved by WHO (1992) for crude plant and extract.

Abstract Food drying is still a crucial step in the food manufacturing process for food preservation, and the foam-mat drying method can be utilized to further enhance food preservation. This study aims to develop an instant L. powder enriched with Moringa oleifera L. extract and to evaluate the effect of foam mat drying conditions on physicochemical and antioxidant properties.The experimental design used a factorial completely randomized block design (FCBD), with triplicates. Based on the results showed that the interaction between the different forms of moringa extract, when added, and drying temperature affected color, water activity, bulk density, hygroscopicity, total acid titration, moisture content, ABTS, antioxidant activity and total flavonoid contents (p0.05). Samples dried at a temperature of 70°C (T3), both liquid (F1) and microencapsulated (F2), exhibited the best physicochemical and antioxidant properties. These findings confirmed the suitability of foam mat drying to produce P. angulata instant powder enriched with M. oleifera extract for functional food ingredients.

Physalis angulata L. berries are green in the initial stage of maturity and turn yellow when fully mature due to an increase in carotenoids. However, the coloration of the epidermis of the berry should not be the reference for harvesting maturity, since the calyx is fully closed. The use of an edible chitosan coating delays the color changes in the berry by reducing the respiration rate. This work studies the effect of harvest maturity and chitosan on the shelf life and berry coloring in Physalis angulata L. Three factors were considered, being harvest maturity stage (green mature (GM), yellowish-green (YG) and yellow (Y)), chitosan coating (0, 0.5, and 1%), and storage time (10, 20, 30 days). The fruits were stored at 20 °C and 85% Rh. The results showed that on the harvesting stage, chitosan coating had a significant effect on the quality and shelf life of berries during storage time. The value of carotenoid and phenol contents, flavor index, chroma, and hue significantly increased with berry maturity. Chitosan delayed the decrease in chlorophyll, phenol contents, antioxidant capacity, berry maturity, and color change. The results show that in the berries coated with 1% chitosan during storage, changes in color were less in comparison with the control condition (no chitosan). The highest decrease of hue angle and color index (17.92°) was observed in the control. The highest total antioxidant (78.42%) was observed after 30 days of storage in MG berries treated with a 0.5% chitosan coating.

The biological properties of Physalis angulata L. include antibacterial, and antioxidant activity, anticancer and anti-inflammatory. The main goal of the research was to determine, using in silico methods, if some of the bioactive substances found in P. angulata L. extract were able to bind and inhibit the important protein/receptor. The Physalis angulata L. extract yielded significant in vitro-free radical scavenging activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) with IC 5 0 value of 1.14 mg/ml, total phenolic content (TPC) value 133.96 ± 2.35 mg of gallic acid equivalent (GAE/g) and TFC value 47.6 ± 5.08 mg of quercetin equivalent (QE/g), respectively. The antibacterial activity was modest when compared with antibiotics controls. The extract was more effective on gram-positive Staphylococcus aureus than gram Escherichia coli yielding 11.367 ± 0.9 (mm) and 7.102 ± 0.5 (mm), respectively, at a 1 mg/mL concentration. The LC-HRMS analysis of the plant extract showed the most responsive compounds (30) that were present were selected to get the hit compound(s) on all target proteins viz., lipoxygenase-3, cytochrome P450, DNA gyrase topoisomerase II and histone acetyltransferase. Computational approaches revealed the low binding affinity of (+)-gallocatechin among 30 identified compounds on all target proteins. All identified compounds have good pharmacokinetic characteristics on ADMET parameters. Based on this study, P. angulata L. extract is a promising source of biological activity with great potential therapeutic use as an antibacterial and antioxidant. In vitro testing demonstrated that the extract from Physalis angulata L. exhibited noteworthy antioxidant activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH), with an IC50 value of 1.14 mg/ml. The extract showed antibacterial activity through diffusion agar methods. It displayed greater efficacy against the gram-positive Staphylococcus aureus at a concentration of 1 mg/mL. The computational assessment revealed that (+)-gallocatechin displayed a lowered binding affinity with all targeted proteins. The PASS activity assessment indicated that (+)-gallocatechin exhibited antioxidant and membrane permeability receptor activity. Nevertheless, all the identified compounds exhibited positive pharmacokinetic characteristics according to ADMET parameters. [ABSTRACT FROM AUTHOR]

Copyright of Indonesian Journal of Veterinary Science / Jurnal Kedokteran Hewan is the property of Universitas Syiah Kuala, Faculty of Veterinary Medicine and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Arif Widiatmoko,1,2 Loeki Enggar Fitri,1,3 Agustina Tri Endharti,1,3 Sinta Murlistyarini,1,2 Herwinda Brahmanti,2 Anggun Putri Yuniaswan,2 Dhany Prafita Ekasari,2 Faradiani Rasyidi,2 Nurul Laili Nahlia,2 Putri Rachma Safitri2 1Doctoral Program in Medical Science, Faculty of Medicine Universitas Brawijaya, Malang, East Java, Indonesia; 2Department of Dermatology and Venereology, Faculty of Medicine Universitas Brawijaya, Dr. Saiful Anwar General Hospital, Malang, East Java, Indonesia; 3Department of Parasitology, Faculty of Medicine Universitas Brawijaya, Malang, East Java, IndonesiaCorrespondence: Arif Widiatmoko, Department of Dermatology and Venereology, Faculty of Medicine Universitas Brawijaya, Dr. Saiful Anwar General Hospital, Jl. Jaksa Agung Suprapto 2, Malang, East Java, 65111, Indonesia, Tel +62 341340991, Fax +62 341340991, Email arif_fk@ub.ac.idIntroduction: Keloids are excessive fibroproliferative diseases that are caused by abnormal wound healing. The anti-proliferative activity of Physalis angulata compounds has potential as a keloid therapeutic agent. This study aimed to observe the effects of P. angulata on fibroblast viability and collagen type I, tissue inhibitor of metalloproteinase 1 (TIMP-1), and plasminogen activator inhibitor 1 (PAI-1) levels in human keloid fibroblasts.Methods: We conducted an experimental study of P. angulata ethanol extract on three primary human keloid fibroblast 3 passage cultures with four replications. Fibroblast viability was measured using the MTT assay after incubation with 3, 5, and 10 μg/mL P. angulata. Concentrations of P. angulata used to observe effects on TIMP-1, PAI-1, and collagen type I levels were 10%, 20%, 30%, and 40% of inhibitory concentration 50 (IC50). The levels of collagen type I, TIMP-1, and PAI-1 were measured by ELISA. Mean comparisons between multiple treatment groups were analyzed using one-way ANOVA followed by post-hoc analysis.Results: The 10 μg/mL P. angulata group had significantly lower fibroblast viability than the control group (p< 0.05) with an IC50 6.3 μg/mL. The collagen type I level of 10% IC50 (0.63 μg/mL) P. angulata group was lower than control (12.910 vs 47.866 ng/mL) (p=0.042). Level of TIMP-1 in 40% IC50 (2.51 μg/mL) P. angulata group was lower than control (5.350 vs 9.972 ng/mL) (p=0.043). There was no significant difference in the PAI-1 levels.Conclusion: This study showed the inhibitory effect of 10 μg/mL P. angulata extract on keloid fibroblast viability, with an IC50 of 6.3 μg/mL. This study also showed collagen type-1 and TIMP-1 inhibition, but not PAI-1 inhibition, after P. angulate treatment.Keywords: Physalis angulata, keloid, fibroblast viability, collagen type I, TIMP-1, PAI-1

Background: No drug with a liver antifibrotic effect for treating non-alcoholic fatty liver disease (NAFLD) has been approved. Physalis angulata Linn., better known to Indonesians as ciplukan, can treat various metabolic and inflammatory diseases naturally. This study aims to determine the effect of ethyl acetate fraction of P. angulata in the NAFLD rat model by examining alanine aminotransferase (ALT), cholesterol levels, and liver histopathological features, which are methods to evaluate the course of the disease and the potential antifibrotic effect. Method: This research is an in vivo study on male Wistar rats conducted at the Animal Laboratory, Faculty of Medicine, Universitas Padjadjaran, from September to November 2020. Rats were grouped randomly into seven groups of 5 each. The NAFLD models were created by giving a diet containing 20% margarine for four weeks. The intervention groups were given vitamin E, ethyl acetate fraction of P. angulata, and both combinations. The statistical analysis examined differences in each group based on their histopathological features, ALT, and cholesterol levels. Results: Histopathological results in the group given P. angulata at a dose of 0.32 mg resembled normal liver, and the ALT level was similar to vitamin E. The administration of P. angulata at a dose of 0.16 mg improved cholesterol levels. Conclusions: P. angulata ethyl acetate fraction at a dose of 0.32 mg improved the histopathological and serum ALT levels in the NAFLD rat model, which could be the basis for the mechanism of P. angulata's antifibrotic ability in NAFLD conditions. [ABSTRACT FROM AUTHOR]

Potato spindle tuber viroid (PSTVd) is an important pathogen that severely affects tomato and potato production. Several Solanaceae species are naturally and experimentally susceptible to PSTVd, implying that Solanaceae weeds can be a reservoir of PSTVd through infected seeds in crop fields. To determine whether PSTVd is seed-transmissible in solanaceous weed species, we examined seed transmission rates and localization of PSTVd in the reproductive organs of Solanum nigrum and Physalis angulata. The results revealed that the seed transmission rate of PSTVd was 0%–50% and 89.7%–100% in S. nigrum and P. angulata, respectively, suggesting that these weed species act as reservoirs of PSTVd, and their seed seems to be an important source of PSTVd. While the seed transmission rate in S. nigrum was 0%–8% for PSTVd isolate VP35, it was 10.5%–50% for isolate VP72-1. In situ hybridization analysis showed that isolate VP72-1 (but not VP35) successfully invaded the ovule and embryo of S. nigrum, suggesting that the transmission rate in S. nigrum might depend on the distribution pattern of PSTVd in ovules and embryos. This is the first report to show the distribution patterns of a viroid in the reproductive organs of solanaceous weed species during their developmental stages. [ABSTRACT FROM AUTHOR]

The Physalis genus has long been used as traditional medicine in the treatment of various diseases. Physalins, the characteristic class of compounds in this genus, are major bioactive constituents. To date, the biogenesis of physalins remains largely unknown, except for the recently established knowledge that 24-methyldesmosterol is a precursor of physalin. To identify the genes encoding P450s that are putatively involved in converting 24-methyldesmosterol to physalins, a total of 306 P450-encoding unigenes were retrieved from our recently constructed P. angulata transcriptome. Extensive phylogenetic analysis proposed 21 P450s that might participate in physalin biosynthesis. To validate the candidates, we developed a virus-induced gene silencing (VIGS) system for P. angulata, and four P450 candidates were selected for the VIGS experiments. The reduction in the transcripts of the four P450 candidates by VIGS all led to decreased levels of physalin-class compounds in the P. angulata leaves. Thus, this study provides a number of P450 candidates that are likely associated with the biosynthesis of physalin-class compounds, forming a strong basis to reveal the unknown physalin biosynthetic pathway in the future. [ABSTRACT FROM AUTHOR]

Cutleaf groundcherry (Physalis angulata L.), an annual plant containing a variety of active ingredients, has great medicinal value. However, studies on the genetic diversity and population structure of P. angulata are limited. In this study, we developed chloroplast microsatellite (cpSSR) markers and applied them to evaluate the genetic diversity and population structure of P. angulata. A total of 57 cpSSRs were identified from the chloroplast genome of P. angulata. Among all cpSSR loci, mononucleotide markers were the most abundant (68.24%), followed by tetranucleotide (12.28%), dinucleotide (10.53%), and trinucleotide (8.77%) markers. In total, 30 newly developed cpSSR markers with rich polymorphism and good stability were selected for further genetic diversity and population structure analyses. These cpSSRs amplified a total of 156 alleles, 132 (84.62%) of which were polymorphic. The percentage of polymorphic alleles and the average polymorphic information content (PIC) value of the cpSSRs were 81.29% and 0.830, respectively. Population genetic diversity analysis indicated that the average observed number of alleles (Na), number of effective alleles (He), Nei's gene diversity (h), and Shannon information indices (I) of 16 P. angulata populations were 1.3161, 1.1754, 0.1023, and 0.1538, respectively. Moreover, unweighted group arithmetic mean, neighbor-joining, principal coordinate, and STRUCTURE analyses indicated that 203 P. angulata individuals from 16 populations were grouped into four clusters. A molecular variance analysis (AMOVA) illustrated the considerable genetic variation among populations, while the gene flow (Nm) value (0.2324) indicated a low level of gene flow among populations. Our study not only provided a batch of efficient genetic markers for research on P. angulata but also laid an important foundation for the protection and genetic breeding of P. angulata resources. [ABSTRACT FROM AUTHOR]

Background The prevalence of atopic dermatitis (AD) and allergic or irritant contact dermatitis has been increasing significantly in the general population. Interleukin- 4 (IL-4), interleukin-6 (IL-6), and immunoglobulin E (IgE) play a key role in the pathogenesis of AD. Physalis angulata (PA) leaves reportedly have anti-inflammatory effects by impeding IL-4, IL-6, and IgE. This study aimed to evaluate the effect of PA leaf extract cream on IL-4, IL-6, and IgE using 2,4-dinitrochlorobenzene (DNCB) to induce AD-like skin inflammation in a mice model. Methods This study used an experimental design involving 30 BALB/c mice, that were randomized into 3 groups: 1) control group receiving no treatment; 2) Vehicle treatment group receiving vehicle cream preparation; 3) PA treatment group receiving 10% PA leaf extract cream after induction of AD-like skin inflammation by DNCB. After 30 days, tissue samples were extracted from the skin lesions to measure IL-4 and IL-6 levels, and serum to measure IgE using ELISA. One-way Anova, Kruskal-Wallis and Mann-Whitney tests were used to analyze the data. Results Group 3 (PA treatment) had significantly lower IL-4 (281.15 ± 43.14 pg/mL) than group 2 (vehicle cream treatment) (388.89±135.88 pg/ml) (p=0.001). However, although IL-6 and IgE levels were lower in group 3 than in group 2, the differences were statistically not significant (p=0.096 and p=0.479 respectively). Conclusion There were lower levels of IL-4, IL-6, and IgE in the group receiving PA leaf extract cream than in the group receiving vehicle cream preparation. Therefore, PA leaf extract cream may have therapeutic potential in AD.

Vigna unguiculata (L.) Walp. (cowpea) is an important economic vegetable in Sanya, Hainan Province, China. But it is easily infected by various viral diseases, especially cowpea mild mottle virus (CPMMV), bean common mosaic virus (BCMV) and cowpea polevirus 2 (CPPV2), causing symptoms such as yellowing, dwarfism and mosaic of leaves, affecting photosynthesis of cowpea. Weeds are perfect intermediate hosts for crop viruses. In the cowpea fields of Sanya, there are a large number of weeds growing nearby, including Sesbania cannabina (Retz.) Poir. and Physalis angulata (L.). S. cannabina, a species of legume, has high nutritional value as the one of the most admired green-manuring plants widely used in crop field for gaining yield and decreasing the quantity of chemical fertilizer (Tiwari et al. 2004). P. angulata, commonly known as husk tomato, is an annual Solanaceaea vegetable crop grown for its fruits (Ramakrishna Pillai et al. 2022). In July 2022, S. cannabina and P. angulata surrounding one hectare of cowpea fields of Sanya with chlorotic and asymptomatic (Figure S1) were collected, and then their total RNAs were individually extracted by the TRIzol Reagent (Life, USA), and two cDNA libraries (one including the RNA samples of S. cannabina, another including the RNA sample of P. angulata) were subsequently constructed using VAHTS Universal V8 RNA-seq Library Prep Kit (Vazyme, China). High-throughput sequencing was performed on a DNBSEQ-T7 platform (BGI, China) with the 150 bp paired-end method. A total of 40,134,299 and 149,473,308 clean reads were de novo assembled by SPAdes 3.15.5 to generate contigs, followed by BLAST-x/n search in viral genomes in GenBank. From the RNA-seq library of S. cannabina, we identified one contig (6255 nt) that exhibited 96.45% nucleotide identity to the CPMMV isolate CPMMV-JS (MT366555), covering 6033 bp out of 6255 bp (6033/6255) of the contig. Additionally, we found seven contigs (ranging in length from 1870 nt to 8336 nt) in the RNA-seq library of P. angulata that showed 78.92% to 84.15% nucleotide identity to the CPMMV isolate Brunt (OK558693), with specific alignment lengths varying from 669/795 to 4244/5337. CPMMV was verified by reverse transcription - polymerase chain reaction (RT-PCR) detection using specific primer (F: 5'-CTGGCCAAGTGGTTTGTTTT-3', R: 5'- AACCGGGTTTACAATCCACA -3') (Wei et al. 2020). PCR products were extracted from an agarose gel, cloned into the pMD19-T Vector (Takara, China), and transformed into Escherichia coli DH5α cells (Sangon Biotech, Shanghai). Two clones for each PCR product were sequenced by Sanger sequencing. The amplified 1865 bp fragments of S. cannabina (PP790744) and P. angulata (PP790743) had 98.07% identity (1727 bp out to 1761 bp) and 97.92% sequence identity (1739 bp out to 1776 bp) to CPMMV-JS (MT366555). Afterwards, we collected S. cannabina and P. angulata with similar symptoms around two cowpea fields (each field covers an area of about one hectare) in three districts of Sanya, namely Yazhou, Tianya, and Haitang, and conducted CPMMV detection. We found that CPMMV was detected in all six samples. CPMMV, including genus Carlavirus and family Betaflexiviridae, was first identified on cowpea in Ghana in the 1970s. Since then, it has been shown to have a very extensive geographical distribution and a wide natural host range. CPMMV principally infects Fabaceae, it is also able to infect hosts from Solanaceaea, Nyctaginaceae, Cleomaceae, Asteraceae and Lamiaceae (Celli et al. 2016; Lamas et al. 2017; Zanardo and Carvalho 2017). To our knowledge, this is the first report of natural infection of the S. cannabina and P. angulata by CPMMV, which may represent additional reservoirs of this virus in the region. Meanwhile, investigating CPMMV in S. cannabina and P. angulata is crucial for developing integrated strategies to prevent its transmission to economically important plants such as cowpea.

Total alkaloids (0.6%) were isolated from the aerial part of Physalis angulata. The known alkaloids cuscohygrine and tropine were identified for the first time in it. Neutral and polar lipids from seeds and fatty acids from leaves of P. angulata were characterized. Neutral (12.35%) and polar lipids (2.18%) were isolated from seeds. Their fatty-acid compositions (16–17 constituents) were determined. Leaves contained 3.6% total lipids with a fatty-acid composition like that of the plant seeds. Seeds and leaves of P. angulata were studied for carbohydrate contents. Leaves were shown to contain water-soluble polysaccharides and pectinic substances (PS). Their monosaccharide compositions were given. A polysaccharide containing mannan was found in seed WSPS. PS of leaves were highly esterified pectins. [ABSTRACT FROM AUTHOR]

In Vietnam, Physalis angulata L. has been widely used as a traditional medicine to treat fever, anti-inflammatory, and expectorant. Currently, there have been studies on the content of chemical composition especially physalin with anti-diabetic, anti-inflammatory, antibacterial, prevent cancer. This study developed a reliable and sensitive method to determine and validate simultaneous Physalin B and Physalin D in Physalis angulata L.. The QuEChERS method was used for sample preparation from leaf matrices and quantified by using High-performance liquid chromatography coupled with a diode-array detector. The method of research was validated under AOAC and ICH guidance. Chromatography conditions include Agilent C18 column (250mm × 4,6mm; 5μm) with a gradient mode using acetonitrile – methanol-water as mobile phase. The recovery of the method ranged from 94.21 – 105.93% and RSD was from 1.20 – 2.31%, the LOD, and LOQ were 0.4 mg/kg – 2.4 mg/kg, respectively. The results of the study showed that the proposed the new QuEChERS method for quantification of Physalin B and D in Physalis angulata L. in Vietnam. [ABSTRACT FROM AUTHOR]

Cutleaf groundcherry (Physalis angulata L.), an annual plant containing a variety of active ingredients, has great medicinal value. However, studies on the genetic diversity and population structure of P. angulata are limited. In this study, we developed chloroplast microsatellite (cpSSR) markers and applied them to evaluate the genetic diversity and population structure of P. angulata. A total of 57 cpSSRs were identified from the chloroplast genome of P. angulata. Among all cpSSR loci, mononucleotide markers were the most abundant (68.24%), followed by tetranucleotide (12.28%), dinucleotide (10.53%), and trinucleotide (8.77%) markers. In total, 30 newly developed cpSSR markers with rich polymorphism and good stability were selected for further genetic diversity and population structure analyses. These cpSSRs amplified a total of 156 alleles, 132 (84.62%) of which were polymorphic. The percentage of polymorphic alleles and the average polymorphic information content (PIC) value of the cpSSRs were 81.29% and 0.830, respectively. Population genetic diversity analysis indicated that the average observed number of alleles (Na), number of effective alleles (He), Nei’s gene diversity (h), and Shannon information indices (I) of 16 P. angulata populations were 1.3161, 1.1754, 0.1023, and 0.1538, respectively. Moreover, unweighted group arithmetic mean, neighbor-joining, principal coordinate, and STRUCTURE analyses indicated that 203 P. angulata individuals from 16 populations were grouped into four clusters. A molecular variance analysis (AMOVA) illustrated the considerable genetic variation among populations, while the gene flow (Nm) value (0.2324) indicated a low level of gene flow among populations. Our study not only provided a batch of efficient genetic markers for research on P. angulata but also laid an important foundation for the protection and genetic breeding of P. angulata resources.

The Physalis genus is composed of species with economic and medicinal importance, its cultivation is expanding in Brazil, and is needed research on the performance of species in different regions of the country. Thus, the objective was to characterize the growth, development and yield of Physalis angulata and Physalis ixocarpa species cultivated in three sowing seasons in Bahia's semiarid region. The days after sowing were determined for the occurrence of vegetative and reproductive stages, and the length and diameter of the main branch were evaluated weekly. At the end of cultivation, the number and total weight of fruits per plant were determined. The plants sown in April showed the best results, with acceleration in flowering, higher productivity and growth close to other producing regions, which is the best period for the cultivation of species. P. angulata is a more tolerant species and can be sown at different periods without compromising yield. High temperatures combined with scarcity of rainfall compromise the development of plants of both species.

Physalis angulata is a renowned traditional Chinese medicine for the treatment of various conditions. Physalin is the major type of bioactive constituents conferring medicinal properties of P. angulata. Despite the medicinal importance, the pathways leading to physalin are largely unknown. In this study, we employed a transcriptomic approach to identify a Pa24ISO gene from P. angulata. Through heterologous expression in yeast, Pa24ISO was revealed to catalyze an isomerization reaction in converting 24-methylenecholesterol to 24-methyldesmosterol. Real-time PCR analysis showed that the abundance of Pa24ISO transcripts correlated with the accumulation pattern of physalin B in different tissues of P. angulata. A direct role of Pa24ISO in channeling of 24-methylenecholesterol for physalin B biosynthesis was illustrated by suppressing the gene in P. angulata via the VIGS approach. Down-regulation of Pa24ISO led to reduced levels of 24-methyldesmosterol and physalin B, accompanied with an increase of campesterol content in P. angulata. The results supported that 24ISO is involved in physalin biosynthesis in plants. [ABSTRACT FROM AUTHOR]

Physalis angulata L. (Solanaceae) an invasive alien weed displayed a great spreading and invasion in Egypt, thus the growth traits and functional strategies within the invaded lads and crops were analyzed. Seedling, juvenile, flowering, fruiting, and dispersion stages were distinguished with a short time and life cycle with an average from 70 to 90 days during the year. Specific leaf area was gradually increased until the final stage and vice versa in root mass and stem mass fractions. The accumulation coefficient of dry weight was increased significantly (P > 0.001) and ranged from 0.844 to 0.99 in response to the habitat conditions. The higher plasticity of P. angulata referred to the substantial adaptability to variable environmental conditions and to invade a new community. The demographic surveys of 60 invaded fields were found about 28 weed species within 25 genera in 10 families in examined crops. Physalis angulata have a high relative growth rate, massive fruits and subsequently seeds production, as well as a higher coefficient of similarity in the recipient communities. While their interaction with the native community was reflexed in their low richness, diversity, and evenness. The most susceptible crop to P. angulate invasion was Citrullus lanatus var. Colocynthoide followed by Sesamum indicum and in contrast Zea mays and Solanum melongena crops that can be considered as competitive crops to this weed. Finally, this information is important for the prediction of P. angulate impacts and future behavior. [ABSTRACT FROM AUTHOR]

The genus Physalis includes species used for food, medicinal and artisanal purposes. The wild tomato (Physalis angulata L.), which is common in the mixed maize cultivation called "the milpa", is cultivated in some localities of Jalisco because of its importance in the preparation of sauces. It is hypothesized that the management of planting density and fertilization application can improve the yield of this tomato. The objective of this study was to evaluate the leaf area and yield of P. angulata L. as a function of slow-release urea doses and planting densities, under open-field rainfed conditions. Nine treatments were evaluated, resulting from the combination of three planting densities and three fertilizer doses. The experimental design was randomized complete blocks with factorial arrangement. The data were analyzed with analysis of variance and the means of the treatments were compared with Tukey's test (p = 0.05). The relationship between yield and study variables was estimated with simple linear regressions. The results indicated that with 2.5 plants m-2 the highest yield was obtained (6.4 Mg ha-1); while with 140 units of slow-release urea the average yield was 5.76 Mg ha-1. The interaction effect showed that with densities of 2.0 and 2.5 plants m-2 and with 120 kg of slow-release urea, the highest fruit yields were obtained, 6.44 and 6.87 Mg ha-1. For each unit increase in the variables leaf area, leaf area index, number of fruits per plant and fruit weight per plant, fruit yield increased as well. The yield of P. angulata responded differently to planting densities and slow-release urea doses. The best yield could be obtained with the planting density of 2.5 plants m-2 and with the application of 30.4 g m-2 slow-release urea. [ABSTRACT FROM AUTHOR]

Physalis angulata is a renowned traditional Chinese medicine for the treatment of various conditions. Physalin is the major type of bioactive constituents conferring medicinal properties of P. angulata. Despite the medicinal importance, the pathways leading to physalin are largely unknown. In this study, we employed a transcriptomic approach to identify a Pa24ISO gene from P. angulata. Through heterologous expression in yeast, Pa24ISO was revealed to catalyze an isomerization reaction in converting 24-methylenecholesterol to 24-methyldesmosterol. Real-time PCR analysis showed that the abundance of Pa24ISO transcripts correlated with the accumulation pattern of physalin B in different tissues of P. angulata. A direct role of Pa24ISO in channeling of 24-methylenecholesterol for physalin B biosynthesis was illustrated by suppressing the gene in P. angulata via the VIGS approach. Down-regulation of Pa24ISO led to reduced levels of 24-methyldesmosterol and physalin B, accompanied with an increase of campesterol content in P. angulata. The results supported that 24ISO is involved in physalin biosynthesis in plants.

Background: Cutleaf groundcherry (Physalis angulata L.) has vitamins that are good for health. There were several genotypes of cutleaf groundcherry that have the potential to be widely cultivation, but information of doses of NPK fertilizer for those genotypes was still limited. The objective of this experiment was to determine the response of cutleaf groundcherry to different rates of NPK fertilizer. Methods: The experiment was conducted May-September 2019 in dry land field. The experiment used a factorial randomized block design with three replications. The first factor was genotypes cutleaf groundcherry (PA 01, PA 02 and PA 03) and the second factor was doses of NPK fertilizer (75, 150 and 225 kg ha-1 NPK). Conclusion: The increased in doses of NPK fertilizer to 225 kg ha-1 NPK increased nutrient uptake, plant growth and fresh fruit weight for each genotype of cutleaf groundcherry. Meanwhile ascorbic acid content increased with a dose of 150 kg ha-1 NPK, but decreased with increased NPK fertilizer rates. The beta-carotene content with 75 kg ha-1 NPK fertilizer was higher than with 150 and 225 kg ha-1 doses. The increase of NPK fertilizer doses otherwise decreases the beta-carotene content for each genotype. Shoot dry weight, fresh fruits weight and ascorbic acid in PA 03 genotype higher than PA 01 and PA 02 genotypes. [ABSTRACT FROM AUTHOR]

The inhibitory effect against 5-α reductase of the ethyl acetate (EA) extract from Physalis angulata was evaluated in vitro using mouse prostate homogenates, and the suppression of benign prostatic hyperplasia (BPH) was assessed in a mouse model of testosterone-induced BPH. The EA extract exhibited a potentially inhibitory effect on 5-α reductase with an IC 50 of 197 μg/ml. In BPH mice, the EA extract at a dose of 12 mg/kg was comparable to finasteride 5 mg/kg in suppressing BPH in terms of reducing absolute enlarged prostate weight (p < 0.05 vs. BPH group) and mitigating the hypertrophy of glandular elements and prostate connective tissue. Identification of chemical ingredients in the EA extract by UPLC-QTOF-MS revealed 37 substances belonging chiefly to flavonoids and physalins. Further quantification of the EA extract by HPLC-PDA methods revealed that chlorogenic acid, and rutin were the main components. Molecular docking studies of chlorogenic acid and rutin on 5-α reductase showed their high affinity to the enzyme with binding energies of −9.3 and − 9.2 kcal/mol, respectively compared with finasteride (− 10.3 kcal/mol). Additionally, chlorogenic acid inhibited 5-α reductase with an IC 50 of 12.07 µM while rutin did not. The presence of chlorogenic acid in the EA extract may explain the inhibitory effects of the EA extract on 5-α reductase, and thus the suppression of BPH. [Display omitted] [ABSTRACT FROM AUTHOR]

AIM: To investigate the effect of Physalis angulata leaf extract on apoptotic and proliferation of retinoblastoma cells. Despite several previous studies evidencing the anti-cancer potential of Physalis angulata; however, certain study that proves its benefits in retinoblastoma cancer cells has been limited. METHODS: This study utilizes an in-vitro experimental study by applying Y79 human retinoblastoma cell line culture obtained from the American Type Culture Collection (ATCC; 10801 University Boulevard Manassas, VA 20110, USA). The cell was divided into 4 groups. Group I was the control group without the administration of Physalis angulata leaf extract. Whereas, group II, II and IV are engaged with 25, 50, and 100 µg/mL of Physalis angulata leaf extract respectively. After a 24h incubation, an examination with microtetrazolium (MTT) cell proliferation assay and Annexin V apoptosis detection was conducted. Statistical analysis was performed with the Tukey test. RESULTS: Physalis angulata leaf extract improved apoptosis and significantly reduced the number of living cells in retinoblastoma cells, along with the increase in the given dose. Based on the Tukey test, a significant difference was found in the treatment group at 50 µg/mL (P=0.025) and 100 µg/mL (P=0.001) in the measurement of apoptosis. Proliferation measurements also indicated a significant decrease in the number of living cells in the 50µg/mL treatment group (P=0.004), and in the 100 µg/mL treatment group (P=0.000). Meanwhile, a dose of 25 µg/mL indicated insignificant difference in the two measurements. Improved apoptosis and decreased number of living cells occured at a dose of 100 µg/mL. Decreased number of living cells (in the measurement of proliferation) was due to the inhibited proliferation or improved apoptosis. CONCLUSION: Physalis angulata leaf extract improve apoptosis in retinoblastoma cell culture, requiring further research to inhibit proliferation.

Background: Medicinal plants play important roles in the management of several diseases including diabetes. Objective: The aim of this study is to investigate the mechanism of action of Physalis angulata (PA) for its anti-diabetic activity using an in vitro model. Materials and Methods: Alpha-amylase inhibition was investigated through dinitrosalicylic acid assay. Glucose uptake was determined using LO-2 cell model. Radical scavenging activity was performed through 1,1-diphenyl-2-picrylhydrazyl (DPPH), and 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS+) assay. Nitric oxide (NO) production was measured using the Griess reaction. Cell viability was examined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl-tetrazolium bromide assay. Results: The result showed that PA extract was able to inhibit enzyme alpha-amylase activity up to (56.6% ± 4.7%) at the concentration of 200 μg/ml. Moreover, PA possessed glucose adsorption and glucose uptake capacity up to (2.2 ± 0.18) mM glucose/g extract and (156% ± 10.1%), respectively. In addition, PA extract scavenged (52.6% ± 3.5%) DPPH and (59.7% ± 2.6%) ABTS + radicals and reduced NO production to (34.2% ± 3.8%) from RAW264.7 cells without any cytotoxic effects. Conclusion: PA could be suggested as pharmaceutical ingredient for the development of anti-diabetic products. [ABSTRACT FROM AUTHOR]

The Physalis genus is composed of species with economic and medicinal importance, its cultivation is expanding in Brazil, and is needed research on the performance of species in different regions of the country. Thus, the objective was to characterize the growth, development and yield of Physalis angulata and Physalis ixocarpa species cultivated in three sowing seasons in Bahia's semiarid region. The days after sowing were determined for the occurrence of vegetative and reproductive stages, and the length and diameter of the main branch were evaluated weekly. At the end of cultivation, the number and total weight of fruits per plant were determined. The plants sown in April showed the best results, as flowering precocity, higher productivity and growth close to other producing regions, which is the best period for the cultivation of species. P. angulata is a more tolerant species and can be sown at different periods without compromising yield. High temperatures combined with scarcity of rainfall compromise the development of plants of both species of Physalis. [ABSTRACT FROM AUTHOR]

Aqueous extracts of selected Thai medicinal plants were assessed for anti-HIV-1 activities in syncytium reduction assay using ∆tat/revMC99/1A2 system and reverse transcription (RT) inhibition assay. Results showed that all the plant extracts inhibited viral syncytium formation with the effective concentrations at 50% (EC50) ranging from 33.9 to 112 µg mL−1. The EC50 values indicated that the extracts were not toxic to 1A2 cells. The selectivity index (SI) ranged from 2.0 to > 6.6. The antiviral activity found in each plant was not due to the inhibition of viral reverse transcriptase enzyme. [ABSTRACT FROM AUTHOR]

Physalis angulata L. belongs to the family Solanaceae and is distributed throughout the tropical and subtropical regions. Physalis angulata leaf and fruit extracts were assessed for in vitro anticancer, antioxidant activity, and total phenolic and flavonoid content. The GC-MS technique investigated the chemical composition and structure of bioactive chemicals reported in extracts. The anticancer activity results revealed a decrease in the percentage of anticancer cells’ viability in a concentration- and time-dependent way. We also noticed morphological alterations in the cells, which we believe are related to Physalis angulata extracts. Under light microscopy, we observed that as the concentration of ethanolic extract (fruit and leaves) treated HeLa cells increased, the number of cells began to decrease.

The aim of this study was to evaluate the changes in quality of fruits of two species of physalis (P. angulata and P. pubescens) harvested from family farmer orchards in different maturity stages, comparing with fully ripen fruits to those of the commercial species (P. peruviana) of similar maturity. The experiment was conducted in a completely randomized design, in five maturity stages for P. angulata and in four for P. pubescens. Data were submitted to variance analysis and means of the maturity stages compared by the Tukey test at 5 % probability. For the comparison of fully ripen fruits of P. peruviana with the two species produced in different locations were used six replications and the means compared by Dunnett's test at 5 % probability. The fruit diameter varied from 15.1 to 18.0 mm that classifies it as of caliber B. During maturation the color of the fruit evolved from green to totally yellow (P. angulata) and to yellow-brown with purplish features (P. pubescens). The soluble solids (SS) contents of the fruits of P. angulata were superior to those of P. pubescens and the commercial species. Comparing with commercial species, the SS/AT ratio was higher in locally produced fruits, indicating more palatable fruits. Fruits of P. angulata present favorable characteristics for fresh consumption, with potential for extensive cultivation and trade in family horticulture.

A new 22,26-seco physalin, physalin XI (1) together with 5 known compounds, were isolated from the dichloromethane extract of Physalis angulata L. The structure of isolated compounds was elucidated by spectroscopic analysis. The effects of isolated compounds on in vitro cytotoxicity were investigated. Compound 1 was assessed for its cytotoxicity against cancer cell lines (HepG2, HeLa, HuCCA-1, T47-D and A-549) and a normal cell line (MRC-5), and the result showed that it has no activity. Compounds 2 and 4 are highly toxic to H69AR and MDA-MB-23 cell lines. This property appears to be related to the presence of their conjugated double bond or epoxy groups and is a more reliable indication of toxicity than substitution on C(5)–C(6). [ABSTRACT FROM AUTHOR]

Introduction: Physalis angulata, an indigenous herb belonging to the Solanaceae family, has been recognised for its medicinal significance and is commonly found in tropical and subtropical regions. This study aimed to evaluate the anti-inflammatory activity of rutin, a flavonoid found in P. angulata. Method: A phytochemical analysis of the water fraction of the entire plant was conducted using chromatographic techniques, leading to the isolation and identification of rutin. The compound's structure was established through the interpretation of NMR spectroscopic data. The anti-inflammatory potential of the isolated rutin was assessed through various enzymatic inhibitory assays, including lipoxygenase, hyaluronidase, protein denaturation, xanthine oxidase and elastase. These enzymes are known to play essential roles in the inflammatory processes associated with various diseases. Results: The assayed compound exhibited promising anti-inflammatory properties with moderate inhibitory activity against elastase, lipoxygenase and xanthine oxidase but weakest in hyaluronidase inhibitory activity. Conclusion: We concluded that the tested flavonoid rutin has the potential to be a candidate for anti-inflammatory agents for the prevention and treatment of numerous diseases, that are caused by complex inflammatory processes. [ABSTRACT FROM AUTHOR]

Transforming growth factor beta (TGF-β) initiates epithelial-mesenchymal transition (EMT) in tubular and glomerular epithelial cells, resulting in excessive production and deposition of extracellular matrix through its interaction with TGF-β receptors, which play a crucial role in TGF-β signaling involving two receptor types, namely TGF-β type I (TβRI) and type II (TβRII). EMT contributes to the pathogenesis of interstitial renal fibrosis, a marker of end-stage kidney disease. This study aimed to identify the bioactive compounds in the active fraction of P. angulata and evaluate their ability to inhibit the TGF-β activity and their potential as drug candidates. The active components in the active fraction of P. angulata were analyzed using gas chromatography-mass spectrometry (GC-MS). The bioactive compound structures were obtained from the PubChem database, while the protein targets, TβRI and TβRII, were retrieved from the Protein Data Bank (PDB). The molecular docking analyses were performed using PyRx 0.8 and Discovery Studio. SwissADME was used to evaluate ligand properties and druglikeness. Three dominant active compounds were identified, namely palmitic acid, campesterol, and stigmasterol. In silico studies demonstrated strong energy bonds existed between TβRI and palmitic acid, campesterol, stigmasterol, and SB431542 with binding energy values of -5.7, -10, -9.4, and -10.9 kcal/mol, respectively. Similarly, they strongly bound to TβRII with binding energy values of -5.2, -7.1, -7.5, and -6.1 kcal/mol, respectively. All compounds meet Lipinski's criteria for druglikeness. Among the identified active compounds, campesterol exhibited the highest affinity for TβRI, while stigmasterol exhibited a strong affinity for TβRII. These findings suggested that the three compounds have potential as drug candidates., Competing Interests: The authors have no conflicts of interest to declare., (© The Author(s).)

The use of natural products by communities from the Colombian Caribbean region to treat health issues, together with biodiversity and geographical features, constitute a great scenery to develop new therapies based on ethnopharmacological heritage. Here, we investigated the anti-inflammatory potential of 10 commonly used plants in Colombian folk medicine, evaluating their effect on nitric oxide (NO) production by LPS-stimulated RAW 264.7 macrophages. The most active plant was evaluated in vivo using 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced mouse ear edema, along with its effect on the production of pro-inflammatory mediators in vitro. The extract of Physalis angulata L. calyces showed the highest activity. This extract was fractionated and its dichloromethane fraction (DF) was the most active in vitro , inhibiting the production of NO, prostaglandin E 2 (PGE 2), interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α and monocyte chemotactic protein (MCP)-1 (CCL2). In vivo , DF showed a significant inhibition of ear edema and myeloperoxidase (MPO) activity, with evident reduction of the leukocyte infiltration into tissue. Our results support the ethnopharmacological use of the selected plants in folk medicine. P. angulata dichloromethane fraction represents a promising source of pharmacological compounds with great potential therapeutic use to treat inflammatory illness. [ABSTRACT FROM AUTHOR]

During the present study an analytical method based on reverse-phase high performance liquid chromatography photodiode array detection method was developed for simultaneous determination of withaferin-A and withanolide-A in plant parts of two cytotypes (diploid n = 12 & tetraploid n = 24) of Physalis angulata. All the plant parts were extracted in different solvent solutions i.e., acidic [HCl] methanol (i.e., methanol containing 0.3% of HCl), methanol, n-hexane, chloroform. Both the compounds were comparatively analysed. The results revealed that tetraploid cytotype (n = 24) showed the higher composition of both the reference compounds. The method is simple, rapid and provides better resolution can be easily applied to the quantitative analyses of withanolides in plant matrices. [ABSTRACT FROM AUTHOR]

Summary: Background: Topical corticosteroids have been the most commonly prescribed drugs to treat skin inflammation, but their uses can lead to several adverse effects. Nowadays, new pharmacological strategies have been evaluated to improve dermatologic efficacy and reduce adverse effects, including natural products. Objectives: The aim of this study was to evaluate and compare the effects of a plant sterol standardized supercritical CO2 phytopharmaceutical of Physalis angulata L. with hydrocortisone on the immune and inflammatory mediators, and skin repair components production. Moreover, we studied effects of both products on the skin microcirculation and temperature in a double‐blind placebo‐controlled clinical trial. Methods: Both products were evaluated on the immune (IL‐6, IL‐10, INF‐γ, TNF‐α, and IL‐1α), inflammatory (COX‐2, LOX, PLA2, PGE2, LTB4, histamine, and NF‐κB), and repair components (TGF‐β, GM‐CSF, collagen, and GAG) production on human keratinocytes and fibroblast in non‐stimulated and LPS‐stimulated conditions. Indeed, in a randomized double‐blind placebo‐controlled clinical trial, we evaluated the effects of the both creams on the skin microcirculation and temperature using laser Doppler and infrared thermometer, respectively. Results: Physalis angulata acted on the skin, modulating immune status and inflammatory response producing corticoid‐like effects, but different of hydrocortisone, increased skin repair factors. The effects of phytopharmaceutical cream in the clinical trial promoted a better reduction in skin microcirculation and temperature than hydrocortisone. Conclusions: Taken together, the results indicate that sterol standardized CO2 supercritical preparation of P angulata is a new and innovative phytopharmaceutical with multiple pharmacological effects potentially useful as human skin protective product, particularly against cutaneous inflammatory disorders. [ABSTRACT FROM AUTHOR]

Background: Physalis angulata L. is widely used in folk medicine. Secondary metabolites with pharmacological potential, including physalins that exhibit anti-inflammatory/immunomodulatory and antiparasitic activities, have been identified in this specie. To date, few studies have investigated storage sites for secondary metabolites in P. angulata. Objective: The objective of the study is to characterize the anatomical structures and determine the phytochemical composition of the vegetative organs of P. angulata. Materials and Methods: Electron and conventional optical microscopy was used for the anatomical characterization of P angulata organs (leaves, roots, stems, and fruits). Methanolic extracts from leaves, roots, stems, and fruits were chemically characterized for the presence of steroids, terpenoids, tannins, alkaloids, saponins, flavonoids, anthraquinones, coumarins, and phenolic compounds. Phenolic compounds, flavonoid contents, and antioxidant capacity of these extracts were determined by 2,2-diphenyl-1-picrylhydrazyl-free radical scavenging activity. Results: Abaxial leaf stomata were more abundant than the adaxial stomata. Trichomes were more abundant along veins in the petioles and stems, beyond the margin in the sepals and petals, and dispersed in the ovary. Steroids and terpenoids were present in leaves, stems, and fruits of P. angulata. Saponins were exclusive to fruits. Phytochemical screening did not detect flavonoids, anthraquinones, and alkaloids in all tested plant parts. The highest antioxidant capacities were identified in leaf and fruit extracts, possibly due to the presence of phenolic compounds in these organs. Conclusion: This study describes anatomical and biochemical features from P angulata that will assist in future phytochemistry and pharmacological studies, particularly pointing toward organs abundant in antioxidants (leaves and fruits) and steroids (possibly physalins; leaves). [ABSTRACT FROM AUTHOR]

Physalis angulata has been discovered and recorded for the first time in the flora of Libya. This species was collected from the Bilash′har region belonging to the city of Tajura, about 20 km east of Tripoli. P. angulata is easily identified by its small yellow flowers without central dark spots in the center, and by pedulus globose berry enclosed within an inflated bladdery fruiting calyx. Detailed descriptions, photographs, habitat and ecology are provided for easy identification, and to facilitate further identification of this species and to warrant its future detection. [ABSTRACT FROM AUTHOR]

A rapid, simple, improved and precise high performance thin layer chromatography method has been developed for the comparative estimation of sugars in two cytotypes i.e., 2x and 4x of crude plant part extracts of Physalis angulata, an important medicinal plant. Chromatographic separation was achieved by employing a mobile phase consisting 1-propanol: ethyl-acetate: water (3:1:0.1 v/v/v) on pre-coated Silica gel 60F254 plates and derivatized using DPA method (diphenylamine). Densitometry analysis was carried out at 600 nm in adsorption reflection mode. A significant difference in the quantity and quality of analyzed sugars was detected among both the cytotypes. The method was shown to be sensitive, accurate and reproducible for the determination of sugars in plants. [ABSTRACT FROM AUTHOR]

As part of the search for new bioactive plants from the Colombian Caribbean, the dichloromethane fraction of the calyces of Physalis angulata L. (PADF) was selected for its anti-inflammatory activity. In this work, we investigated the immunomodulatory effect of PADF in activated macrophages and during dextran sulfate sodium (DSS)-induced colitis. PADF displayed a low content of withanolides or phenolic compounds, and a higher content of sucrose esters, representative anti-inflammatory metabolites of the Physalis genus. The PADF fraction at 12.5 μg/mL prevented the induction of interleukin (IL)-1β, tumor necrosis factor (TNF-α), IL-6, IL-12, cyclooxygenase-2 (COX-2), and inducible nitric oxide synthase (iNOS) by lipopolysaccharide (LPS), while increased the levels of arginase (ARG1), IL-10, and mannose receptor C (MRC1). The polarization towards an anti-inflammatory profile was also observed in resting macrophages, without promoting the typical gene profile induced by IL-4, suggesting that PADF promotes a shift to a regulatory status rather than to an alternative one. In vivo, the administration of PADF to mice with chronic DSS-colitis reduced disease signs (i.e., body weight loss and colon shortening), and improved the histology score by diminishing the levels of pro-inflammatory cytokines and increasing the production of IL-10. Overall, results suggest that the regulatory effect on PADF towards macrophages might contribute to the therapeutic activity observed in the murine model of inflammatory bowel disease.

RESUMO A espécie Physalis angulata L., pertencente à família Solanaceae, tem despontado como uma planta extremamente promissora para uso medicinal, em razão da produção do composto fisalina. No entanto, aspectos importantes do seu cultivo ainda permanecem pouco conhecidos. Assim, objetivou-se avaliar a influencia do fósforo para o seu crescimento. O experimento foi conduzido em Latossolo Amarelo de textura média, submetido a três doses de P: 8, 16 e 64 mg kg-1 de P. Usou-se um delineamento experimental inteiramente casualizado. Foram realizadas duas colheitas: aos 30 e 42 dias após o plantio. Verificou-se que as plantas cultivadas sob deficiência (8 mg kg-1 de P no solo) apresentaram 26,3 folhas, enquanto as cultivadas com a maior dose (64 mg kg-1 de P no solo) produziram 80,17 folhas. Aumento semelhante (201%) foi obtido para a área foliar, cujos valores variaram de 436,4 cm2a 1.313,9 cm2. Sob deficiência, a produção da massa seca total foi de apenas 1,72g, enquanto para a dose de 64 mg kg-1 de P no solo esse valor foi de 7,58g, significando um aumento de 340%. Plantas cultivadas com 8 mg kg-1 de P no solo não apresentaram flores ou frutos; já para o tratamento em que se utilizou 64 mg kg-1 de P no solo, o início do florescimento antecedeu ao das plantas cultivadas com 16 mg kg-1 de P no solo. A razão de área foliar e a área foliar específica foram maiores para as plantas cultivadas sob deficiência, enquanto a taxa de crescimento relativo e a taxa assimilatória líquida não foram estatisticamente influenciadas. Conclui-se que a deficiência de P no solo pode comprometer sobremaneira o crescimento das plantas de Physalis. Além disso, como a deficiência de P reduziu sensivelmente a produção de folhas, órgão responsável pela produção da fisalina, também é possível concluir que a deficiência de P pode, mesmo que indiretamente, reduzir a concentração desse importante composto na planta.

Abstrak Angka kejadian penyakit infeksi di Indonesia masih tinggi, dengan angka mortalitas 230 kematian per 100.000 populasi. Dampak hal tersebut adalah penggunaan antibiotik yang tidak terkendali menyebabkan resistensi obat dan multidrug resistant bahkan extensive drug resistant. Konsumsi substansi yang berfungsi imunomodulator menjadi salah satu alternatif pemecahan. Tujuan penelitian ini untuk mengetahui apakah ekstrak etanol ceplukan (Physalis angulata) yang memiliki efek imunomodulator berpengaruh pada aktivitas fagositosis makrofag intraperitoneal mencit jantan galur DDY, serta menilai optimasi dosis ekstrak etanol ceplukan dan membandingkan efeknya dengan obat herbal imunomodulator terstandar. Penelitian ini merupakan eksperimental laboratorik dengan subjek 25 ekor mencit jantan galur DDY yang dibagi lima kelompok. Setiap kelompok diberi perlakuan yang sama selama tujuh hari. Kelompok I (kontrol negatif) tidak diberikan ekstrak etanol ceplukan, kelompok II, III, dan IV diberikan ekstrak etanol ceplukan dengan dosis 12,5%, 25%, dan 50%, serta kelompok V (kontrol positif) diberikan obat herbal imunomodulator terstandar dosis 50 µL. Pada hari ke-8, dilakukan pengukuran aktivitas fagositosis makrofag intraperitoneal dengan melihat jumlah makrofag yang memfagosit biji lateks. Uji statistik yang digunakan adalah Kruskal-Wallis, Mann-Whitney, dan independent t-test. Hasil penelitian ini menunjukkan bahwa ekstrak etanol ceplukan dosis 12,5% (rata-rata: 10, SD: 11,5) dan 25% (rata-rata: 14, SD: 8,5) secara signifikan meningkatkan aktivitas fagositosis makrofag dibanding dengan kontrol negatif. Ekstrak etanol ceplukan dosis 25% tidak berbeda bermakna dibanding dengan obat imunomodulator (rata-rata: 13, SD: 8,26) (p=0,05). Simpulan, ekstrak etanol ceplukan meningkatkan aktivitas fagositosis makrofag intraperitoneal dengan dosis optimum 25% dan memiliki efek yang sama dengan obat herbal imunomodulator terstandar. Kata kunci: Aktivitas fagositosis, biji lateks, ekstrak etanol ceplukan, mencit jantan galur DDY Dossage Optimation and Comparison of Ethanol Extract of Ceplukan (Physalis angulata) to Standardized Immunomodulator Herbal Medicine on Intraperitoneal Macrophage of Male Mice DDY Strain Abstract Number of infection disease are still in Indonesia. There were 230 people died from 100,000 population. The impact is Indonesia still face uncontrolled use of antibiotic which cause multidrug resistant even extensive drug resistant. The use of immunomodulator became the alternative solutions. This study aims was to describe whether there were an ability of Physalis angulata as an immunomodulator for the activity in macropag phagocytosis in DDY male rats. It also aim to identify extract optimation and compare it with the standard herbal immunomodulator. This was an experimental study with 25 male DDY rats divided into 5 groups. Group I as control negative was not given any ceplukan ethanol extract, group II, III and IV were given ceplukan ethanol extract with 12.5%, 25% and 50% dosage respectively and group V acted as positive control fed by standard herbal immunomodulator. On the 8th day intraperitoneal macrophage phagocytosis were measured by counting the number of macrophage which consumed the latex seeds. Statistical analysis used was Kruskal-Wallis, Mann-Whitney, and independent t-test.The resuts from this study showed that ceplukan ethanol extracts with the dosage of 12.5% (mean: 10, SD: 11.5) and 25% (mean: 14; SD: 8.5) significantly increased the phagocyte activity of macrophage compared to negative control. However 25% ceplukan ethanol extracts had no significant difference compared to standar herbal immunomodulator (mean: 13; SD: 8.25, p>0.05). The conclusions are ceplukan ethanol extract increases the phagocyte activity of macrophage with optimum dosage of 25% and possess the same effect with standard herbal immunomodulator. Key words: Latex seeds, male DDY rats, phagocytes activities, physalis angulata