Search

Background The head louse, Pediculus humanus capitis , is an obligate ectoparasite and its infestation remains a major public health issue worldwide. Determining the genetic characteristics of the existing clades is essential to identify the population structure and to develop head lice-control programs. Hence, we aimed to investigate the genetic diversity of head lice among infested individuals in northern Iran. Methods Adult head lice were collected from 100 infested individuals referring to the health centers throughout five geographical regions in Mazandaran Province, Iran. Partial fragments of the mitochondrial cytb gene were amplified by PCR, then consequently sequenced. Results The results of the phylogenetic tree of collected head lice confirmed the existence of two clades, A and B, in the studied areas. Thirteen haplotypes were detected in the studied populations, of which 11 were novel haplotypes. Clade A was the dominant form and accounted for 75% of samples, while clade B included the rest. Haplotype and nucleotide diversity were 0.999 and 0.0411, respectively. Conclusions Clade A and B of Pediculus humanus capitis exist among the human populations of northern Iran. We observed high genotypic diversity of this head lice. [ABSTRACT FROM AUTHOR]

Head lice infestations significantly impact schoolchildren, with permethrin being the primary treatment. The escalation in the prevalence of the knockdown resistance (kdr) mutation, potentially affecting treatment efficacy, is highly concerning. This study examined head lice infestation prevalence, the efficacy of 1% permethrin lotion, kdr mutation frequency, and the association between kdr genotype and permethrin treatment outcomes in schoolchildren in Nonthaburi province, Thailand. Participants and lice samples were collected from six primary schools using cluster sampling. Clinical outcomes and adverse events were assessed on days 7 and 14 post-treatment. Kdr mutations (T917I) in head lice samples were analyzed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. Head lice infestation prevalence was 6.1%, with a kdr mutation frequency of 63.2% and a permethrin cure rate of approximately 50%. Multivariate regression analysis revealed the association between kdr genotype and clinical response to permethrin treatment (Odds Ratio (OR) = 13.15, p = 0.005). The presence of resistance genes hinders the cure rate (presence 35.9% versus absence 85.7%). These findings highlight the importance of the kdr genotype in predicting permethrin treatment responses in head lice infestations. Furthermore, in regions with documented reduced permethrin efficacy and a high prevalence of kdr mutations, alternative non-pyrethroid-based pediculicides should be considered. This research could help improve the control of head lice infestations, especially in problematic areas of Thailand. [ABSTRACT FROM AUTHOR]

Head lice infestation continues to be a major health problem worldwide. In order to solve this problem, frequent use of pediculocides has caused growing resistance among head lice population. This study aims to investigate the presence of the knockdown resistance (kdr) mutation in the head lice population in northern Iran. Adult head lice were collected from 115 infested individuals referring to the health centers in different parts of Mazandaran province, northern Iran. 38 samples were randomly selected, and Polymerase chain reaction (PCR) was used to amplify a 332-bp and ⁓ 900-bp fragment of the α-subunit of the voltage-sensitive sodium channel (VSSC) gene. According to the analysis of a 332-bp fragment of the VSSC gene, the frequency of kdr T917I mutation including homozygous susceptible (SS), heterozygous resistant (RS), and homozygous resistant (RR) were 45.83%, 12.5%, and 41.66%, respectively. The total frequency of the resistance allele was 54.16%. The results of the 900-bp fragment of the VSSC gene showed two new mutations in the IIS1-2 extracellular loop (H813P) and IIS2 (S825R) and old well-known kdr mutations (M815I–T917I–L920F). The results of Hardy-Weinberg's exact equilibrium test showed that the frequency of genotypes in the studied areas is different from expectations. Moreover, a positive inbreeding coefficient value (Fis>0) was found in studied areas which indicated an excess of homozygotes. Overall, the results showed a high frequency of resistant alleles in the northern region of the country. Therefore, it is necessary to develop appropriate control programs for the treatment of pediculosis. [ABSTRACT FROM AUTHOR]

Objective:Head lice infestation (HLI), caused by Pediculus humanus capitis, is an important public health problem worldwide, especially in primary school children. The aim of this study is to investigate HLI level, related factors, and families’ knowledge levels and attitudes about HLI in two primary schools in a relatively low socio-economic region in İstanbul.Methods:A questionnaire on HLI was developed initially and delivered to all children and parents in the school. A total of 340 primary school students, aged between 6-12, were enrolled in the study after the consent of their parents. Their hair were examined for HLI with special combs at their schools, and free anti-lice shampoos were given to parents of positive children. A total of 951 completed questionnaires were received and evaluated with chi-square test using the SPSS® 17.0 program, and the differences of p0.05).Conclusion:HLI is still a common health problem, especially in girls in primary schools. Parents are aware of the relationship between the hygiene and prevention against HLI, but low socio-economic resources seem to be important determinants. Regular combing and training activities in primary schools, in coordination with the local authorities and parents are no doubt useful in reducing the incidence of HLI among the children.

Background and Objectives: The head louse Pediculus humanus capitis is a cosmopolitan ectoparasite that causes pediculosis. In the study of human lice, little research focuses on embryonic development. Currently, external markers of embryonic development represent a new approach in the evaluation of ovicidal drugs. The objective of this work was to update the morphology of embryonic development and propose novel external markers to differentiate between early, medium, or late P. h. capitis eggs. Methods: Using stereoscopic light microscopy, we describe the morphological characteristics of P. h. capitis eggs with a special focus on embryonic development. Results: The morphological analysis of the eggs revealed the presence of an operculum with ten aeropyles, although no micropyles were observed. For the first time, the presence of defective eggs that were non-viable due to the apparent absence of yolk granules was documented. The early eggs presented yolk granules and developing germ bands, while the medium eggs presented an embryonic rudiment and the outlines of the eyes and limbs. In late eggs, the head with eyes and antennae, the thorax with three pairs of legs, and the abdomen with six pairs of spiracles were observed as formed structures. At the end of this stage, the embryos acquired the morphology of the nymph I stage. Conclusion: We propose novel biomarkers (e.g., the presence of spiracles and antennae, the proportion of the egg occupied by the embryo) to facilitate the differentiation between the developmental stages. The updated morphological characteristics of P. h. capitis eggs facilitate the standardization of toxicological tests in the quest for ovicidal drugs. [ABSTRACT FROM AUTHOR]

Abstract Background Head louse infestation is an important public health problem, and expanding resistance to permethrin is a major challenge to its control. The mapping and detection of pyrethroid resistance are essential to the development of appropriate treatments and ensure the effectiveness of current measures. The aim of this study was to present the phenotypic and genotypic basis of permethrin resistance and identify knockdown resistance (kdr) mutations in head louse populations in northwestern Iran. Methods Adult head lice were collected from 1059 infested girls in Ardebil, East Azerbaijan, West Azerbaijan and Zanjan Provinces, northwestern Iran. The toxicity of permethrin and the possible synergistic effect of piperonyl butoxide (PBO) on this toxicity were assessed using bioassays. Fragments of voltage-sensitive sodium channels (vssc) and cytochrome b (cytb) genes were amplified and analyzed for the detection of knockdown resistance (kdr) mutations and mitochondrial groups. Moreover, genotypes of the two hot spot regions of the vssc gene were determined by melting curve analysis of amplicons. Results A total of 1450 adult head lice were collected during 2016–2021. Live lice were exposed to a dose of 1% permethrin for 12 h, and the median lethal time (LT50) and time to achieve 90% mortality (LT90) were determined to be 6 and 14.8 h, respectively. Topical application of 2 and 16 ng permethrin per louse resulted in 25% and 42.11% mortality, respectively. Pre-exposure of samples to 3% piperonyl butoxide had no synergistic effect on the effects of permethrin. Analysis of the 774-bp vssc gene fragment showed the presence of the M815I, T917I and L920F mutations, wild-type and T917I mutation, in 91.6%, 4.2% and 4.2% of samples, respectively. Investigation of the mitochondrial cytb gene demonstrated the predominance of clade B. The frequency of domain II segment 4 (S4)-S5 kdr genotypes in mitochondrial groups was identical, and heterozygotes were present in 93.5% of samples. A significant difference was detected in the frequency of domain IIS1-S3 kdr genotypes, and the frequency of resistant alleles and heterozygotes was higher in clade B than in clade A. Conclusions The presence of kdr mutations in the vssc gene and the non-synergist effect of PBO indicate that pyrethroid target site insensitivity is the main resistance mechanism. This phenomenon and the high frequency of resistant alleles necessitate that new pediculosis management programs be developed. Further studies need to be conducted to identify all factors contributing this resistance and to develop alternative pediculicides. Graphical Abstract

Background: Head louse females secrete liquid gel, which is mainly composed of the louse nit sheath protein 1 (LNSP1) and LNSP2, when they lay eggs. The gel is crosslinked by transglutaminase (TG) to form the nit sheath, which covers most of the egg except the top operculum area where breathing holes are located. Knowledge on the selective mechanism of nit sheath solidification to avoid uncontrolled crosslinking could lead to designing a novel method of louse control, but no information is available yet. Methods: To elucidate the crosslinking mechanisms of nit sheath gel inside the reproductive system of head louse females, in situ hybridization in conjunction with microscopic observation of the oviposition process was conducted. Results: Histochemical analysis revealed that LNSP1 and LNSP2 are expressed over the entire area of the accessory gland and uterus, whereas TG expression site is confined to a highly localized area around the opening of posterior oviduct. Detailed microscopic observations of oviposition process uncovered that a mature egg is positioned in the uterus after ovulation. Once aligned inside the uterus, the mature egg is redirected so that its operculum side is tightly held by the ventral end of the uterus being positioned toward the head again and its pointed bottom end being positioned toward the dorsal end of the uterus, which functions as a reservoir for the nit sheath gel. Conclusions: Physical separation of the TG-mediated crosslinking site from the ventral end of the uterus is necessary to avoid uncontrolled crosslinking inside the uterus and to ensure selective crosslinking over only the lower part of egg without any unwanted crosslinking over the operculum during oviposition. [ABSTRACT FROM AUTHOR]

Background Head louse infestation is an important public health problem, and expanding resistance to permethrin is a major challenge to its control. The mapping and detection of pyrethroid resistance are essential to the development of appropriate treatments and ensure the efectiveness of current measures. The aim of this study was to present the phenotypic and genotypic basis of permethrin resistance and identify knockdown resistance (kdr) mutations in head louse populations in northwestern Iran. Methods Adult head lice were collected from 1059 infested girls in Ardebil, East Azerbaijan, West Azerbaijan and Zanjan Provinces, northwestern Iran. The toxicity of permethrin and the possible synergistic efect of piperonyl butoxide (PBO) on this toxicity were assessed using bioassays. Fragments of voltage-sensitive sodium channels (vssc) and cytochrome b (cytb) genes were amplifed and analyzed for the detection of knockdown resistance (kdr) mutations and mitochondrial groups. Moreover, genotypes of the two hot spot regions of the vssc gene were determined by melting curve analysis of amplicons. Results A total of 1450 adult head lice were collected during 2016–2021. Live lice were exposed to a dose of 1% permethrin for 12 h, and the median lethal time (LT50) and time to achieve 90% mortality (LT90) were determined to be 6 and 14.8 h, respectively. Topical application of 2 and 16 ng permethrin per louse resulted in 25% and 42.11% mortality, respectively. Pre-exposure of samples to 3% piperonyl butoxide had no synergistic efect on the efects of permethrin. Analysis of the 774-bp vssc gene fragment showed the presence of the M815I, T917I and L920F mutations, wild-type and T917I mutation, in 91.6%, 4.2% and 4.2% of samples, respectively. Investigation of the mitochondrial cytb gene demonstrated the predominance of clade B. The frequency of domain II segment 4 (S4)-S5 kdr genotypes in mitochondrial groups was identical, and heterozygotes were present in 93.5% of samples. A signifcant diference was detected in the frequency of domain IIS1-S3 kdr genotypes, and the frequency of resistant alleles and heterozygotes was higher in clade B than in clade A. Conclusions The presence of kdr mutations in the vssc gene and the non-synergist efect of PBO indicate that pyrethroid target site insensitivity is the main resistance mechanism. This phenomenon and the high frequency of resistant alleles necessitate that new pediculosis management programs be developed. Further studies need to be conducted to identify all factors contributing this resistance and to develop alternative pediculicides. [ABSTRACT FROM AUTHOR]

Head lice, Pediculus humanus capitis De Geer (Psocodea: Pediculidae) that failed to respond to pyrethroid insecticide-based treatment products were first identified in London and Cambridge, UK, in 1993 after which reports of treatment failure arose throughout the UK. There was a need amongst healthcare workers for a rapid detection method for resistance that could be used at the community level. A laboratory service was set up so that health professionals could send lice by overnight post for bioassay testing for resistance. In addition, test kits were provided so that testing could either be conducted on site or lice could be shipped to the laboratory on pre-treated test papers so that insecticide exposure could proceed while lice were in transit to the laboratory. Between 1994 and 1999, over 350 samples from 145 locations were tested and during this time populations of lice resistant to pyrethroids, malathion, and carbaryl were identified from all parts of the country, both urban and rural. In some areas, lice were only resistant to one of the insecticides available but in other places lice showed tolerance to all three insecticides used at the time. [ABSTRACT FROM AUTHOR]

Background: Head lice, or head pediculosis, is a parasitosis considered a serious public health problem that affects mainly resource-limited countries. Objective: To describe epidemiological aspects of the pediculosis capitis in Minas Gerais, in Brazil. Method: This systematic review was conducted through the standards established by the Preferred Reporting Items in Systematic Reviews and Metanalyses (PRISMA). PubMed, LILACS, and SciELO databases, as well as the gray literature, were searched. Results: Nine of 1,167 studies were included, published between 1988 and 2019. These studies reported a total prevalence of parasitosis that ranged from 1.4% to 57.4%. The prevalence of head lice ranged from 0.0% to 66.7% for males and 2.3% to 57.4% for females, thus being higher in black-skinned people (1.4% to 40.3%). Regarding age, the highest prevalence was 10-12 years old (45.3%). As for the characteristics of the hair, there was a greater infestation in people with long (16.0% to 79.5%), wavy (0.0% to 44.7%), dark (0.0% to 36.6%), with low capillary density (35.4%), and thick hair (39.2%). Conclusion: Head pediculosis affects both sexes, different ages, and races, representing an important health problem in Minas Gerais, not only due to the presence of ectoparasite but also to the secondary complications that can be generated from this parasitism. [ABSTRACT FROM AUTHOR]

Pediculosis capitis is a disease caused by head lice infestation (Pediculus humanus capitis). This disease is often overlooked because it does not cause fatal symptoms but can interfere concentration and activities of the affected individual. Infestation of parasite often affects a group of children in an orphanage, dormitory or boarding school. The purpose of this activity is to carried out at the Al-Muslimun Islamic Boarding School in Muda Setia Village, Bandar Seikijang District, Pelalawan, Riau Province. The target audience is students of tsanawiyah totaling 178 students. On examination, 93% were positive for pediculosis capitis. The students were given treatment of permethrin 1% and counseling in the form education on how to prevent and eradicate the disease. In addition to students, education is also given to musyrifah. It is hoped that students who have received treatment and education can receive and apply the knowledge gained so that can eradicate the disease.

Abstract Background Head lice, or head pediculosis, is a parasitosis considered a serious public health problem that affects mainly resource-limited countries. Objective To describe epidemiological aspects of the pediculosis capitis in Minas Gerais, in Brazil. Method This systematic review was conducted through the standards established by the Preferred Reporting Items in Systematic Reviews and Metanalyses (PRISMA). PubMed, LILACS, and SciELO databases, as well as the gray literature, were searched. Results Nine of 1,167 studies were included, published between 1988 and 2019. These studies reported a total prevalence of parasitosis that ranged from 1.4% to 57.4%. The prevalence of head lice ranged from 0.0% to 66.7% for males and 2.3% to 57.4% for females, thus being higher in black-skinned people (1.4% to 40.3%). Regarding age, the highest prevalence was 10-12 years old (45.3%). As for the characteristics of the hair, there was a greater infestation in people with long (16.0% to 79.5%), wavy (0.0% to 44.7%), dark (0.0% to 36.6%), with low capillary density (35.4%), and thick hair (39.2%). Conclusion Head pediculosis affects both sexes, different ages, and races, representing an important health problem in Minas Gerais, not only due to the presence of ectoparasite but also to the secondary complications that can be generated from this parasitism.

Lice represent one of the most neglected group of vectors worldwide, particularly in Latin America. Records of bacterial agents related to head lice are non‐existent in this region of the continent. Many of these communities often do not have adequate access to public services and/or health protection. The normalization of this condition prevents them from manifesting discomfort, such as bites and itching, which further aggravates the situation, as they can be vectors of important diseases. For this reason, the aim of this work was to identify the richness of bacterial pathogens (Acinetobacter, Bartonella, and Rickettsia) and endosymbionts (Wolbachia) in head lice of paediatric patients from the indigenous municipality of Hoctun, Yucatan, Mexico. DNA extraction was performed using the QIAamp DNA Mini Kit. For the detection of bacterial pathogens, fragments of the gltA, rpoB, and 16S rDNA genes were amplified. For the detection of Wolbachia, the wsp gene was amplified. Of the 28 lice analysed, the presence of two genera of bacterial pathogens was detected Acinetobacter (42.9% = 12/28) and Bartonella (7.14% = 2/28). We also detected the endosymbiont Wolbachia (71.42% = 20/28). Our results showed that DNA from three bacteria species (Acinetobacter baumannii, Bartonella quintana, and Wolbachia pipientis) was present with frequencies ranging from 3.57% to 71.42%. This work represents the first exploratory study of the diversity of agents associated with head lice (Pediculus humanus capitis) in Mexico and Latin America. Due to the findings generated in the present study, it is important to perform surveillance of head lice populations to identify the degree of spread of these pathogens and their impact on populations in the region. [ABSTRACT FROM AUTHOR]

Pediculus humanus capitis (head louse), which causes pediculosis capitis, remains a global health concern. Plant products are efficient alternative pediculicides for treating the human ectoparasite P. h. capitis which is resistant to permethrin. The study evaluates the toxicity and mechanisms of 6-gingerol and Cymbopogon citratus leaf extract on P. h. capitis. Pediculus humanus capitis adult stages were exposed to three different dosages of 6-gingerol and C. citratus crude leaf extract on filter sheets for 5, 10, and 30 min, respectively. The biochemical approach was used to assess the activity of detoxifying enzymes including acetylcholinesterase (AChE), glutathione S-transferase (GST), and oxidase. Scanning electron microscope (SEM) was used to investigate the ultrastructure of the morphological body of lice. After 30 min, 6-gingerol and C. citratus leaf extract killed P. h. capitis completely. Bioassay periods significantly affected lice mortality (P < 0.05). The LC 50 values for 6-gingerol and C. citratus extract were 1.79 μg/cm 2 and 25.0 μg/cm 2 , respectively. 6-Gingerol and C. citratus leaf extract significantly lower AChE and GST activity (P < 0.05). Cymbopogon citratus also caused morphological ultrastructure changes in P. h. capitis, including an irregularly formed head, thorax, abdominal respiratory spiracles, and belly. 6-Gingerol and C. citratus leaf extracts could be used as an alternate pediculicide to decrease P. h. capitis populations., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier Ltd.)

Abstract Background The male genital structures of arthropods are key features in the taxonomic and phylogenetic study of these organisms. The male genitalia of the head louse Pediculus humanus capitis are complex organs which are partly composed of structures that dynamically extrude during copulation. Methods Here, we describe the morphology of the genitalia of P. humanus capitis at the copulation stage, and at rest, by using stereoscopic microscopy, confocal laser scanning microscopy (CLSM), and scanning electron microscopy (SEM). Results CLSM and SEM images revealed that the vesica is composed of two distinct anatomical parts, the proximal lobe and the distal lobe. Both lobes have short and narrow spines, as well as long and wide scales with either sharp or rounded tips. The rounded scales vary in size and have a wavy base and rounded tips, and thus resemble a tongue in appearance. We identified a gland-like area on the penis with 11 shallow circular depressions, and a flat area with 14–16 exit orifices. The apical end of the penis has a foliaceous trifurcation and serves to expel the contents of the ejaculatory duct. These characteristics were recorded for all the specimens analyzed, indicating that these structures are highly conserved; to our knowledge, they have not been previously reported for any suborder of lice. Conclusions To the best of our knowledge, our results reveal for the first time the morphological details, and complexity, of the male genitalia of the head louse P. humanus capitis at different stages of copulation. The new approach described here provided information that should be taken into consideration in future research on the genitalia of lice. Application of this approach will also impact the taxonomic and phylogenetic study of other insect taxa. Graphical Abstract

Background and Aim: Pediculus humanus capitis, the human head louse, remains a global health problem. This study evaluated the resistance of head lice to permethrin and 6-paradol mediated by in vitro detoxification enzyme activity experiments and to describe physical changes in the lice using scanning electron microscopy (SEM). Materials and Methods: The adult stages of P. h. capitis were collected from patients exposed to 1% permethrin and three different concentrations of 6-paradol (0.00005%, 0.0001%, and 0.00015%) using a filter paper diffusion bioassay. Healthy P. h. capitis adults served as the control. The in vitro bioassays were conducted after 10, 20, 30, and 60 min of exposure. The activities of acetylcholinesterase (AChE), glutathione S-transferase (GST), and oxidase were analyzed. Physical changes in the lice were analyzed using SEM. Results: Permethrin and 6-paradol exhibited low toxicity against the lice. At 60 min, 1% permethrin had killed 36.7% of the lice present, while 6-paradol had killed 66.7-86.7%. Permethrin induced significantly elevated AChE, GST, and oxidase activity; 6-paradol also caused significantly elevated AChE, GST, and oxidase activity. Permethrin did not cause any ultrastructural morphological changes on the lice, while 6-paradol severely damaged the head, thorax, respiratory spiracles, and abdomen of the dead lice. Conclusion: This in vitro experimental of P. h. capitis is the first study to report P. h. capitis in East Jakarta shows complete resistance to permethrin and 6-paradol, and to describe the associated increase in AChE, GST, and oxidase activity. It was observed that 6-paradol severely damaged the head, thorax, respiratory spiracles, and abdomen of the dead lice.

Pediculosis is a growing social problem in both developed and undeveloped countries. Resistance to chemical treatments and toxicity of insecticidal compounds are reasons why alternative medications should be proposed for this parasitic infestation. This study attempted to investigate traditional anti-lice treatments, and draw together scientific insights into lice management through the study of Persian Medicine manuscripts. Lice infestation formulations were searched in seven traditional textbooks (al-Manṣuri fi al-ṭibb, al-Qanun fi al-ṭibb, Kamil al-ṣina‘ah al-ṭibbiyah, Qarabadin Kabir, Qarabadin Salehi, Makhzan al-Adviyeh, Eksir Azam) pertaining to one millennium period, from the 9th to 19th century. Twenty multi-component medications were selected for the study of ingredients and their active compounds. PubMed, Google Scholar, and Scopus were searched to find pediculicidal or insecticidal evidence. In vitro studies and clinical trials reporting anti-lice and/or insecticidal activities were summarized. Formulations had four kinds of base (oil, vinegar, alcohol, or water). Oils act through occluding the respiratory spiracles of lice. Vinegar loosens the attachment between nits and hair shaft, improving the removal of nits from hair. Essential oil- and tannin-containing plants made up the majority of anti-lice components in the current study. Seventeen out of twenty-seven medicinal plants were reported to have pediculicidal and/or insecticidal activity. Considering the results, further investigation leads to the designing new treatments against pediculosis.

Several studies have documented the presence of Acinetobacter baumannii, a known multi-drug-resistant pathogen, in the human head louse, Pediculus humanus capitis. Since no reports from countries in Latin America have been published, the aim of the present study was to determine whether A. baumannii was present in head lice specimens collected in this geographic region. Head lice specimens from Argentina, Colombia, and Honduras were analyzed. PCR assays were performed to confirm the specimens’ species and to investigate whether the DNA of A. baumannii was present. The products of the latter were sequenced to confirm bacterial identity. Altogether, 122 pools of head lice were analyzed, of which two (1.64%) were positive for A. baumannii’s DNA. The positive head lice had been collected at the poorest study site in Honduras. The remaining specimens were negative. This study is the first to report the presence of A. baumannii in human head lice from Latin America. Further investigations are required to elucidate whether these ectoparasites can serve as natural reservoirs or even effectively transmit A. baumannii to humans.

The head louse Pediculus humanus capitis (De Geer) is a hematophagous ectoparasite that inhabits the human scalp. The infestations are asymptomatic; however, skin irritation from scratching occasionally may cause secondary bacterial infections. The present study determined the presence and frequency of the knockdown resistance (kdr) mutation T929I in 245 head lice collected from Mexico, Peru, and Canada. Head lice were collected manually using a comb in the private head lice control clinic. Allele mutation at T9291 was present in 100% of the total sampled populations (245 lice) examined. In addition, 4.89% of the lice were homozygous susceptible, whereas 6.93% heterozygous and 88.16% homozygous were resistant, respectively. This represents the second report in Mexico and Quebec and fist in Lima. [ABSTRACT FROM AUTHOR]

Abstract Pediculosis mainly affects school-age children worldwide. The aim of this study was to identify and analyze the knowledge of the parents and guardians of children in elementary schools in Niterói, Brazil, regarding pediculosis. Questionnaires were applied to 237 guardians of children at five 1-5 grade municipal schools. The responses were analyzed and correlated with positivity to louse infestation, detected by scalp aspiration. 73.8% of the respondents reported that their child had already been infested with lice. 32.9% presented correct responses about transmission. Incorrect responses were attributed to the air/wind, blood type and the fact that lice jump and fly. 40.1% of the respondents erroneously correlated control over the parasitosis with hygiene. A majority of the participants (58.6%) responded that pediculosis is harmful to health, while a small proportion (20.7%) considered it to be a disease. The prevalence of pediculosis was 19.8% among schoolchildren. Female sex, pruritus on the head and indifference regarding infestation were shown to be risk factors for pediculosis. The lack of perception of pediculosis as a disease may lead to naturalization of this parasitosis. Incorrect responses may add difficulty to implementation of preventive and curative approaches, which highlights the importance of dissemination of correct information about pediculosis.

Copyright of Diyala Journal of Medicine is the property of Republic of Iraq Ministry of Higher Education & Scientific Research (MOHESR) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Objective: This article reviews the pharmacology, safety, efficacy, and clinical importance of abametapir 0.74% (Xeglyze) for the treatment of head lice. Data Sources: From 2020 to May 2021, a systematic review of the MEDLINE and EMBASE databases was conducted using the terms abametapir, Xeglyze, Ha44, and head lice. Bibliographies, Food and Drug Administration (FDA) drug package inserts, and ClinicalTrials.gov were searched for further information. Study Selection and Data Extraction: All relevant full-text articles in English were considered for inclusion, with a final article date range of 1999 to 2020. Data Synthesis: Abametapir chelates heavy metal cations and inhibits metalloproteinases critical to louse ova development, hatching, and adult survival. In phase II, abametapir had direct ovicidal activity inhibiting 100% of treated louse eggs from hatching, compared with 64% in the vehicle-treated group. In two identical phase III clinical trials, subjects treated with a single 10-minute application of abametapir had greater treatment success compared with vehicle-treated subjects, with 81.1% success versus 50.9% in study 1 (P = 0.001) and 81.8% versus 47.2% in study 2 (P < 0.001). Abametapir was well tolerated, with only mild adverse effects. Relevance to Patient Care and Clinical Practice: Abametapir is a newly FDA-approved, single-application treatment for head lice in patients aged 6 months and older. This review highlights the safety and efficacy of abametapir in the treatment of head lice. Conclusions: In the wake of increasing widespread resistance to first-line treatment options, abametapir offers a safe and effective new treatment option for head lice infestations. [ABSTRACT FROM AUTHOR]

Background: The association between man and the head lice is one of the oldest relationship and its history return to 10000 years ago. Blood sucking head lice belong to Kingdom Animalia, Class: Insecta, Order: Phiroptera, Family: Pediculidae, Genus: Pediculus, Species: humanus and Subspecies: capitis that’s obligate parasite on human this highly specialized to suck blood and close association with their host where completed its entire life cycle. Objective: To determine the rate of infestation by the head lice, Pediculus humanus capitis and its associated factors among primary school children in Erbil City. Patients and Methods: A case control study was conducted on the twenty two (22) randomly selected primary school in the center of Erbil city. For this purpose, a total of 1082 students (430 boys and 652 girls) were examined from first to sixth stage (age ≥6 years old) during 1st October 2020 to 31th May 2021. Personal requested information was recorded by student parents in a questionnaire form. Results: An overall prevalence of infestation of 25.5% (276/1082) was recorded in the present study. Study reveals the existence of a significant relationship age [6 and < 9 years old , 178/759 (23.5%), and ≥ 9 years old, 98/323 (30.3%), P = 0.0174], gender [girls, 215/652 (33%) and boys, 61/430 (14.2%), P < 0.001], education level of parent (educated family, 146/694 (21%) and none educated family, 130/388 (33.5%), P < 0.001], longevity of hair [ long hair, 157/473 (33.2%) and short hair 119/609 (19.5%), P < 0.001] hair washing frequency [daily washing, 243/587 (41.4%), and weekly washing 33/495 (6.7%), P < 0.001], hair combing condition [common comb user,165/499 (33%) and special comb user, 111/583 (19%), P < 0.001] and sleeping habitat [ sleeping together 222/693 (32%) and sleeping habitat alone, 54/389 (13.9%), P < 0.001]. There’s no significant existence related to density of students in classroom [ one student per table, 114/486 (23.5%) and sitting in pair, 162/596 (27.2%), P = 0.1621], hair type, smooth and wrinkle [smooth hair, 183/741 (24.7%), 93/341 (27.3), P = 0.366] and head lice infestation. Conclusion: We concluded that head lice infestation rate was varied depending on the several physio and socioeconomic factors including, age, gender, type of hair, education level of parents, frequency of hair washing, sleeping habitat and condition of hair combing. Among variables, only density of pupils in classroom, smooth and wrinkled hair show no any significant relationship with pediculosis capitis (P- value = 0.1621 and P –value = 0.366 respectively).

Pediculosis capitis is an ectoparasitosis in which Pediculus humanus capitis (Phthiraptera: Anoplura) infest the human scalp. Infestation is confirmed by the presence of adults, nymphs, or viable eggs (nits). The unhatched eggs of head louse is occupied with an embryo, brownish, and has ovoid construction with a curved end. Nit can be misdiagnosed with hair cast, which are thin, amorphous, extended, whitish cylindrical structure, and freely moveable along the hair shaft. It is very important to correctly differentiate pediculosis from hair cast to avoid anxiety and unnecessary treatment. The purpose of this study is to describe three hair cast and seven pediculosis cases in Dezful health center, southwest Iran. This is a study of ten cases reported in our laboratory in 2017. For each case, microscopic and entomological examination of the hairs were performed. The patients were ten women including eight children and two adults. Clinical signs included itching and skin color changes in all the cases. Microscopic examination showed nits anchored to the hair in seven cases. In the other three cases, the initial diagnosis was confirmed to be hair cast. In all pediculosis cases, the diagnosis of cases was confirmed by entomological examination of hairs, which revealed the presence of nit forms of P. humanus capitis. Differentiation of pediculosis from hair cast can avoid apprehension and pointless treatment. [ABSTRACT FROM AUTHOR]

Abstract Background The head louse, Pediculus humanus capitis, is the most important ectoparasite causing many health problems. Several linkages are presented for this parasite, each representing a particular geographical distribution, prevalence rate, vector competence, susceptibility to pediculicides, and infestation rate. Determining the genetic nature of these linkages is necessary to identify the population structure and also to develop and monitor control programmes against head lice. This study was designed to analyse cox1 and cytb genes and determine the mitochondrial clades in head lice populations in the northwest of Iran. Methods Adult head lice were collected from infested females of Ardabil, East and West Azerbaijan, and Zanjan Provinces from 2016 to 2018. Partial fragments of the mitochondrial genes cox1 and cytb were amplified by PCR and some of the amplicons were sequenced. All confirmed sequences were analysed, and the frequency of each mitochondrial clade was determined in the studied areas. Results A total of 6410 females were clinically examined, and 897 adult head lice were collected from 562 infested cases. Genomic DNA was extracted from 417 samples, and fragments of cox1 and cytb genes were amplified in 348 individuals. Analysis of the 116 sequences showed the 632-bp and 495-bp fragments for cox1 and cytb genes, respectively. The nucleotide and haplotype diversities of cytb and cox1 genes were 0.02261 and 0.589 and 0.01443 and 0.424, respectively. Sequence analysis indicated 6 haplotypes clustered in two clades, A and B. The relative prevalence of clade B was 73% for cytb and 82% for cox1 gene. Haplotypes of clade B were found in all the studied areas, while those of clade A were observed only in rural and suburban areas. Conclusions To our knowledge, this is the first study investigated deeply the field populations of Pediculus and documented two clades in the Middle East. The considerable prevalence of pediculosis in the studied areas requires authorities’ attention to establish effective control and preventive measures. Given the role of cytb in monitoring population groups, application of this marker is suggested for future epigenetic studies to evaluate the factors affecting the abundance of these clades.

Pedikulosis kapitis merupakan penyakit parasitik yang masih sering terjadi dan terabaikan. Gejala klinis dari penyakit ini berupa gatal di kepala yang dapat mengganggu aktivitas sehari-hari. Panti Asuhan merupakan tempat yang berisiko untuk terjadinya infestasi parasit tersebut. Kegiatan ini bertujuan untuk mengetahui angka kejadian infestasi Pediculus humanus capitis, melakukan pendidikan kesehatan berupa penyuluhan dan pelatihan untuk mencegah penyakit tersebut serta melakukan penatalaksanaan pada anak yang terinfestasi dengan kutu kepala. Kegiatan ini dilakukan di Panti Asuhan Desa Pandau Jaya, Kecamatan Siak Hulu Kabupaten Kampar. Khalayak sasaran adalah semua anak-anak dan pengurus panti yang berjumlah 60 orang dan sasaran khusus yaitu anak-anak panti yang berjumlah 54 orang. Terdapat 22 (40,7%) anak yang terinfestasi Pediculus humanus capitis. Anak-anak yang terinfestasi ditatalaksana dengan permethrin 1% yang diberikan melalui kakak/ibu asuh. Selain itu juga diberikan sisir serit, satu anak satu sisir serit. Setelah dilakukan edukasi dan pelatihan, anak-anak serta pengurus panti diharapkan dapat menerapkan ilmu yang didapat untuk memberantas penyakit tersebut.

Abstract Background The human head louse, Pediculus humanus capitis, is a cosmopolitan blood-sucking ectoparasite affecting mostly schoolchildren in both developed and developing countries. In Honduras, chemical pediculicides are the first line of treatment, with permethrin as their main active ingredient. Despite the extended use of these products, there is currently no research investigating insecticide resistance in Honduran head lice. In head lice, the most common mechanism is knockdown resistance (kdr), which is the result of two point mutations and the associated amino acid substitutions, T917I and L920F, within the voltage-sensitive sodium channel (VSSC). Methods Genomic DNA was extracted from 83 head lice collected in the localities of San Buenaventura and La Hicaca, Honduras. Polymerase chain reaction (PCR) was used to amplify a 332-bp fragment of the VSSC gene that contains a site affected by C/T mutation which results in a T917I amino acid substitution on each human head louse genomic DNA fragments. Results The C/T non-synonymous mutation which results in the T917I kdr amino acid substitution was detected in both head lice populations at frequencies ranging between 0.45–0.5. Globally, the frequency of this substitution was 0.47. Of these, 5 (6.1%) were homozygous susceptible and 78 (93.9%) were heterozygotes. The kdr-resistant homozygote (RR) was not detected in the studied populations. Thus, 93.9% of the head lice collected in Honduras harbored only one T917I allele. Exact test for the Hardy-Weinberg equilibrium for both localities showed that genotype frequencies differed significantly from expectation. In addition, San Buenaventura and La Hicaca populations had an inbreeding coefficient (Fis) < 0, suggesting an excess of heterozygotes. Conclusions To our knowledge, this is the first study showing the presence of the C/T mutation responsible of the T917I kdr allele associated with pyrethroid resistance in P. h. capitis from Honduras. The PCR-restriction fragment length polymorphism (RFLP) employed here has demonstrated to be a reliable, economic, and reproducible assay that can be used to accurately genotype individual head lice for the mutation encoding the resistance-conferring T917I amino acid substitution. This highlights the necessity of proactive resistance management programmes designed to detect pyrethroid mutations before they become established within populations of head lice.

Background and Aim: Pediculus humanus capitis has been prevalent throughout the world, especially in developing countries among elementary students and societies with a weak socio-economic status. This study aimed to forecast head lice (Pediculidae: P. capitis) infestation incidence hotspots based on spatial correlation analysis in Ardabil Province, Northwest Iran. Materials and Methods: In this retrospective analytical study, all cases of head lice infestations who were confirmed by Centers for Disease Control office have been studied from 2016 to 2018. Head lice infestation incidence hotspots in the province should be detected based on general G statistics in ArcMap GIS10.4.1. Furthermore, MaxEnt.3.3.3 model was used for modeling the high-risk areas. Results: The prevalence rate of pediculosis was 14.90/100,000 populations. The general G statistics revealed that the head lice infestation in this study area has a high cluster pattern. The analysis showed that the Parsabad and Germi counties were identified as a head lice infestation incidence hotspots. Statistical and spatial analyses of head lice infestation incidence showed a significant positive correlation with head lice infestation incidence hotspots and the altitudes (15-500 m), annual temperature range (14-16.5°C), and slope and average diurnal temperature (12-18°C). Conclusion: The results of this study showed that the most ecologically suitable areas of head lice occurrence were identified in two hotspots (Parsabad and Germi) in the Northern areas of Ardabil Province (Parsabad and Germi counties); in the borderline of Iran and the Republic of Azerbaijan.

Background: The male genital structures of arthropods are key features in the taxonomic and phylogenetic study of these organisms. The male genitalia of the head louse Pediculus humanus capitis are complex organs which are partly composed of structures that dynamically extrude during copulation. Methods: Here, we describe the morphology of the genitalia of P. humanus capitis at the copulation stage, and at rest, by using stereoscopic microscopy, confocal laser scanning microscopy (CLSM), and scanning electron microscopy (SEM). Results: CLSM and SEM images revealed that the vesica is composed of two distinct anatomical parts, the proximal lobe and the distal lobe. Both lobes have short and narrow spines, as well as long and wide scales with either sharp or rounded tips. The rounded scales vary in size and have a wavy base and rounded tips, and thus resemble a tongue in appearance. We identified a gland-like area on the penis with 11 shallow circular depressions, and a flat area with 14–16 exit orifices. The apical end of the penis has a foliaceous trifurcation and serves to expel the contents of the ejaculatory duct. These characteristics were recorded for all the specimens analyzed, indicating that these structures are highly conserved; to our knowledge, they have not been previously reported for any suborder of lice. Conclusions: To the best of our knowledge, our results reveal for the first time the morphological details, and complexity, of the male genitalia of the head louse P. humanus capitis at different stages of copulation. The new approach described here provided information that should be taken into consideration in future research on the genitalia of lice. Application of this approach will also impact the taxonomic and phylogenetic study of other insect taxa. [ABSTRACT FROM AUTHOR]

Background and Aim: Pediculus humanus capitis, the human head louse, remains a global health problem. This study evaluated the resistance of head lice to permethrin and 6-paradol mediated by in vitro detoxification enzyme activity experiments and to describe physical changes in the lice using scanning electron microscopy (SEM). Materials and Methods: The adult stages of P. h. capitis were collected from patients exposed to 1% permethrin and three different concentrations of 6-paradol (0.00005%, 0.0001%, and 0.00015%) using a filter paper diffusion bioassay. Healthy P. h. capitis adults served as the control. The in vitro bioassays were conducted after 10, 20, 30, and 60 min of exposure. The activities of acetylcholinesterase (AChE), glutathione S-transferase (GST), and oxidase were analyzed. Physical changes in the lice were analyzed using SEM. Results: Permethrin and 6-paradol exhibited low toxicity against the lice. At 60 min, 1% permethrin had killed 36.7% of the lice present, while 6-paradol had killed 66.7-86.7%. Permethrin induced significantly elevated AChE, GST, and oxidase activity; 6-paradol also caused significantly elevated AChE, GST, and oxidase activity. Permethrin did not cause any ultrastructural morphological changes on the lice, while 6-paradol severely damaged the head, thorax, respiratory spiracles, and abdomen of the dead lice. Conclusion: This in vitro experimental of P. h. capitis is the first study to report P. h. capitis in East Jakarta shows complete resistance to permethrin and 6-paradol, and to describe the associated increase in AChE, GST, and oxidase activity. It was observed that 6-paradol severely damaged the head, thorax, respiratory spiracles, and abdomen of the dead lice. [ABSTRACT FROM AUTHOR]

O presente artigo tem como foco relatar e discutir a atividade realizada em uma escola da periferia da cidade de Araucária-PR. O objetivo da atividade foi transmitir os conhecimentos sobre a pediculose, com ênfase no combate e prevenção, e desmistificar informações que vêm do conhecimento popular referentes a estas temáticas. O teatro foi a metodologia aplicada e apresentada para um total de 145 crianças, do pré-escolar ao quinto ano dos anos iniciais, e para um grupo de dez a 20 responsáveis. A atividade e a interação com o público foram bastante satisfatórias, uma vez que as crianças e responsáveis expuseram seus conhecimentos tradicionais prévios e foi possível por meio de um “bate-papo” corrigir alguns saberes arraigados sempre fundamentando em informações científicas.

Human head and body lice are obligatory hematophagous ectoparasites that belong to a single species, Pediculus humanus. Only body lice, however, are vectors of the infectious Gram-negative bacterium Bartonella quintana. Because of their near identical genomes, yet differential vector competence, head and body lice provide a unique model system to study the gain or loss of vector competence. Using our in vitro louse-rearing system, we infected head and body lice with blood containing B. quintana in order to detect both differences in the proliferation of B. quintana and transcriptional differences of immune-related genes in the lice. B. quintana proliferated rapidly in body lice at 6 days post-infection, but plateaued in head lice at 4 days post-infection. RNAseq and quantitative real-time PCR validation analyses determined gene expression differences. Eight immunoresponse genes were observed to be significantly different with many associated with the Toll pathway: Fibrinogen-like protein, Spaetzle, Defensin 1, Serpin, Scavenger receptor A and Apolipoporhrin 2. Our findings support the hypothesis that body lice, unlike head lice, fight infection from B. quintana only at the later stages of its proliferation.

A cross-sectional school-based study was performed with the objectives to determine the prevalence of head lice infestation among primary schools in Baghdad suburbs (Abu Ghraib, Al-Yousifiya, Al-Radwaniyah, Al-Al-Taji, and Al-Hussainiya). The study included examination of 920 male and female students in several elementary schools' class first to sixth (age 6-15 year). These schools include urban, rural, and economically and culturally diverse regions for the period from February to June 2018. The results of the current study showed that the total injury rate was 9%, and the Radwaniyah region recorded the highest infection rate of 13.2 and the Al-Al-Taji rejoin region recorded the lowest (6.1%). The female infection rate was greater than that of males and reached 12.3 and 5.6 respectively. The results indicated a significant relationship between the spread of head lice and the educational status of parents, sharing of the head comb, and infection with dandruff. [ABSTRACT FROM AUTHOR]

Background: The head louse infestation is a public health issue in the world especially, affecting most people who live in camps, school-aged children and their families. Head lice treatment has economic ramifications that often under calculated. The aim of this study was evaluation of economic burden associated with head louse infestation in Iran. Methods: In a cross-sectional study, 500,002 infestations were diagnosed among suspected head lice infested people who referred to health care system in all provinces of Iran during 2017. Direct and indirect costs related to paid by patients and government systems were extracted by referring to accounting documents and interviews with patients and experts and were recorded in researcher-made forms. Microsoft Excel 2010 software was used for economic burden calculation. Results: The incidence rate of head lice infestation in Iran was 500,002/79,926,270 (625.5 per 100,000 populations). Economic burden of head lice in the country was calculated at 5,790,143$. Direct and indirect costs, governmental cost, out of pocket and total costs of head lice were included 3.14$, 2.84$, 5.98$, 5.60$ and 11.58$ per case respectively. Conclusion: The direct and indirect costs associated with treatment of infestations were relatively high. Therefore, the creation of medical facilities such as availability of diagnostic and treatment strategies can be effective in the control of infestation. The adoption of infestation prevention methods, such as health education to people at risk of infestation, reduces the incidence of head lice and imposition of related treatment costs on governmental health care system and head lice cases.

ABSTRACT Most human epidemiological and clinical studies use visual inspection of the hair and scalp to diagnose Pediculus humanus capitis , however this method has low sensitivity to diagnose active infestations (presence of nymphs and adult lice). Vacuuming the hair and scalp has been used as a diagnostic method, but there are no previous data comparing its effectiveness with visual inspection. The aim of this study was to determine the prevalence of overall infestation (nits and trophic stages), of active infestation by Pediculus humanus capitis , and to evaluate the effectiveness of vacuuming in comparison with the visual inspection. Visual inspection was performed by three examiners and vacuuming of the scalp by one investigator, with an adapted vacuum cleaner. A total of 166 children aged 4 to 10 years old were randomly selected from public schools in Southern Brazil. Considering the positive results obtained by both methods, the prevalence of overall infestation was 63.3%, whereas active infestation was 18.7%. The visual inspection was more effective on diagnosing overall infestation, however, its effectiveness to detect active infestation was lower, ranging from 0.6% (RR=3%, p

Abstract Background Head lice, Pediculus humanus capitis, are obligate blood-sucking parasites. Phylogenetically, they occur in five divergent mitochondrial clades (A, D, B, C and E), each having a particular geographical distribution. Recent studies have revealed that head lice, as is the case of body lice, can act as a vector for louse-borne diseases. Here, we aimed to study the genetic diversity of head lice collected from Niger’s refugees (migrant population) arriving in Algeria, northern Africa, and to look for louse-borne pathogens. Comparative head lice samples collected from indigenous population of schoolchildren (non-immigrant) were also analyzed to frame the study. Results In this study, 37 head lice samples were collected from 31 Nigerien refugees, as well as 45 head lice from 27 schoolchildren. The collection was established in three localities of eastern Algiers, north Algeria. Quantitative real-time PCR screening of pathogens bacteria and the genetic characterisation of the head lice satut were performed. Through amplification and sequencing of the cytb gene, results showed that all head lice of Nigerien refugees 37/82 (45.12%) belonged to clade E with the presence of four new haplotypes, while, of the 45 head lice of schoolchildren, 34/82 lice (41.46%) belonged to clade A and 11/82 (13.41%) belonged to clade B. Our study is the first to report the existence of clade E haplogroup in Nigerien head lice. DNA of Coxiella burnetii was detected in 3/37 (8.10%) of the head lice collected from 3 of the 31 (9.67%) migrant population. We also revealed the presence of Acinetobacter DNA in 20/37 (54.05%) of head lice collected from 25/31 (80.64%) of the Nigerien refugees, and in 25/45 (55.55%) head lice collected from 15/27 (55.55%) schoolchildren. All positive Nigerien-head lice for Acinetobacter spp. were identified as A. baumannii, while positive schoolchildren-head lice were identified as A. johnsonii 15/25 (60%), A. variabilis 8/25 (32%) and A. baumannii 2/25 (8%). Conclusions Based on these findings from head lice collected on migrant and non-migrant population, our results show, for the first time, that head lice from Niger belong to haplogroup E, and confirm that the clade E had a west African distribution. We also detected, for the first time, the presence of C. burnetii and A. baumannii in these Nigerien head lice. Nevertheless, further studies are needed to determine whether the head lice can transmit these pathogenic bacteria from one person to another.

Pedikulosis kapitis dikategorikan sebagai penyakit yang terabaikan dan masih menjadi masalah kesehatan. Infestasi Pediculus humanus capitis dengan mudah ditularkan melalui hubungan langsung antar individu atau benda pribadi yang digunakan bersama. Pedikulosis kapitis memiliki berbagai faktor risiko yang dapat meningkatkan terjadinya infestasi Pediculus humanus capitis. Penyakit ini menyerang semua usia terutama usia muda dan cepat meluas dalam lingkungan hidup yang padat seperti asrama dan panti asuhan. Gejala klinis yang khas berupa gatal disertai adanya bekas garukan. Tujuan dari penelitian ini untuk mengetahui hubungan faktor risiko dengan infestasi Pediculus humanus capitis pada anak panti asuhan di kota Pekanbaru. Anak panti asuhan yang diperiksa berjumlah 127 orang dari 3 panti asuhan di Pekanbaru. Hasil pemeriksaan didapatkan infestasi Pediculus humanus capitis pada perempuan lebih tinggi (87,1%), infestasi berdasarkan kelompok usia lebih banyak terjadi pada usia 6-12 tahun (65,9%), infestasi Pediculus humanus capitis menurut karakteristik rambut tertinggi pada keriting (81,8%). Anak yang memiliki panjang rambut sebahu adalah 91,3%. Kebiasaan anak yang selalu memakai alat rambut dan tidur bersama memiliki infestasi Pediculus humanus capitis sebesar 57,5% dan infestasi Pediculus humanus capitis untuk anak yang mencuci rambut 3 kali seminggu adalah 58,3%. Jenis kelamin dan karakteristik rambut memiliki hubungan yang signifikan mempengaruhi kejadian pedikulosis kapitis dengan nilai p

Objective: To evaluate the efficacy of Thai herbal shampoos [Cartoxylum formosum (C. formosum) + eucalyptus essential oil (EO), C. formosum + citrus EO, Solanum trilobatum + eucalyptus EO, Solanum trilobatum + citrus EO, Moringa oleifera + eucalyptus EO and Moringa oleifera + citrus EO] for killing all stages of Pediculus humanus capitis (Phthiraptera). Methods: A filter paper contact method was applied with three concentrations (0.05, 0.10 and 0.20 mL/cm2) of each Thai herbal shampoo as well as permethrin pediculicide (positive control) and drinking water (negative control) against eggs, nymphs and adults of Pediculus humanus capitis. Mortality rates of the eggs were recorded after 7 days of incubation while those of nymphs and adults were recorded after 5 minutes of contact. Results: All herbal shampoos at the high concentration were highly effective against nymphs and adults, but not effective against the eggs. C. formosum + eucalyptus EO and C. formosum + citrus EO shampoos at all concentrations exhibited the highest efficacy against nymphs and adults with 100% mortality rate at 5 min and LC50 values of 0.004 and 0.005 mL/cm2, respectively. All formulation of Solanum trilobatum and Moringa oleifera shampoos added with eucalyptus EO showed mortality rates against nymphs at 92.0%-100.0% and 76.0%-100.0% and against adults at 84.0%-100.0% and 20.0%-32.0%, respectively. Permethrin pediculicide was not effective against the eggs, but showed 68.0%-92.0% and 28.0%-60.0% mortality rates against nymphs and adults. Conclusions: These results indicate that C. formosum + eucalyptus EO shampoo can be used as an effective nymphicide and adulticide against Pediculus humanus capitis.

Background: The human head louse, Pediculus humanus capitis, is a cosmopolitan blood-sucking ectoparasite affecting mostly schoolchildren in both developed and developing countries. In Honduras, chemical pediculicides are the first line of treatment, with permethrin as their main active ingredient. Despite the extended use of these products, there is currently no research investigating insecticide resistance in Honduran head lice. In head lice, the most common mechanism is knockdown resistance (kdr), which is the result of two point mutations and the associated amino acid substitutions, T917I and L920F, within the voltage-sensitive sodium channel (VSSC). Methods: Genomic DNA was extracted from 83 head lice collected in the localities of San Buenaventura and La Hicaca, Honduras. Polymerase chain reaction (PCR) was used to amplify a 332-bp fragment of the VSSC gene that contains a site affected by C/T mutation which results in a T917I amino acid substitution on each human head louse genomic DNA fragments. Results: The C/T non-synonymous mutation which results in the T917I kdr amino acid substitution was detected in both head lice populations at frequencies ranging between 0.45–0.5. Globally, the frequency of this substitution was 0.47. Of these, 5 (6.1%) were homozygous susceptible and 78 (93.9%) were heterozygotes. The kdr-resistant homozygote (RR) was not detected in the studied populations. Thus, 93.9% of the head lice collected in Honduras harbored only one T917I allele. Exact test for the Hardy-Weinberg equilibrium for both localities showed that genotype frequencies differed significantly from expectation. In addition, San Buenaventura and La Hicaca populations had an inbreeding coefficient (Fis) < 0, suggesting an excess of heterozygotes. Conclusions: To our knowledge, this is the first study showing the presence of the C/T mutation responsible of the T917I kdr allele associated with pyrethroid resistance in P. h. capitis from Honduras. The PCR-restriction fragment length polymorphism (RFLP) employed here has demonstrated to be a reliable, economic, and reproducible assay that can be used to accurately genotype individual head lice for the mutation encoding the resistance-conferring T917I amino acid substitution. This highlights the necessity of proactive resistance management programmes designed to detect pyrethroid mutations before they become established within populations of head lice. [ABSTRACT FROM AUTHOR]

Background and Aim: Pediculus humanus capitis has been prevalent throughout the world, especially in developing countries among elementary students and societies with a weak socio-economic status. This study aimed to forecast head lice (Pediculidae: P. capitis) infestation incidence hotspots based on spatial correlation analysis in Ardabil Province, Northwest Iran. Materials and Methods: In this retrospective analytical study, all cases of head lice infestations who were confirmed by Centers for Disease Control office have been studied from 2016 to 2018. Head lice infestation incidence hotspots in the province should be detected based on general G statistics in ArcMap GIS10.4.1. Furthermore, MaxEnt.3.3.3 model was used for modeling the high-risk areas. Results: The prevalence rate of pediculosis was 14.90/100,000 populations. The general G statistics revealed that the head lice infestation in this study area has a high cluster pattern. The analysis showed that the Parsabad and Germi counties were identified as a head lice infestation incidence hotspots. Statistical and spatial analyses of head lice infestation incidence showed a significant positive correlation with head lice infestation incidence hotspots and the altitudes (15-500 m), annual temperature range (14-16.5°C), and slope and average diurnal temperature (12-18°C). Conclusion: The results of this study showed that the most ecologically suitable areas of head lice occurrence were identified in two hotspots (Parsabad and Germi) in the Northern areas of Ardabil Province (Parsabad and Germi counties); in the borderline of Iran and the Republic of Azerbaijan. [ABSTRACT FROM AUTHOR]

Most human epidemiological and clinical studies use visual inspection of the hair and scalp to diagnose Pediculus humanus capitis, however this method has low sensitivity to diagnose active infestations (presence of nymphs and adult lice). Vacuuming the hair and scalp has been used as a diagnostic method, but there are no previous data comparing its effectiveness with visual inspection. The aim of this study was to determine the prevalence of overall infestation (nits and trophic stages), of active infestation by Pediculus humanus capitis, and to evaluate the effectiveness of vacuuming in comparison with the visual inspection. Visual inspection was performed by three examiners and vacuuming of the scalp by one investigator, with an adapted vacuum cleaner. A total of 166 children aged 4 to 10 years old were randomly selected from public schools in Southern Brazil. Considering the positive results obtained by both methods, the prevalence of overall infestation was 63.3%, whereas active infestation was 18.7%. The visual inspection was more effective on diagnosing overall infestation, however, its effectiveness to detect active infestation was lower, ranging from 0.6% (RR=3%, p<0.001) to 6.6% (RR=35%, p=0.001), depending on the number of examiners. The effectiveness of vacuuming to diagnose active infestation was higher than the one of visual inspection, with a prevalence rate of 16.3% (RR=87%, p=0.332). As presented in our study, the vacuuming method was 2.74 to 7.87 times most likely to detect active infestation, thus it could be adopted as a more accurate method to diagnose active pediculosis. [ABSTRACT FROM AUTHOR]

• Pediculosis risk is associated with geographical location, sex, hair length and hair diameter. • Long hair and a smaller hair diameter may favor insect contact and fixation. • Girls are a greater risk as they let their hair grow for cultural reasons. • Inclusion in the model of hair color, shape, and hair-scale partly explain the susceptibility. • The results obtained can justify the discrepancies obtained in previous analyses. The human head lice is a cosmopolitan ectoparasite that causes pediculosis. The main way of spreading lice is through direct head-to-head contact. It is popular knowledge that some individuals are more susceptible to contracting head lice than others. Reports of individuals who have never been affected by the disease are common, even living in the same environment and under the same conditions as people who regularly have lice infestations. Previous research has been carried out on the risk of this infection associated with different human factors like gender or age. However, studies on the influence of the individual hair characteristics are scarce. The objective of the study was to analyze the pediculosis risk using geographical location, gender, age and individual hair characteristics as variables. Pediculosis was diagnosed through the detection of living lice in the hair. This cross-sectional school-based epidemiological study was conducted in 310 schoolchildren aged 1 to 13 years of schools in 4 municipalities situated in the State of Paraná, Brazil. The prevalence of head louse infection in primary school students was 49.35 %. The Odds Ratio of presence of pediculosis (OR) was estimated using multivariate logistic regression analysis. The results obtained indicate that hair length and thickness increase the risk of infection. Furthermore, the inclusion of hair color, hair shape, kind of hair-scale as covariates increases the risk of pediculosis, indicating that these variables partly explain this susceptibility and that pediculosis is independent of gender. A smaller hair diameter may favor insect fixation to the hair in the nymphal phases. These results may explain why girls are a greater risk as they let their hair grow for cultural reasons, i.e., being of female gender is an agglutinating variable. The conclusions drawn may explain the discrepancies obtained in previous analyses. [Display omitted] [ABSTRACT FROM AUTHOR]

Insect antennae are sophisticated sensory organs, usually covered with sensory structures responsible for the detection of relevant signals of different modalities coming from the environment. Despite the relevance of the head louse Pediculus humanus capitis as a human parasite, the role of its antennal sensory system in the highly dependent relation established with their hosts has been barely studied. In this work, we present a functional description of the antennae of these hematophagous insects by applying different approaches, including scanning electron microscopy (SEM), anterograde antennal fluorescent backfills, and behavioral experiments with intact or differentially antennectomized lice. Results constitute a first approach to identify and describe the head louse antennal sensilla and to determine the role of the antenna in host recognition. SEM images allowed us to identify a total of 35–40 sensilla belonging to seven different morphological types that according to their external architecture are candidates to bear mechano-, thermo-, hygro-, or chemo-receptor functions. The anterograde backfills revealed a direct neural pathway to the ipsilateral antennal lobe, which includes 8–10 glomerular-like diffuse structures. In the two-choice behavioral experiments, intact lice chose scalp chemicals and warm surfaces (i.e., 32°C) and avoided wet substrates. Behavioral preferences disappeared after ablation of the different flagellomeres of their antenna, allowing us to discuss about the location and function of the different identified sensilla. This is the first study that integrates morphological and behavioral aspects of the sensory machinery of head lice involved in host perception.

Background: Pediculus humanus capitis is one of the ectoparasites which lead to transition of Typhus fever. Rickettsial infections which affect the vasculature cause nonspecific signs and symptoms making it difficult to diagnose the disease clinically. This study was performed to investigate the genetic sequence of these external parasites and the possibility of their development that may make them more dangerous to transfer many pathogens to the human body. Method: In this study, 200 patients of school students (65 males and 135 females) with their ages =18 years were enrolled. In addition, 8(4%) of them were infected with rickettsiosis. All the patients were tested for detection of IGM and IgG anti- Rickettsia antibodies by ELISA and IFA techniques. Results: The serum titers for Anti- Rickettsia Antibodies (IgG) were 1/128, 1/256 and 1/512 among 8 of them as 2(25%), 4(50%) and 2(25%), respectively. The COI gene was detected with 552bp. The primers used F- AGCTCATTTGTTCAAGGCGG and R TACCAACACCCTCCAGCAAA with sequence size 827.. Conclusion: There was a 100 percent similarity between USA strains and Iraqi strains of the Bene Bank, indicating that the lice have not been developed. [ABSTRACT FROM AUTHOR]