Search

This article describes how Pine (Pinus roxburghii) tree products can create opportunities for a green and inclusive economic recovery in Himalayan states hit by COVID - 19 pandemic, where Pine trees grow in abundance. A Pine based green economy can enhance the livelihood opportunities of the poor people and enhance the resilience of state economies and societies in the face of severe recession and bring about reduction in degradation of forests and prevent forest fires.

The study was carried out in three selected metro areas of Chattogram city of Bangladesh covering 90 sample households. Proportionate random sampling technique was followed. Results revealed that the average rooftop space per household was recorded as 2248.23 sq. feet; whereas 1268.4 sq. feet (56.42%) was under rooftop garden (RTG), 588.5 sq. feet (26.17%) was remained as open and 391.3 sq. feet (17.41%) was identified as potential space for expanding the garden. All of the gardens were installed at 2-10th stories of the buildings. As crop diversity 26 types of vegetables, 39 types of fruits, 11 types spices and 22 types of flower/ornamental and medicinal plants were found to be grown in the current RTG’s. But the number of crops varies significantly among the garden and locations. About 16 types of containers were used for growing plants. The total yield was recorded to be 135.38 kg per garden from 22 types of vegetables in the year of 2019. Among them, the highest yield was received from bottle gourd, 17.98 kg followed by tomato, 9.33 kg and country bean, 8.99 kg. In the case of fruits, the total yield was recorded as 77.24 kg per garden from 18 types of fruits in the same year. Among these, mango gave the highest yield (8.57 kg), followed by papaya (8.38 kg) and guava (7.52 kg). Research should be carried out on crop selection, fertilizer and irrigation management under different container systems and to develop a suitable RTG model for greening city of Bangladesh.

Rayleigh-Benard convection (RBC), where a horizontal layer of fluid is kept between two conducting plates and the system is heated from below, provides a simplified model of convection. RBC is a classical extended dissipative system which displays a plethora of instabilities and patterns very close to the onset of convection for wide range of fluids. The study of these instabilities is an important topic of research and several approaches are available for the investigation. This chapter deals with the low dimensional modeling technique for investigating instabilities and the associated pattern dynamics in RBC.

H7N9, a novel strain of avian origin influenza was the first recorded incidence where a human was transited by a N9 type influenza virus. Effective vaccination against influenza A (H7N9) is a major concern, since it has emerged as a life threatening viral pathogen. Here, an in silico reverse vaccinology strategy was adopted to design a unique chimeric subunit vaccine against avian influenza A (H7N9). Induction of humoral and cell-mediated immunity is the prime concerned characteristics for a peptide vaccine candidate, hence both T cell and B cell immunity of viral proteins were screened. Antigenicity testing, transmembrane topology screening, allergenicity and toxicity assessment, population coverage analysis and molecular docking approach were adopted to generate the most antigenic epitopes of avian influenza A (H7N9) proteome. Further, a novel subunit vaccine was designed by the combination of highly immunogenic epitopes along with suitable adjuvant and linkers. Physicochemical properties and secondary structure of the designed vaccine were assessed to ensure its thermostability, hydrophilicity, theoretical PI and structural behavior. Homology modeling, refinement and validation of the designed vaccine allowed to construct a three dimensional structure of the predicted vaccine, further employed to molecular docking analysis with different MHC molecules and human immune TLR8 receptor present on lymphocyte cells. Moreover, disulfide engineering was employed to lessen the high mobility region of the designed vaccine in order to extend its stability. Furthermore, we investigated the molecular dynamic simulation of the modeled subunit vaccine and TLR8 complexed molecule to strengthen our prediction. Finally, the suggested vaccine was reverse transcribed and adapted forE. colistrain K12 prior to insertion within pET28a(+) vector for checking translational potency and microbial expression.

The investigation probed relationships among human-figure drawing, field-dependent-independent cognitive style and self-esteem of 10–15 year olds. It also attempted to predict human-figure drawing scores of participants based on their field-dependence-independence and self-esteem. Area, stratified and multi-stage random sampling were used to select a sample of 600 10–15 year olds residing in Kolkata city, India. The sample comprised three age-based strata: 10 and 11 year olds; 12 and 13 year olds; and 14 and 15 year olds. Each stratum comprised 100 girls and 100 boys. Participants’ actual age-ranges were 10 years 1 month – 11 years 10 months (first stratum); 12 years 4 months – 13 years 10 months (second stratum); and 14 years 3 months – 15 years 9 months (third stratum). Goodenough-Harris Drawing Test, Group Embedded Figures Test and Coopersmith Inventory were administered for assessing participants’ human-figure drawing, field-dependence-independence and self-esteem respectively. Results revealed significant positive relations among pertinent variables. Participants’ human-figure drawing scores could be significantly predicted by their field-dependence-independence and self-esteem.

We investigate the transitions near the onset of thermal convection in electrically conducting low Prandtl-number (Pr) fluids in the presence of rotation about a vertical axis and external horizontal magnetic field. Three-dimensional direct numerical simulations (DNSs) and low dimensional modeling are performed with the Rayleigh–Benard convection system in the ranges 0 < Q ≤ 1000 and 0 < Ta ≤ 500 of the Chandrasekhar number (Q) and the Taylor number (Ta), respectively, for that purpose. For larger Q(≥32.7), DNSs show substantial enhancement of convective heat transport and only finite amplitude steady two dimensional roll patterns at the onset. On the other hand, for smaller Q(

Using design and communication principles, this study uses a content analysis design to evaluate all active blogs from the 2011 Fortune 500 list (n = 125). The results indicate that corporate America has only modestly incorporated the dialogic principles into their blogs. Current corporate blogs are well-designed as far as making them searchable and easy to navigate; however, the blogs are mostly being used to provide information in a one-way manner rather than creating an open dialogue with consumers. While blogging can enhance relationships with stakeholders, corporate communicators must strive to develop legitimate conversations with their blog readers.

This two-part study with working adults examines which communication behaviors occur at work and how these communication behaviors are evaluated. Through an analysis of organizational communication publications (articles, organizational case studies, textbooks), the authors identified 343 communication behaviors; sorting analysis reduced this list to 163 verbal communication behaviors used in the workplace. In Study 1, using an online survey, 126 working adults identified which of these communication behaviors had been heard or observed the previous day in the workplace. Forty-four communication behaviors were identified by 50% or more of the participants, indicating their frequent use in the workplace. In Study 2, 331 working adults evaluated their effectiveness on the 44 verbal communication behaviors. Factor analysis reduced that list to 36 verbal workplace communication behaviors composed of four factors: information sharing, relational maintenance, expressing negative emotion, and organizing communic...

Among the primary needs of the central Himalayan region is a sustainable agriculture that will increase farmers' income through agricultural diversification while conserving biodiversity and achieving food self-sufficiency. The danger of losing a rich biodiversity has been realized and has been high on policy and research agendas for some time. However, much remains to be done to protect central Himalayan agro-biodiversity. This article describes the current status of agro-food cultivation in central Himalaya and examines the constraints and opportunities for the further development of the traditional agro-food cultivation involving resource-poor farmers.

Lanthanum-doped LiCoO2 composite cathode materials, containing 0.1–10 mol% of La were synthesized by citric acid aided combustion technique. Thermal analyses showed that the sharp decomposition reaction for pristine LiCoO2 became sluggish upon addition of lanthanum. X-ray diffraction analyses of the composites revealed existence of minute quantities of lanthanum-rich perovskite phases—rhombohedral LaCoO3 ( R 3 ¯ ) and tetragonal La2Li0.5Co0.5O4 (14/mmm), along with rhombohedral LiCoO2 ( R 3 ¯ m ) . Electron microscopy showed a distinct grain growth with increasing La content. An increase of about two orders of magnitude in the electrical conductivity (1.09 × 10−3 S cm−1) was observed for 1.0 mol% La-doped LiCoO2. An excellent cycling performance with capacity retention by a factor of ∼10 in comparison to the pristine LiCoO2 was observed for the composite cathode containing 5.0 mol% La, when 2032 type coin cells were cycled at 5C rate. This has been ascribed to the structural stability induced by La doping and presence of the ion-conducting phase La2Li0.5Co0.5O4 which acts as a solid electrolyte for Li+ ions. A negligible growth of impedance upon repeated cycling has been observed. Cyclic voltammetry showed a remarkable improvement in reversibility and stability of the La-doped electrodes. These composite cathodes might be very useful for high rate power applications.

Nanocrystalline (∼50 nm) LiCoO 2 powders containing 0–10 mol% of Ag have been prepared by combustion synthesis using citrate–nitrate combustion route. Thermal analyses show a sharp decomposition of the gel at ∼177 °C for pristine LiCoO 2 . With addition of silver, the decomposition becomes sluggish and it completes only above 430 °C. X-ray powder diffraction analyses show an increase in lattice parameter, c , with increasing Ag content suggesting the occupation of Ag within LiCoO 2 interlayer spacings. Transmission electron microscopy indicates diffusion of Ag into LiCoO 2 grains. It has been observed that adding 1.0 mol% silver increases the room temperature electrical conductivity by more than two orders of magnitude (1.5 × 10 −3 S cm −1 ). Galvanostatic charge–discharge profiles of coin cells fabricated with the synthesized powders show a two-fold enhancement in the discharge capacity for 1.0 mol% Ag-added LiCoO 2 cathode (140 mAh g −1 ) compared to that for pristine LiCoO 2 (70 mAh g −1 ).

Nanocrystalline LiMn 2 O 4 powders have been synthesized by combustion process in a single step using a novel fuel, l -alanine. Thermogravimetric analysis and differential thermal analysis of the gel indicate a sharp combustion at a temperature as low as 149 °C. Quantitative phase analysis of X-ray diffraction data shows about 97% of phase purity in the as-synthesized powder, which on further calcination at 700 °C becomes single phase LiMn 2 O 4 . High Brunauer, Emmett, and Teller surface area values obtained for ash (53 m 2 /g) and calcined powder (23 m 2 /g) indicate the ultrafine nature of the powder. Average crystallite size is found to be ∼60–70 nm from X-ray diffraction analysis and transmission electron microscopy. Fourier transformed infra-red spectrum shows two strong bands at 615 and 511 cm −1 originating from asymmetrical stretching of MnO 6 octahedra. A nominal composition of Li 0.88 Mn 2 O 4 is calculated from the inductive coupled plasma analysis. From UV–vis spectroscopy, an optical band gap of 1.43 eV is estimated which is assigned to a transition between t 2g and e g bands of Mn 3d. Electrochemical charge–discharge profiles show typical LiMn 2 O 4 behavior with a specific capacity of 76 mAh/g.

Gene expression is controlled at several levels including mRNA decay. Sarco/endoplasmic reticulum Ca2+–Mg2+-ATPase isoform 2b (SERCA2b) is central to Ca2+ signalling and homeostasis in several tissues. SERCA2b mRNA decay involves interactions between cis-acting elements in its 3′-region and trans-acting nuclear protein factors. In the presence of the protein factors, the synthetic capped and polyadenylated RNA fragment 2b1 (3444–3753) decays faster than other SERCA2b 3′-region fragments. Here we determined the minimum cis-acting destabilizing element in the decay and its interactions with the nuclear protein factors. The in vitro decay required ATP hydrolysis and Mg2+ but not Ca2+. The decay was directional from 3′ to 5′, and involved a novel 35b GC rich domain designated 2b1–4 corresponding to 3521–3555. The decay of 2b1 RNA was decreased by (a) competition with 2b1–4, (b) mutation of 2b1 to delete 2b1–4, and (c) depleting the extracts of destabilizing trans-acting factors using immobilized 2b1–4. To determine the minimal destabilizing elements 2b1–4 was divided into 7b domains A–E. Deleting AB, BC, CD or DE inactivated the destabilizing cis-acting element but deleting A, B, C, D or E had no effect. In electrophoresis mobility shift assays the nuclear protein extracts retarded the mobility of labeled uncapped 2b1 RNA without a poly A+ tail. A positive co-operativity in the interactions was shown in protein concentration dependence of the shift and in the competition of 2b1–4 in inhibiting the mobility of 2b1 RNA. Based on further experiments, the domain CDE (3535–3555) was sufficient to compete with 2b1 RNA for the protein binding. Consistent with this competition, excess CDE RNA retarded the in vitro decay of 2b1 RNA. Thus the RNA decay required ATP hydrolysis and Mg2+ but not Ca2+, the minimum binding domain was in the sequence 3535–3555, and the decay may involve a multimeric protein complex.

Nanocrystalline LiCoO2 powders (10–50 nm) were synthesized by a citrate-nitrate combustion process followed by calcination at different temperatures (300–800 °C) in air. Thermogravimetric analyses indicated a sharp combustion at a low temperature of 225 °C, producing fine crystallites. Quantitative phase analyses from the x-ray diffractograms showed that while annealing at 500 °C produced mixed phases of cubic and rhombohedral LiCoO2, annealing at 800 °C resulted in single-phase rhombohedral LiCoO2. Electronic transitions related to the Co 3d bands were investigated by ultraviolet-visible reflectance spectra in absorbance mode and were ascribed to the Co 3d intra-band transition involving t2g and eg orbitals. The d-d transitions underwent a blue shift of about 0.3 eV as the cubic LiCoO2 transformed into the rhombohedral structure with band gap values of about 1.4 and 1.7 eV.

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3′-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3′-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3′-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5′)ppp(5′)Gm] and polyadenylated (A40) RNA fragments from the 3′-end region (3444–4472) of SERCA2b. The proximal fragment 2B1 (3444–3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521–3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

Alternative splicing of the sarco/endoplasmic reticulum (SERCA2) Ca2+ pump transcript generates the two isoforms: SERCA2a in left ventricular myocytes (LVM) and SERCA2b in most tissues. Nuclear protein extracts from left ventricular myocytes can cause a decay of the 3'-region of the SERCA2a. To determine if all the domains in the 800 b SERCA2a 3'-end region (3344-4243) are equally stable, we examined in vitro decay of synthetically capped, polyadenylated overlapping RNA fragments 2A1-2A6 from the 3'-end region of SERCA2a. Whereas 2A1-2A5 RNAs were stable, the distal fragment 2A6 (4135-4243 b) decayed rapidly. Deleting the 2A6 sequence from the 800-b 3'-end region increased its stability. In mobility shift assays, 2A6 bound to protein(s) in the LVM nuclear extracts in a specific manner: unlabelled 2A6 or the 800 b 3'-region RNA competed for binding but poly A, poly U, and poly C RNA did not. Secondary structure analysis revealed three hairpin loops in 2A6. Experiments using small synthetic RNA fragments for competition with 2A6 binding to nuclear proteins were consistent with a model involving the three hairpin loops. Thus, the secondary structure of the distal domain of SERCA2a RNA may be important in regulating its stability.

A study was conducted in irrigated rice fields planted to three rice ( Oryza sativa ) cultivars, Sarju-52, Malviya-36 and Pant Dhan-4, to investigate the influence of rice cultivars on rate of N-mineralization, nitrification and nitrifier population size. Thirty-day-old seedlings were transplanted in the waterlogged condition. Urea was the only fertilizer applied, at a rate of 100 kg N ha −1 in three split doses. The experiment was laid out in a randomized complete block design with three replicate plots for each cultivar and treatment. Soil mineral-N content, N-mineralization, nitrification and the most probable number of ammonium and nitrite oxidizing bacteria were estimated on six dates within the cropping period. It was observed that the mineral-N content in soil was lowest beneath Pant Dhan-4 under both unfertilized (control) and fertilized conditions. Mineral-N values in plots planted to Malviya-36 had intermediate values, while plots planted to Sarju-52 had highest mineral-N content under both control and fertilized conditions. Throughout the cropping season the lowest rate of N-mineralization, nitrification and nitrifier population was recorded in soil beneath Sarju-52 and highest beneath Pant Dhan-4. The highest vigour in terms of plant growth, grain yield and root porosity, was observed in Pant Dhan-4, followed by Malviya-36 and Sarju-52. Intercultivar differences in plant biomass production, which indicates the differences in nitrogen utilization potential and indirectly the quantity and quality of litter production may explain in part the differences in N-mineralization processes. The nitrifying bacterial population was strongly correlated with root biomass and root air space. The rice cultivars differed significantly in aerenchyma tissue differentiation resulting in different degrees of aerobic conditions in their rhizosphere. This explains the differences in nitrifier populations harboured by each of the cultivars in their respective soils and the consequent differences in soil processes. Hence, apart from fertilizer management, choice of rice cultivar also affects nitrifier populations and their functions, which are responsible for supplying nutrients to the rice soil.

Li(2)MnSiO(4) cathode powders were synthesized by a simple combustion technique using citric acid as a chelating agent. The as-synthesized powder was ballmilled with acetylene black (0-20 wt %) and heated at 700 degrees C in argon atmosphere to form a Li(2)MnSiO(4)/C composite. X-ray powder diffraction indicated the formation of Li(2)MnSiO(4) possessing an orthorhombic crystal structure along with manganese oxide as a minor impurity phase. Field-emission-scanning electron microscopy showed that pristine Li(2)MnSiO(4) consists of large agglomerates of similar to 500 to 800 nm. The addition of acetylene black resulted in a drastic change in morphology for Li(2)MnSiO(4)/C composites consisting of uniform grains of similar to 50 nm. The electrochemical discharge capacity as well as the rate capability of Li(2)MnSiO(4) also improved dramatically with an increasing amount of conducting carbon (acetylene black) in the matrix, and a value as high as 164 mAh g(-1) was obtained at a current density of 0.01 mA/cm(2). Impedance spectroscopy showed that the addition of acetylene black decreases the charge-transfer impedance and checks the growth of cell impedance during cycling. Cyclic voltammetry showed two oxidation/reduction couples at 3.6/2.9 and 4.5/4.3 V with good reversibility.