Search

Bacterial spot of tomato (BST), predominantly caused by Xanthomonas perforans ( Xp ) in Florida, is one of the most devastating diseases in hot, humid environments. Bacterial resistance to copper-based bactericides and antibiotics makes disease management extremely challenging. This necessitates alternative new solutions to manage the disease. In this study, we used two novel hybrid copper and magnesium nanomaterials, noted as magnesium double-coated (Mg-Db) and magnesium-copper (Mg-Cu), to manage BST. In in vitro experiments, no viable cells were recovered following 4 h of exposure to 500 μg/ml of both Mg-Db and Mg-Cu, while 100 and 200 μg/ml required 24 h of exposure for complete inhibition. In a viability assay using the live/dead cell straining method and epifluorescence microscopy, copper-tolerant Xp cells were killed within 4 h by both Mg-Cu and Mg-Db nanomaterials at 500 μg/ml but not by copper hydroxide (Kocide 3000). In the greenhouse, Mg-Db and Mg-Cu at 100 to 500 μg/ml significantly reduced BST severity compared with micron-sized commercial copper bactericide Kocide 3000 and the growers' standard (copper hydroxide + mancozeb) ( P < 0.05). In field studies, Mg-Db and Mg-Cu nanomaterials significantly reduced disease severity in two out four field trials. Mg-Db at 500 μg/ml reduced BST severity by 34% compared with the nontreated control without affecting yield in fall, 2020. The use of hybrid nanomaterials at the highest concentrations (500 μg/ml) evaluated in the field experiments can reduce copper use by 90% compared with the growers' standard. In addition, there was no phytotoxicity observed with the use of hybrid nanomaterials in the field. These results suggest the potential of novel magnesium-copper-based hybrid nanomaterials to manage copper-tolerant bacterial pathogens., Competing Interests: The author(s) declare no conflict of interest.

Bacterial spot caused by Xanthomonas spp. is an economically important disease of pepper causing significant yield losses in Taiwan. Monitoring the pathogen population on a continuous basis is necessary for developing disease management strategies. We analyzed a collection of xanthomonad strains isolated from pepper in Taiwan between 1989 and 2019. Among the sequenced genomes, 65 were identified as Xanthomonas euvesicatoria , and 10 were X. perforans . Thirty-five X. euvesicatoria and 10 X. perforans strains were copper tolerant, whereas only four X. euvesicatoria and none of the X. perforans strains were tolerant to streptomycin. Nine X. euvesicatoria strains were amylolytic, which is considered an unusual characteristic for X. euvesicatoria . Bayesian analysis of the population structure based on core gene single-nucleotide polymorphisms clustered the strains into five clusters for X. euvesicatoria and three clusters for X. perforans . One X. perforans cluster, designated as TP-2019, appears to be a novel genetic cluster based on core genes, accessory gene content, and effector profile. This knowledge of pathogen diversity with whole genomic information will be useful in future comparative studies and in improving breeding programs to develop disease-resistant cultivars and other disease management options., Competing Interests: The author(s) declare no conflict of interest.

In Florida, angular leaf spot, caused by Xanthomonas fragariae , was the only known bacterial disease in strawberry, which is sporadic and affects the foliage and calyx. However, from the 2019-2020 to 2023-2024 Florida strawberry seasons, unusual bacterial-like symptoms were observed in commercial farms, with reports of up to 30 % disease incidence. Typical lesions were water-soaked and angular in early stages that later became necrotic with a circular-ellipsoidal purple halo, and consistently yielded colonies resembling Pseudomonas on culture media. Strains were pathogenic on strawberry, fluorescent, oxidase- and arginine-dihydrolase-negative, elicited a hypersensitive reaction on tobacco, and lacked pectolytic activity. Although phenotypic assays, such as fatty acid methyl profiles and Biolog protocols, placed the strains into the Pseudomonas group, there was a low similarity at the species level. Further analysis using 16S rRNA genes, housekeeping genes, and whole genome sequencing showed that the strains cluster into the Pseudomonas group but do not share more than 95 % average nucleotide identity compared to representative members. Therefore, the genomic and phenotypic analysis confirm that the strains causing bacterial spot in strawberry represent a new plant pathogenic bacterial species for which we propose the name Pseudomonas fragariae sp. nov. with 20-417 T (17 T =LMG 32456 T =DSM 113340 T ) as the type strain, in relation to Fragaria × ananassa , the plant species from which the pathogen was first isolated. Future work is needed to assess the epidemiology, cultivar susceptibility, chemical sensitivity, and disease management of this possible new emerging strawberry pathogen.

Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.

The widespread presence of tolerance to copper in Xanthomonas species has resulted in the need to develop alternative approaches to control plant diseases caused by xanthomonads. In recent years, nanotechnological approaches have resulted in the identification of novel materials to control plant pathogens. With many metal-based nanomaterials having shown promise for disease control, an important question relates to the mode of action of these new materials. In this study, we used several approaches, such as scanning electron microscopy, propidium monoazide quantitative polymerase chain reaction, epifluorescence microscopy, and RNA sequencing to elucidate the mode of action of a Cu/Zn hybrid nanoparticle against copper-tolerant strains of Xanthomonas euvesicatoria. We demonstrate that Cu/Zn did not activate copper resistance genes (i.e., copA and copB ) in the copper-tolerant bacterium but functioned by disrupting the bacterial cell structure and perturbing important biological processes such as cell respiration and chemical homeostasis., Competing Interests: The author(s) declare no conflict of interest.

Bacterial leaf spot of cucurbits (BLS) is an emerging disease in the southeastern United States that is capable of causing widespread outbreaks under conducive conditions. Historically attributed solely to the bacterium Pseudomonas syringae pv. lachrymans , recent studies have identified additional P. syringae pathovars as causal agents of the disease. To further investigate the identity and diversity of P. syringae strains associated with BLS in the southeastern United States, 47 bacterial isolates were recovered from symptomatic cucurbits from Florida, Alabama, and Georgia. Strains were characterized using the LOPAT testing scheme, fluorescence, and pathogenicity to watermelon and squash seedlings. Thirty-eight fluorescent isolates underwent whole-genome sequencing and were further characterized with 16S rRNA, four gene multilocus sequence analysis (MLSA) phylogeny, and average nucleotide identity analysis. Thirty-four isolates were identified as members of the P. syringae species complex, including P. syringae sensu stricto (12), P. alliivorans (12), P. capsici (nine), and P. viridiflava (one). An additional four isolates were found to belong to the Pseudomonas genus outside of the syringae species complex, though they did not share 95% or greater average nucleotide identity to any validly published species and are believed to belong to three novel Pseudomonas species. These results reveal an unpredicted level of diversity of Pseudomonas strains associated with BLS in the region and show the benefits of whole-genome sequencing for strain identification. Identification of P. capsici , which is capable of causing disease at higher temperatures than P. syringae , as a causal agent of BLS may also affect management strategies in the future., Competing Interests: The author(s) declare no conflict of interest.

Xanthomonas spp. infect a wide range of annual and perennial plants. Bacterial blight in young seedlings of Eucalyptus spp. in Indonesia was originally identified as X. perforans . However, these strains failed to elicit a hypersensitive response (HR) on either tomatoes or peppers. Two of the strains, EPK43 and BCC 972, when infiltrated into tomato and pepper leaves, failed to grow to significant levels in comparison with well-characterized X. euvesicatoria pv. perforans ( Xp ) strains. Furthermore, spray inoculation of 'Bonny Best' tomato plants with a bacterial suspension of the Eucalyptus strains resulted in no obvious symptoms. We sequenced the whole genomes of eight strains isolated from two Eucalyptus species between 2007 and 2015. The strains had average nucleotide identities (ANIs) of at least 97.8 with Xp and X. euvesicatoria pv. euvesicatoria ( Xeu ) strains, both of which are causal agents of bacterial spot of tomatoes and peppers. A comparison of the Eucalyptus strains revealed that the ANI values were >99.99% with each other. Core genome phylogeny clustered all Eucalyptus strains with X. euvesicatoria pv. rosa . They formed separate clades, which included X. euvesicatoria pv. alangii , X. euvesicatoria pv. citrumelonis , and X. euvesicatoria pv. alfalfae . Based on ANI, phylogenetic relationships, and pathogenicity, we designated these Eucalyptus strains as X. euvesicatoria pv. eucalypti ( Xee ). Comparative analysis of sequenced strains provided unique profiles of type III secretion effectors. Core effector XopD, present in all pathogenic Xp and Xeu strains, was absent in the Xee strains. Comparison of the hrp clusters of Xee , Xp , and Xeu genomes revealed that HrpE in Xee strains was very different from that in Xp and Xeu . To determine if it was functional, we deleted the gene and complemented with the Xee hrpE , confirming it was essential for secretion of type III effectors. HrpE has a hypervariable N-terminus in Xanthomonas spp., in which the N-terminus of Xee strains differs significantly from those of Xeu and Xp strains., Competing Interests: The author(s) declare no conflict of interest.

Bacteriophages are biocontrol agents used to manage bacterial diseases. They have long been used against plant pathogenic bacteria; however, several factors impede their use as a reliable disease management strategy. Short-lived persistence on plant surfaces under field conditions results mainly from rapid degradation by exposure to ultraviolet (UV) light. Currently, there are no effective commercial formulations that protect phages from UV. The phage ΦXp06-02-1, which lyses strains of the tomato bacterial spot pathogen Xanthomonas perforans , was mixed with different concentrations of the nanomaterial N -acetylcysteine surface-coated manganese-doped zinc sulfide (NAC-ZnS; 3.5 nm). In vitro, NAC-ZnS at 10,000 μg/ml formulated phage, when exposed to UV for 1 min, provided statistically equivalent plaque-forming unit (PFU) recovery as phages that were not exposed to UV. NAC-ZnS had no negative effect on the phage's ability to lyse bacterial cells under in vitro conditions. NAC-ZnS reduced phage degradation over time in comparison with the nontreated control, whereas N -acetylcysteine-zinc oxide (NAC-ZnO) had no effect. In fluorescent light, without UV exposure, NAC-ZnO-formulated phages were more infective than NAC-ZnS-formulated phages. The nanomaterial-phage mixture did not cause any phytotoxicity when applied to tomato plants. Following exposure to sunlight, the NAC-ZnS formulation improved phage persistence in the phyllosphere by 15 times compared with nonformulated phages. NAC-ZnO-formulated phage populations were undetectable within 32 h, whereas NAC-ZnS-formulated phage populations were detected at 10 3 PFU/g. At 4 h of sunlight exposure, NAC-ZnS-formulated phages at 1,000 μg/ml significantly reduced tomato bacterial spot disease severity by 16.4% compared with nonformulated phages. These results suggest that NAC-ZnS can be used to improve the efficacy of phages for bacterial diseases., Competing Interests: The author(s) declare no conflict of interest.

Begomoviruses and criniviruses, vectored by whiteflies (Bemisia tabaci), are important threats to crops worldwide. In recent years, the spread of cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) on cucurbit crops has been reported to cause devastating crop losses in many regions of the world. In this study, a multiplex recombinase polymerase amplification (RPA) assay, an isothermal technique for rapid and simultaneous detection of DNA and RNA viruses CuLCrV, CYSDV and CCYV was developed. Highly specific and sensitive multiplex RPA primers for the coat protein region of these viruses were created and evaluated. The sensitivity of the multiplex RPA assay was examined using serially diluted plasmid containing the target regions. The results demonstrated that multiplex RPA primers have high sensitivity with a detection limit of a single copy of the viruses. The multiplex RPA primers were specific to the target as indicated by testing against other begomoviruses, potyviruses and an ilarvirus, and no nonspecific amplifications were noted. The primers simultaneously detected mixed infection of CCYV, CYSDV and CuLCrV in watermelon and squash crude extracts. This study is the first report of a multiplex RPA assay for simultaneous detection of mixed infection of DNA and RNA plant viruses., (© 2023 The Authors. Molecular Plant Pathology published by British Society for Plant Pathology and John Wiley & Sons Ltd.)

Bacterial spot of tomato is among the most economically relevant diseases affecting tomato plants globally. In previous studies, non-formulated magnesium oxide nanoparticles (nano-MgOs) significantly reduced the disease severity in greenhouse and field conditions. However, the aggregation of nano-MgO in liquid suspension makes it challenging to use in field applications. Therefore, we formulated two novel MgO nanomaterials (SgMg #3 and SgMg #2.5) and one MgOH 2 nanomaterial (SgMc) and evaluated their physical characteristics, antibacterial properties, and disease reduction abilities. Among the three Mg nanomaterials, SgMc showed the highest efficacy against copper-tolerant strains of Xanthomonas perforans in vitro, and provided disease reduction in the greenhouse experiments compared with commercial Cu bactericide and an untreated control. However, SgMc was not consistently effective in field conditions. To determine the cause of its inconsistent efficacy in different environments, we monitored particle size, zeta potential, morphology, and crystallinity for all three formulated materials and nano-MgOs. The MgO particle size was determined by the scanning electron microscopy (SEM) and dynamic light scattering (DLS) techniques. An X-ray diffraction (XRD) study confirmed a change in the crystallinity of MgO from a periclase to an Mg(OH) 2 brucite crystal structure. As a result, the bactericidal activity correlated with the high crystallinity present in nano-MgOs and SgMc, while the inconsistent antimicrobial potency of SgMg #3 and SgMg #2.5 might have been related to loss of crystallinity. Future studies are needed to determine which specific variables impair the performance of these nanomaterials in the field compared to under greenhouse conditions. Although SgMc did not lead to significant disease severity reduction in the field, it still has the potential to act as an alternative to Cu against bacterial spot disease in tomato transplant production.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Plant disease classification is quite complex and, in most cases, requires trained plant pathologists and sophisticated labs to accurately determine the cause. Our group for the first time used microscopic images (×30) of tomato plant diseases, for which representative plant samples were diagnostically validated to classify disease symptoms using non-coding deep learning platforms (NCDL). The mean F1 scores (SD) of the NCDL platforms were 98.5 (1.6) for Amazon Rekognition Custom Label, 93.9 (2.5) for Clarifai, 91.6 (3.9) for Teachable Machine, 95.0 (1.9) for Google AutoML Vision, and 97.5 (2.7) for Microsoft Azure Custom Vision. The accuracy of the NCDL platform for Amazon Rekognition Custom Label was 99.8% (0.2), for Clarifai 98.7% (0.5), for Teachable Machine 98.3% (0.4), for Google AutoML Vision 98.9% (0.6), and for Apple CreateML 87.3 (4.3). Upon external validation, the model's accuracy of the tested NCDL platforms dropped no more than 7%. The potential future use for these models includes the development of mobile- and web-based applications for the classification of plant diseases and integration with a disease management advisory system. The NCDL models also have the potential to improve the early triage of symptomatic plant samples into classes that may save time in diagnostic lab sample processing., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision., (Copyright © 2023 Choudhary, Sentil, Jones and Paret.)

A rapid surge in world population leads to an increase in worldwide demand for agricultural products. Nanotechnology and its applications in agriculture have appeared as a boon to civilization with enormous potential in transforming conventional farming practices into redefined farming activities. Low-cost portable nanobiosensors are the most effective diagnostic tool for the rapid on-site assessment of plant and soil health including plant biotic and abiotic stress level, nutritional status, presence of hazardous chemicals in soil, etc. to maintain proper farming and crop productivity. Nanobiosensors detect physiological signals and convert them into standardized detectable signals. In order to achieve a reliable sensing analysis, nanoparticles can aid in signal amplification and sensor sensitivity by lowering the detection limit. The high selectivity and sensitivity of nanobiosensors enable early detection and management of targeted abnormalities. This study identifies the types of nanobiosensors according to the target application in agriculture sector., Competing Interests: The authors declare no conflict of interest., (© 2022 The Author(s).)

Five bacterial strains were isolated from symptomatic leaves of Achillea millefolium , Delphinium sp. and Hydrangea sp. in California. Colonies isolated on King's medium B (KMB) appeared white, mucoid and round, similar to Pseudomonas species. Phylogenetic analyses based on 16S rRNA, rpoB , rpoD and gyrB genes placed the bacteria into three distinct groups within Pseudomonas that were most closely related to Pseudomonas viridiflava , Pseudomonas cichorii or Pseudomonas caspiana . To further characterize the strains, phenotypic analyses and the following tests were performed: fatty acid methyl ester composition, LOPAT, fluorescence on KMB, Biolog assay, and transmission electron microscopy. Finally, whole genome sequencing of the strains was conducted, and the sequences were compared with reference genomes of Pseudomonas species based on average nucleotide identity (ANI). The first group, which consists of three strains isolated from delphinium, hydrangea and achillea, had 95.6-96.9 % pairwise ANI between each other; the second group consists of two strains isolated from delphinium that had 100 % pairwise ANI. Although comparisons of the two groups with publicly available genomes revealed closest relationships with P. viridiflava (91.6 %), P. caspiana (88.3 %) and P. asturiensis (86.7 %), ANI values were less than 95 % compared to all validly published pseudomonads. Combining genomic and phenotypic data, we conclude that these strains represent two new species and the names proposed are Pseudomonas quasicaspiana sp. nov. (type strain DSMZ 11 30 42 T =LMG 32 434 T ) for the strains isolated from delphinium, achillea and hydrangea and Pseudomonas californiensis sp. nov. (DSMZ 11 30 43 T =LMG 32 432 T ) for the two strains isolated from delphinium. The specific epithets quasicaspiana and californiensis were selected based on the close phylogenetic relationship of strains with P. caspiana and on the geographic location of isolation, respectively.

The pathogen that causes stem gall in Loropetalum chinense was first identified in Florida and Alabama in 2018 and named Pseudomonas amygdali pv. loropetali . We report the genome sequence of the pathotype strain of this pathogen, Pseudomonas amygdali pv. loropetali DSM105780 PT ., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (© 2022 The Authors.)

Bacterial diseases are a constant threat to crop production globally. Current management strategies rely on an array of tactics, including improved cultural practices; application of bactericides, plant activators, and biocontrol agents; and use of resistant varieties when available. However, effective management remains a challenge, as the longevity of deployed tactics is threatened by constantly changing bacterial populations. Increased scrutiny of the impact of pesticides on human and environmental health underscores the need for alternative solutions that are durable, sustainable, accessible to farmers, and environmentally friendly. In this review, we discuss the strengths and shortcomings of existing practices and dissect recent advances that may shape the future of bacterial disease management. We conclude that disease resistance through genome modification may be the most effective arsenal against bacterial diseases. Nonetheless, more research is necessary for developing novel bacterial disease management tactics to meet the food demand of a growing global population.

Copper bactericides are routinely used to control Xanthomonas perforans (XP), causal agent of bacterial spot of tomato. Given the widespread tolerance to copper in XP strains in FL, USA, nanotechnology-based elemental composites have gained interest for their potential applications in agriculture in part due to their enhanced antimicrobial properties and toxicity to copper-tolerant strains. However, little is known about the potential impact of conventional copper bactericides as well as nano-based elemental composites on soil microbial communities, as determined by high-throughput sequencing of the 16S rDNA. We compared the effects of 2 and 200 μg/mL of core-shell (CS), a metallic copper composite, and a conventional copper bactericide + mancozeb (Cu+Man) on the soil microbiome. These treatments were compared to three controls, the microbial profile of the soil prior to application of copper products, a water application, and spiking the soil with a soilborne phytobacterium, Ralstonia solanacearum (RS). The RS treatment was included to determine if downstream analysis could detect the artificial inoculation. Utilizing multiple β diversity measurements, each emphasizing various tenets of ecology, provided a greater perspective of the effects the treatments had on the microbiome. Analysis of HTS data revealed that the two treatments containing field applied rates of metallic copper, CS 200 and Cu+Man, had the largest impact on the soil microbiome at seven-days posttreatment compared to water. However, we simulated field applied rates of CS 200 entering the soil by treating soil with CS 2 and determined this concentration had a negligible effect on the soil microbiome. IMPORTANCE Nanotechnology-based elemental composites have gained popularity for their potential applications in plant disease management due to their enhanced antimicrobial properties. However, little is known about their potential impact on the environment. Foliar applications of nano metallic composites upon leaching into the soil have the potential to impact soil microbial populations that in turn influence soil health. Utilizing multiple β diversity measurements, high-throughput sequencing analysis revealed that field applied rates of metallic copper (200 μg/mL) from an advanced copper composite (core-shell [CS]) and a conventional copper bactericide in combination with mancozeb had the largest impact on the soil microbiome compared to water and nontreated control. To simulate leaching from the leaf surface, a lower concentration (2 μg/mL) of CS was also applied to the soil and had a negligible effect on the soil microbiome. Thus, field applied rates of CS may have a minimal effect on soil microbial communities.

Xanthomonas euvesicatoria pv. rosa strain Xer07 causes a leaf spot on a Rosa sp. and is closely related to X. euvesicatoria pv. euvesicatoria ( Xee ) and X. perforans ( Xp ), causal agents of bacterial spot of tomato. However, Xer07 is not pathogenic on tomato and elicits a hypersensitive reaction (HR). We compared the genomes of the three bacterial species to identify the factors that limit Xer07 on tomato. Comparison of pathogenicity associated factors including the type III secretion systems identified two genes, xopA and xer3856 , in Xer 07 that have lower sequence homology in tomato pathogens. xer3856 is a homolog of genes in X. citri ( xac3856 ) and X. fuscans pv. aurantifolii , both of which have been reported to elicit HRs in tomato. When xer3856 was expressed in X. perforans and infiltrated in tomato leaflets, the transconjugant elicited an HR and significantly reduced bacterial populations compared to the wildtype X. perforans strain. When xer 3856 was mutated in Xer07 , the mutant strain still triggered an HR in tomato leaflets. The second gene identified codes for type III secreted effector XopA, which contains a harpin domain that is distinct from the xopA homologs in Xee and Xp . The Xer07 - xopA , when expressed in X. perforans , did not elicit an HR in tomato leaflets, but significantly reduced bacterial populations. This indicates that xopA and xer3856 genes in combination with an additional factor(s) limit Xer07 in tomato.

Rose rosette disease (RRD) caused by rose rosette emaravirus (RRV) is a major issue in the U.S. rose industry with no effective method for its management. This study evaluated the effect of foliar application of acibenzolar-S-methyl (ASM), a plant systemic acquired resistance inducer, in reducing RRD disease severity on Rosa species cv. Radtkopink ('Pink Double Knock Out') under greenhouse conditions, and the effect of ASM on plant growth under commercial nursery production conditions. ASM at 50- or 100-mg/liter concentrations at weekly intervals significantly reduced RRD severity compared with the untreated control in two of the three greenhouse trials ( P < 0.05). The plants in these trials were subsequently pruned and observed for symptoms, which further indicated that application of ASM at 50- or 100-mg/liter concentrations lowered disease severity compared with the untreated control ( P < 0.05) in these two trials. Plants treated with ASM at 50- or 100-mg/liter concentrations had delayed incidence of RRD compared with the nontreated controls. Plants treated with ASM at the 50- or 100-mg/liter rate in all three trials either did not have RRV present or the virus was present in fewer leaf samples than untreated controls as indicated by quantitative reverse transcription PCR analysis. Overall, plants treated with ASM at the 50-mg/liter concentration had 36 to 43% reduced RRD incidence compared with the water control. The treatment of two cultivars of rose, 'Radtkopink' and 'Meijocos' ('Pink Drift'), with weekly foliar applications of ASM at the three rates (0.5, 0.75, and 1.0 oz/A) indicated that ASM had no negative effect on flowering or plant growth at even the highest rate of application.

Phyllocoptes fructiphilus Keifer (Acari: Eriophyidae) is the vector of rose rosette virus (RRV), which causes rose rosette disease (RRD) in North America. The RRD symptoms, such as witches' broom, flower, and leaf deformation, disrupt the aesthetic appearance of plants and cause plant mortality. Because there is no cure for RRV, it is critical to manage the vector and reduce the spread of the virus. The information on the phenology of P. fructiphilus on rose plants is essential to develop management strategies and reduce its spread. Thus, the objectives of the study were to determine 1) the phenology of eriophyid mites (including P. fructiphilus ) in central Georgia due to its widespread occurrence in the state and 2) the incidence of eriophyid mites on closed and opened flower buds and other plant parts. In central Georgia, eriophyid mites, including P. fructiphilus were active on both symptomatic and asymptomatic plants from April to December. The mite densities were greater during July and August than during the remaining months on asymptomatic plants. The mites were more abundant on the RRD-symptomatic than on the asymptomatic plants. Similar numbers of eriophyid mites were observed on closed and opened flower buds. Eriophyid mite densities were greater on sepals and leaf bases than on other plant parts.

Disease Symptoms: Symptoms include water-soaked areas surrounded by chlorosis turning into necrotic spots on all aerial parts of plants. On tomato fruits, small, water-soaked, or slightly raised pale-green spots with greenish-white halos are formed, ultimately becoming dark brown and slightly sunken with a scabby or wart-like surface., Host Range: Main and economically important hosts include different types of tomatoes and peppers. Alternative solanaceous and nonsolanaceous hosts include Datura spp., Hyoscyamus spp., Lycium spp., Nicotiana rustica, Physalis spp., Solanum spp., Amaranthus lividus, Emilia fosbergii, Euphorbia heterophylla, Nicandra physaloides, Physalis pubescens, Sida glomerata, and Solanum americanum., Taxonomic Status of the Pathogen: Domain, Bacteria; phylum, Proteobacteria; class, Gammaproteobacteria; order, Xanthomonadales; family, Xanthomonadaceae; genus, Xanthomonas; species, X. euvesicatoria, X. hortorum, X. vesicatoria., Synonyms (nonpreferred Scientific Names): Bacterium exitiosum, Bacterium vesicatorium, Phytomonas exitiosa, Phytomonas vesicatoria, Pseudomonas exitiosa, Pseudomonas gardneri, Pseudomonas vesicatoria, Xanthomonas axonopodis pv. vesicatoria, Xanthomonas campestris pv. vesicatoria, Xanthomonas cynarae pv. gardneri, Xanthomonas gardneri, Xanthomonas perforans., Microbiological Properties: Colonies are gram-negative, oxidase-negative, and catalase-positive and have oxidative metabolism. Pale-yellow domed circular colonies of 1-2 mm in diameter grow on general culture media., Distribution: The bacteria are widespread in Africa, Brazil, Canada and the USA, Australia, eastern Europe, and south-east Asia. Occurrence in western Europe is restricted., Phytosanitary Categorization: A2 no. 157, EU Annex designation II/A2., Eppo Codes: XANTEU, XANTGA, XANTPF, XANTVE., (© 2021 The Authors. Molecular Plant Pathology published by British Society for Plant Pathology and John Wiley & Sons Ltd.)

Copper (Cu) is the most extensively used bactericide worldwide in many agricultural production systems. However, intensive application of Cu bactericide have increased the selection pressure toward Cu-tolerant pathogens, including Xanthomonas perforans , the causal agent of tomato bacterial spot. However, alternatives for Cu bactericides are limited and have many drawbacks including plant damage and inconsistent effectiveness under field conditions. Also, potential ecological risk on nontarget organisms exposed to field runoff containing Cu is high. However, due to lack of alternatives for Cu, it is still widely used in tomato and other crops around the world in both conventional and organic production systems. In this study, a Cu-tolerant X. perforans strain GEV485, which can tolerate eight tested commercial Cu bactericides, was used in all the field trials to evaluate the efficacy of MgO nanomaterial. Four field experiments were conducted to evaluate the impact of intensive application of MgO nanomaterial on tomato bacterial spot disease severity, and one field experiment was conducted to study the impact of soil accumulation of total and bioavailable Cu, Mg, Mn, and Zn. In the first two field experiments, twice-weekly applications of 200 μg/mL MgO significantly reduced disease severity by 29-38% less in comparison to a conventional Cu bactericide Kocide 3000 and 19-30% less in comparison to the water control applied at the same frequency ( p = 0.05). The disease severity on MgO twice-weekly was 12-32% less than Kocide 3000 + Mancozeb treatment. Single weekly applications of MgO had 13-19% higher disease severity than twice weekly application of MgO. In the second set of two field trials, twice-weekly applications of MgO at 1000 μg/mL significantly reduced disease severity by 32-40% in comparison to water control applied at the same frequency ( p = 0.05). There was no negative yield impact in any of the trials. The third field experiment demonstrated that application of MgO did not result in significant accumulation of total and bioavailable Mg, Mn, Cu, or Zn in the root-associated soil and in soil farther away from the production bed compared to the water control. However, Cu bactericide contributed to significantly higher Mn, Cu, and Zn accumulation in the soil compared to water control ( p = 0.05). This study demonstrates that MgO nanomaterial could be an alternative for Cu bactericide and have potential in reducing risks associated with development of tolerant strains and for reducing Cu load in the environment.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

Before 1991, Xanthomonas euvesicatoria was the causal agent of bacterial spot of tomato in Florida but was quickly replaced by X. perforans . The X. perforans population has changed in genotype and phenotype despite lack of a clear selection pressure. To determine the current Xanthomonas population in Florida, we collected 585 Xanthomonas strains from 70 tomato fields, representing 22 farms across eight counties, in the Florida tomato production region. Strains were isolated from 23 cultivars across eight seed producers and were associated with eight transplant facilities during the fall 2017 season. Our collection was phenotypically and genotypically characterized. Only X. perforans was identified, and all strains except one (99.8%) were tolerant to copper sulfate and 25% of strains were resistant to streptomycin sulfate. Most of the strains (99.3%) that were resistant to streptomycin sulfate were sequence type 1. The X. perforans population consisted of tomato races 3 (8%) and 4 (92%) and all three previously reported sequence types, ranging from 22 to 46% frequency. Approximately half of all strains, none of which were sequence type 2, produced bacteriocins against X. euvesicatoria . Effector profiles were highly variable among strains, which could impact the strains' host range. The effector xopJ4 , which was previously thought to be conserved in X. perforans tomato pathogens, was absent in 19 strains. Nonmetric multidimensional scaling and network analyses show how strains and strain traits were associated with production system variables, including anonymized farms and transplant facilities. These analyses show that the composition of the Florida X. perforans population is diverse and complex.

Fusarium wilt of watermelon (Citrullus lanatus) caused by Fusarium oxysporum f. sp. niveum (Fon), has become an increasing concern of farmers in the southeastern USA, especially in Florida. Management of this disease, most often through the use of resistant cultivars and crop rotation, requires an accurate understanding of an area's pathogen population structure and phenotypic characteristics. This study improved the understanding of the state's pathogen population by completing multilocus sequence analysis (MLSA) of two housekeeping genes (BT and TEF) and two loci (ITS and IGS), aggressiveness and race-determining bioassays on 72 isolates collected between 2011 and 2015 from major watermelon production areas in North, Central, and South Florida. Multilocus sequence analysis (MLSA) failed to group race 3 isolates into a single large clade; moreover, clade membership was not apparently correlated with aggressiveness (which varied both within and between clades), and only slightly with sampling location. The failure of multilocus sequence analysis using four highly conserved housekeeping genes and loci to clearly group and delineate known Fon races provides justification for future whole genome sequencing efforts whose more robust genomic comparisons will provide higher resolution of intra-species genetic distinctions. Consequently, these results suggest that identification of Fon isolates by race determination alone may fail to detect economically important phenotypic characteristics such as aggressiveness leading to inaccurate risk assessment., Competing Interests: The authors have declared that no competing interests exist.

The development of bacterial tolerance against pesticides poses a serious threat to the sustainability of food production. Widespread use of copper (Cu)-based products for plant disease management has led to the emergence of copper-tolerant pathogens such as Xanthomonas perforans ( X. perforans ) strains in Florida, which is very destructive to the tomato ( Solanum lycopersicum ) industry. In this study, we report a hybrid nanoparticle (NP)-based system, coined Locally Systemic Pesticide (LSP), which has been designed for improved efficacy compared to conventional Cu-based bactericides against Cu-tolerant X. perforans . The silica core-shell structure of LSP particles makes it possible to host ultra-small Cu NPs (<10 nm) and quaternary ammonium (Quat) molecules on the shell. The morphology, release of Cu and Quat, and subsequent in vitro antimicrobial properties were characterized for LSP NPs with core diameters from 50 to 600 nm. A concentration of 4 μg mL -1 (Cu): 1 μg mL -1 (Quat) was found to be sufficient to inhibit the growth of Cu-tolerant X. perforans compared to 100 μg mL -1 (metallic Cu) required with standard Kocide 3000. Wetting properties of LSP exhibited contact angles below 60°, which constitutes a significant improvement from the 90° and 85° observed with water and Kocide 3000, respectively. The design was also found to provide slow Cu release to the leaves upon water washes, and to mitigate the phytotoxicity of water-soluble Cu and Quat agents. With Cu and Quat bound to the LSP silica core-shell structure, no sign of phytotoxicity was observed even at 1000 μg mL -1 (Cu). In greenhouse and field experiments, LSP formulations significantly reduced the severity of bacterial spot disease compared to the water control. Overall, the study highlights the potential of using LSP particles as a candidate for managing tomato bacterial spot disease and beyond., Competing Interests: There are no conflicts to declare., (This journal is © The Royal Society of Chemistry.)

Cucurbit yellow stunting disorder virus (CYSDV) is a single-stranded positive-sense RNA virus that produces devastating disease in watermelon and squash. Foliar symptoms of CYSDV consist of interveinal yellowing, brittleness, and thickening of older leaves leading to reduced plant vigor. A rapid diagnostic method for CYSDV would facilitate early detection and implementation of best viral-based management practices. We developed a rapid isothermal reverse transcription-recombination polymerase amplification (exo RT-RPA) assay for the detection of CYSDV. The primers and a 6-fluorescein amidite (6-FAM) probe were developed to target the nucleocapsid gene. The real-time assay detected CYSDV at 2.5 pg purified total RNA extracted from CYSDV-infected leaf tissue and corresponded to 10 copies of the target molecule. The assay was specific and did not cross-react with other common cucurbit viruses found in Florida and Georgia. The performance of the exo RT-RPA was evaluated using crude extract from 21 cucurbit field samples and demonstrated that the exo RT-RPA is a rapid procedure, thus providing a promising novel alternative approach for the detection of CYSDV., (Copyright © 2020 Elsevier Ltd. All rights reserved.)

Tomato (Solanum lycopersicum), pepper (Capsicum annum), and gboma (Solanum macrocarpon) are major vegetables in Togo, with many people depending on these crops for their livelihood. In December 2018, during the dry season with temperatures between 21°C to 35°C, tomato ('Petomech'), pepper ('Gboyebesse') and gboma (local landrace) showing wilt symptoms without foliar yellowing were collected from two locations, Tchouloum and CECO-AGRO sites in the Sotouboua Prefecture of Togo, ~300 km from the capital city of Lome. Disease incidence ranged between 10% to 50% in multiple fields. Cut stems of most wilting tomato, pepper and gboma plants produced bacterial ooze in water and vascular discoloration was visible in longitudinal stem sections. Ground cut stem tissue tested positive with Rs ImmunoStrips specific to the Ralstonia solanacearum species complex (RSSC) (Agdia Inc., Elkhart, IN, USA). Collected samples were stored at ambient temperature and cultured within 36 hr. Culturing sap from cut stems plated on modified SMSA medium (Engelbrecht 1994) yielded colonies with typical RSSC morphology: slow-growing, irregular, mucoid, and white with red centers. Genomic DNA was extracted from thirteen isolates: two from gboma, five from tomato and six from pepper. The expected 280-bp band was amplified from all 13 genomic DNAs following polymerase chain reaction (PCR) using the 759/760 RSSC-specific primer pair (Opina et al. 1997). PCR with the 630/631 primers, which identify the Race 3 biovar 2 RSSC subgroup, did not yield a product from any Togo isolate (Opina et al. 1997). The phylotype multiplex PCR identified all Togo isolates as belonging to the phylotype I subgroup, also called R. pseudosolanacearum (Prior et al. 2016; Fegan and Prior 2005). Phylotype control DNAs were from strains GMI1000 (phylotype I, Asia), K60 (phylotype II, Americas), CMR15 (phylotype III, Africa), and PSI07 (phylotype IV, Indondesia). Comparative genomic analysis of the partial endoglucanase (egl) gene, amplified with the Endo primer pairs (Poussier et al. 2000), revealed all Togo strains belonged to sequevar 17, a group known to cause bacterial wilt of peanut in China. (Xu et al. 2009). The egl sequences are in NCBI GenBank accessions MT572393 to MT572405. Koch's postulates were completed by inoculating 28-day-old bacterial wilt-susceptible 'Bonny Best' tomato plants by soil soak (Khokhani et al. 2018). Briefly, soil around each unwounded plant was drenched with 50 ml of a 108 CFU/mL suspension of bacteria grown from a single colony. Five plants were inoculated with each of four randomly selected Togo strains. RSSC phylotype I strain GMI1000 served as a positive control and water treated plants as negative controls. Plants were kept in a 28°C growth chamber with a 12 hr photoperiod. All RSSC inoculated plants were fully wilted within a week; symptoms resembled to those observed in the field. Water treated control plants did not wilt. Culturing sap from all inoculated plants on SMSA medium yielded colonies with typical RSSC morphology that tested positive with the Rs ImmunoStrips. This is the first identification of RSSC in Togo. These results will guide development of disease management strategies and regionally appropriate breeding of vegetable lines with resistance to the phylotype I RSSC strains present in Togo.

Cold hardy citrus is an emerging industry in north Florida. However, it is under the threat of Candidatus Liberibacter asiaticus (CLas), the agent of the citrus disease huanglongbing. Distribution and phenology of the Asian citrus psyllid, Diaphorina citri (Kuwayama), the vector of CLas, was investigated over a 2-year sampling period in north Florida. Diaphorina citri was only found in backyard and ornamental citrus along the Gulf of Mexico, and was not observed in cultivated citrus groves during the 2 years (2017-2018) of the survey. Diaphorina citri population peaks occurred approximately 2 mo later than in central Florida with major population peaks occurring in July. The number of D. citri adults was significantly higher on CLas infected than uninfected citrus trees, whereas more nymphs were found on uninfected trees. Most D. citri were negative for CLas except in Franklin county where both infected trees and psyllids were found. We were able to find adult D. citri during all winter months, despite temperatures as low as -5.5°C. During two consecutive winters, we conducted experiments to determine D. citri cold hardiness by caging D. citri under ambient conditions in mid-November and assessing survivors in the following spring. In 2018, approximately 21%, of D. citri adults survived overwintering whereas 16% survived in 2019 despite lower temperature in 2018 than in 2019. As we are at the earliest stage of HLB infestation, management of D. citri and CLas in north Florida should focus on removal of CLas-infected trees to reduce the reservoir of pathogen., (© The Author(s) 2020. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Gummy stem blight, caused by Stagonosporopsis spp., is a major disease of cucurbits in the United States and China that is managed primarily through the use of fungicides. The objective of this study was to monitor and compare the recent fungicide resistance profiles of Stagonosporopsis spp. in Florida open-field and East China protected-structure production systems. Isolates of Stagonosporopsis spp. were evaluated for sensitivity to the commonly used fungicides azoxystrobin, boscalid, tebuconazole, and thiophanate-methyl at discriminatory rates of 0.096, 0.034, 0.128, and 100 mg/liter, respectively. Isolates were collected from Jiangsu, Jiangxi, Zhejiang, and Anhui provinces in China ( n = 69), 12 counties in Florida ( n = 89), and one county in Georgia ( n = 6). More than 50% of isolates from Florida and East China were resistant to thiophanate-methyl. Boscalid resistance was detected in both isolate collections but was two times more frequent in China. Resistance to azoxystrobin was detected in 66% of isolates in Florida but only 7% in China. Tebuconazole was effective in controlling the mycelia growth of Stagonosporopsis spp. in both collections. The results indicate that both production systems currently face similar challenges related to the development of fungicide resistance in Stagonosporopsis spp. However, the resistance profiles are unique for both production systems.

Bacterial spot of tomato, caused by Xanthomonas perforans, X. euvesicatoria, X. vesicatoria and X. gardneri, is a major disease, contributing to significant yield losses worldwide. Over dependence of conventional copper bactericides over the last decades has led to the prevalence of copper-tolerant strains of Xanthomonas spp., making copper bactericides ineffective. Thus, there is a critical need to develop new strategies for better management of copper-tolerant Xanthomonas spp. In this study, we investigated the antimicrobial activity of a hybrid nanoparticle, copper-zinc (Cu/Zn), on copper-tolerant and sensitive strains. The hybrid nanoparticle significantly reduced bacterial growth in vitro compared to the non-treated and micron-size commercial copper controls. Tomato transplants treated with the hybrid nanoparticle had significantly reduced disease severity compared to the controls, and no phytotoxicity was observed on plants. We also studied the hybrid nanoparticle effect on the bacterial pigment xanthomonadin using Near-Infra Red Raman spectroscopy as an indicator of bacterial degradation. The hybrid nanoparticle significantly affected the ability of X. perforans in its production of xanthomonadin when compared with samples treated with micron-size copper or untreated. This study sheds new light on the potential utilization of this novel multi-site Cu/Zn hybrid nanoparticle for bacterial spot management.

Bacterial spot, caused by Xanthomonas spp., is a highly destructive disease of tomatoes worldwide. Copper (Cu) bactericides are often ineffective due to the presence of Cu-tolerant strains. Magnesium oxide (MgO) is an effective alternative to Cu bactericides against Xanthomonas spp. However, the effects of particle size on bactericidal activity and fruit elemental levels are unknown. In this study, nano (20 nm) and micron (0.3 and 0.6 µm) size MgO particles were compared for efficacy. Nano MgO had significantly greater in vitro bactericidal activity against Cu-tolerant X. perforans than micron MgO at 25-50 µg/ml. In field experiments nano and micron MgO applied at 200 and 1,000 µg/ml were evaluated for disease control. Nano MgO at 200 µg/ml was the only treatment that consistently reduced disease severity compared to the untreated control. Inductively Coupled Plasma Optical Emission Spectroscopy revealed that nano MgO applications did not significantly alter Mg, Cu, Ca, K, Mn, P and S accumulation compared to fruits from the untreated plots. We demonstrated that although both nano MgO and micron MgO had bactericidal activity against Cu-tolerant strains in vitro, only nano MgO was effective in bacterial spot disease management under field conditions.

Multispectral imaging is increasingly used in specialty crops, but its benefits in assessment of disease severity and improvements in conventional scouting practice are unknown. Multispectral imaging was conducted using an unmanned aerial vehicle (UAV), and data were analyzed for five flights from Florida and Georgia commercial watermelon fields in 2017. The fields were rated for disease incidence and severity by extension agents and plant pathologists at randomized locations (i.e., conventional scouting) followed by ratings at locations that were identified by differences in normalized difference vegetation index (NDVI) and stress index (i.e., UAV-assisted scouting). Diseases identified by the scouts included gummy stem blight, anthracnose, Fusarium wilt, Phytophthora fruit rot, Alternaria leaf spot, and cucurbit leaf crumple disease. Disease incidence and severity ratings were significantly different between conventional and UAV-assisted scouting ( P < 0.01, Bhapkar/exact test). Higher severity ratings of 4 and 5 on a scale of 1 to 5 from no disease to complete loss of the canopy were more consistent after the scouts used the multispectral images in determining sampling locations. The UAV-assisted scouting locations had significantly lower green, red, and red edge NDVI values and higher stress index values than the conventional scouting areas ( P < 0.05, ANOVA/Tukey), and this corresponded to areas with higher disease severity. Conventional scouting involving human evaluation remains necessary for disease validation. Multispectral imagery improved watermelon field scouting owing to increased ability to identify disease foci and areas of concern more rapidly than conventional scouting practices with early detection of diseases 20% more often using UAV-assisted scouting.

Bacterial spot of tomato is caused by Xanthomonas gardneri, X. euvesicatoria, X. perforans, and X. vesicatoria. Current diagnostic methods for the pathogens are not in-field assays. Recombinase polymerase amplification (RPA) is ideal for in-field detection assays, because it is an isothermal technique that is rapid and more tolerant to inhibitors compared with polymerase chain reaction. Hence, novel RPA probes and primers were designed to amplify regions of the hrcN gene of X. gardneri, X. euvesicatoria, and X. perforans. The X. gardneri RPA is specific to X. gardneri with a detection limit of 10 6 CFU/ml and detected X. gardneri in lesions from naturally (n = 6) or artificially (n = 18) infected plants. The X. euvesicatoria RPA detects both X. euvesicatoria and X. perforans with a detection limit of 10 6 CFU/ml and detected both pathogens in plants artificially infected (n = 36) or naturally infected (n = 85) with either X. euvesicatoria or X. perforans. The X. perforans RPA is specific to X. perforans with a detection limit of 10 7 CFU/ml. Although the X. perforans RPA assay was unable to detect X. perforans from lesions, the X. euvesicatoria RPA was successfully used in field to detect X. perforans from symptomatic field samples (n = 31). The X. perforans RPA was then used to confirm the pathogen in the laboratory. The X. euvesicatoria and X. gardneri RPA is promising for rapid, real-time in-field detection of bacterial spot and one of the first developed among plant pathogenic bacteria.

Pseudomonas syringae sensu stricto (phylogroup 2; referred to as P. syringae ) consists of an environmentally ubiquitous bacterial population associated with diseases of numerous plant species. Recent studies using multilocus sequence analysis have indicated the clonal expansion of several P. syringae lineages, located in phylogroups 2a and 2b, in association with outbreaks of bacterial spot disease of watermelon, cantaloupe, and squash in the United States. To investigate the evolutionary processes that led to the emergence of these epidemic lineages, we sequenced the genomes of six P. syringae strains that were isolated from cucurbits grown in the United States, Europe, and China over a period of more than a decade, as well as eight strains that were isolated from watermelon and squash grown in six different Florida counties during the 2013 and 2014 seasons. These data were subjected to comparative analyses along with 42 previously sequenced genomes of P. syringae stains collected from diverse plant species and environments available from GenBank. Maximum likelihood reconstruction of the P. syringae core genome revealed the presence of a hybrid phylogenetic group, comprised of cucurbit strains collected in Florida, Italy, Serbia, and France, which emerged through genome-wide homologous recombination between phylogroups 2a and 2b. Functional analysis of the recombinant core genome showed that pathways involved in the ATP-dependent transport and metabolism of amino acids, bacterial motility, and secretion systems were enriched for recombination. A survey of described virulence factors indicated the convergent acquisition of several accessory type 3 secreted effectors (T3SEs) among phylogenetically distinct lineages through integrative and conjugative element and plasmid loci. Finally, pathogenicity assays on watermelon and squash showed qualitative differences in virulence between strains of the same clonal lineage, which correlated with T3SEs acquired through various mechanisms of horizontal gene transfer (HGT). This study provides novel insights into the interplay of homologous recombination and HGT toward pathogen emergence and highlights the dynamic nature of P. syringae sensu lato genomes.

Bacterial spot caused by Xanthomonas perforans causes significant damage on tomato in Florida. Due to the presence of copper (Cu)-tolerant X. perforans strains, Cu bactericides are not effective in disease management. Hence, there is a critical need to find alternatives for Cu. Antibacterial activity of magnesium oxide (Nano-MgO), and other metal oxide nanoparticles, were evaluated against a Cu-tolerant and -sensitive X. perforans strain. In vitro experiments demonstrated high antibacterial activity of Nano-MgO against both strains compared with the commercial Cu. The minimum inhibitory concentration of Nano-MgO is 25 µg/ml and the minimum bactericidal concentration is 100 µg/ml against a Cu-tolerant X. perforans strain after 4 h of exposure. Structural changes in the bacterial membrane following exposure to Nano-MgO treatments compared with the controls were observed using transmission electron microscopy. In two greenhouse experiments with a Cu-tolerant strain, bacterial spot severity was significantly reduced by Nano-MgO at 200 µg/ml compared with Cu-ethylene bis-dithiocarbamate (grower standard), and the untreated control (P = 0.05). In three field experiments, Nano-MgO at 200 µg/ml significantly reduced disease severity with no negative impact on yield compared with the untreated control. Inductively coupled plasma mass spectrometric analysis of the fruit confirmed that Nano-MgO application did not lead to the accumulation of Mg, Cu, Ca, K, Mn, P, and S. This study is the first to demonstrate the potential of Nano-MgO against bacterial spot of tomato.

Field trials were conducted at two locations in Florida to evaluate transgenic tomato expressing the ELONGATION FACTOR TU RECEPTOR (EFR) gene from Arabidopsis thaliana, the Bs2 gene from pepper, or both Bs2 and EFR (Bs2/EFR) for managing bacterial wilt caused by Ralstonia solanacearum and bacterial spot caused by Xanthomonas perforans. Expression of EFR or Bs2/EFR in the susceptible genotype Fla. 8000 significantly reduced bacterial wilt incidence (50 to 100%) and increased total yield (57 to 114%) relative to lines expressing only Bs2 or the nontransformed Fla. 8000 control, although the marketable yield was not significantly affected. Following harvest, surviving symptomatic and nonsymptomatic plants were assessed for colonization by R. solanacearum. There were no significant differences in the population at the lower stem. Interestingly, in the middle stem, no bacteria could be recovered from EFR or Bs2/EFR lines but viable bacterial populations were recovered from Bs2 and nontransformed control lines at 10 2 to 10 5 CFU/g of stem tissue. In growth-chamber experiments, the EFR transgenic tomato lines were found to be effective against seven different R. solanacearum strains isolated from the southeastern United States, indicating utility across the southeastern United States. In all of the bacterial spot trials, EFR and Bs2/EFR lines had significantly reduced disease severity (22 to 98%) compared with the Fla. 8000 control. The marketable and total yield of Bs2/EFR were significantly higher (43 to 170%) than Fla. 8000 control in three of four field trials. These results demonstrate for the first time the potential of using the EFR gene for field management of bacterial wilt and bacterial spot diseases of tomato.

Several isothermal techniques for the detection of plant pathogens have been developed with the advent of molecular techniques. Among them, Recombinase Polymerase Amplification (RPA) is becoming an important technique for the rapid, sensitive and cost-effective detection of plant viruses. The RPA technology has the advantage to be implemented in field-based scenarios because the method requires a minimal sample preparation, and is performed at constant low temperature (37-42 °C). The RPA technique is rapidly becoming a promising tool for use in rapid detection and further diagnostics in plant clinics and monitoring quarantine services. This paper presents a review of studies conducted using RPA for detection/diagnosis of plant viruses with either DNA genomes (Banana bunchy top virus, Bean golden yellow mosaic virus, Tomato mottle virus, Tomato yellow leaf curl virus) or RNA genomes (Little Cherry virus 2, Plum pox virus and Rose rosette virus)., (Copyright © 2018 Elsevier Inc. All rights reserved.)

From 2013 to 2014, bacterial leaf spot epidemics incited by Pseudomonas syringae pv. syringae affected an estimated 3,000 ha of watermelon and squash in Florida, and caused foliar blighting and transplant losses in severely affected fields. To investigate the diversity of the causal agent, we isolated 28 P. syringae strains from diseased plants grown in 10 Florida and Georgia counties over the course of 2 years. Strains were confirmed as P. syringae through sequence analysis of the 16S ribosomal RNA, phenotypic, and biochemical profiling; however, 20 displayed an atypical phenotype by exhibiting nonfluorescent activity on King's medium B agar and being negative for ice-nucleating activity. Multilocus sequence analysis and BOX polymerase chain reaction revealed the presence of two haplotypes among the collected strains that grouped into two distinct clades within P. syringae phylogroup 2. Pathogenicity testing showed that watermelon, cantaloupe, and squash seedlings were susceptible to a majority of these strains. Although both haplotypes were equally virulent on cantaloupe, they differed in virulence on watermelon and squash. The distribution of one haplotype in 9 of 10 Florida and Georgia counties sampled indicated that these epidemics were associated with the recent introduction of a novel clonal P. syringae lineage throughout major watermelon production areas in Florida.

Bacterial spot, caused by Xanthomonas spp., is a widespread and damaging bacterial disease of tomato (Solanum lycopersicum). For disease management, growers rely on copper bactericides, which are often ineffective due to the presence of copper-tolerant Xanthomonas strains. This study evaluated the antibacterial activity of the new copper composites core-shell copper (CS-Cu), multivalent copper (MV-Cu), and fixed quaternary ammonium copper (FQ-Cu) as potential alternatives to commercially available micron-sized copper bactericides for controlling copper-tolerant Xanthomonas perforans. In vitro, metallic copper from CS-Cu and FQ-Cu at 100 μg/ml killed the copper-tolerant X. perforans strain within 1 h of exposure. In contrast, none of the micron-sized copper rates (100 to 1,000 μg/ml) from Kocide 3000 significantly reduced copper-tolerant X. perforans populations after 48 h of exposure compared with the water control (P < 0.05). All copper-based treatments killed the copper-sensitive X. perforans strain within 1 h. Greenhouse studies demonstrated that all copper composites significantly reduced bacterial spot disease severity when compared with copper-mancozeb and water controls (P < 0.05). Although there was no significant impact on yield, copper composites significantly reduced disease severity when compared with water controls, using 80% less metallic copper in comparison with copper-mancozeb in field studies (P < 0.05). This study highlights the discovery that copper composites have the potential to manage copper-tolerant X. perforans and tomato bacterial spot.

An unusual fluorescent pseudomonad was isolated from tomato exhibiting leaf spot symptoms similar to bacterial speck. Strains were fluorescent, oxidase- and arginine-dihydrolase-negative, elicited a hypersensitive reaction on tobacco and produced a soft rot on potato slices. However, the strains produced an unusual yellow, mucoid growth on media containing 5 % sucrose that is not typical of levan. Based on multilocus sequence analysis using 16S rRNA, gap1, gltA, gyrB and rpoD, these strains formed a distinct phylogenetic group in the genus Pseudomonas and were most closely related to Pseudomonas viridiflava within the Pseudomonassyringae complex. Whole-genome comparisons, using average nucleotide identity based on blast, of representative strain GEV388 T and publicly available genomes representing the genus Pseudomonas revealed phylogroup 7 P. viridiflava strain UASW0038 and P. viridiflava type strain ICMP 2848 T as the closest relatives with 86.59 and 86.56 % nucleotide identity, respectively. In silico DNA-DNA hybridization using the genome-to-genome distance calculation method estimated 31.1 % DNA relatedness between GEV388 T and P. viridiflava ATCC 13223 T , strongly suggesting the strains are representatives of different species. These results together with Biolog GEN III tests, fatty acid methyl ester profiles and phylogenetic analysis using 16S rRNA and multiple housekeeping gene sequences demonstrated that this group represents a novel species member of the genus Pseudomonas. The name Pseudomonas floridensis sp. nov. is proposed with GEV388 T (=LMG 30013 T =ATCC TSD-90 T ) as the type strain.

Recently, in Central Florida tomato production fields, tomato foliage and fruit were observed with symptoms similar to bacterial speck. Fluorescent pseudomonads were consistently isolated and the strains were characterized by standard LOPAT tests, pathogenicity tests, and genetic characterization using 16S ribosomal RNA (rRNA) sequences and multilocus sequence analysis (MLSA) of conserved housekeeping genes. LOPAT test results indicated that the strains were likely Pseudomonas cichorii. These strains were pathogenic on tomato and were also pathogenic on lettuce, the host for the type strain of P. cichorii. Likewise, strains of P. cichorii isolated in Florida since the early 1980s from hosts other than tomato, along with the type strain, were also pathogenic on tomato. Genetic characterization using 16S rRNA and MLSA confirmed that the strains were most closely related to P. cichorii but varied significantly from the type strain. The Florida P. cichorii strains formed a separate phylogenetic group along with P. cichorii strains isolated from tomato in Tanzania. These strains were different from the previously described morphotypes and genomovars of P. cichorii. Our results indicate the presence of a genetically distinct group of multihost pathogenic P. cichorii strains that have been present in Florida since at least the early 1980s.

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (<5min) has been standardized from RRV infected tissue sources, using PBS-T buffer (pH 7.4), which facilitates the virus adsorption onto the PCR tubes at 4°C for 2min, followed by denaturation to release the RNA. RT-exoRPA analysis of the infected plants using the primer/probe indicated that the virus could be detected from leaves, stems, petals, pollen, primary roots and secondary roots. In addition, the assay was efficiently used in the diagnosis of RRV from different rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes., (Copyright © 2017 Elsevier B.V. All rights reserved.)

Bacterial leaf spot of watermelon caused by Pseudomonas syringae has been an emerging disease in the southeastern United States in recent years. Disease outbreaks in Florida were widespread from 2013 to 2014 and resulted in foliar blighting at the early stages of the crop and transplant losses. We conducted a series of field trials at two locations over the course of two years to examine the chemical control options that may be effective in management of this disease, and to investigate the environmental conditions conducive for bacterial leaf spot development. Weekly applications of acibenzolar-S-methyl (ASM) foliar, ASM drip, or copper hydroxide mixed with ethylene bis-dithiocarbamate were effective in reducing the standardized area under the disease progress curve (P < 0.05). Pearson's correlation test demonstrated a negative relationship between the average weekly temperature and disease severity (-0.77, P = 0.0002). When incorporated into a multiple regression model with the square root transformed average weekly rainfall, these two variables accounted for 71% of the variability observed in the weekly disease severity (P < 0.0001). This information should be considered when choosing the planting date for watermelon seedlings as the cool conditions often encountered early in the spring season are conducive for bacterial leaf spot development.

Three field experiments were conducted in Florida from 2012-2014 to assess the impact of acibenzolar-S-methyl (ASM), a systemic acquired-resistance inducer, applied as foliar spray or through drip-irrigation lines, on bacterial wilt incidence and yield of grafted tomatoes. The experiments were conducted in a field with race 1, biovar 1 strain of Ralstonia solanacearum, causal agent of tomato bacterial wilt. In all three experiments, the susceptible tomato variety BHN 602, grafted onto a resistant rootstock BHN 998, was compared with nongrafted BHN 602, treated with or without foliar applications of ASM and with grafted plants treated with foliar applications of ASM. In two experiments, an additional treatment of drip applications of ASM on grafted and nongrafted plants was evaluated. Grafting alone or in combination with drip applications of ASM (178.6 μM) significantly reduced disease incidence and increased total marketable yield relative to nongrafted treatments. There were no significant differences between grafted plants with or without drip ASM applications in terms of bacterial wilt incidence or total marketable yield. However, we demonstrate for the first time that foliar ASM applications on grafted plants negatively affects the total marketable yield compared with drip ASM applications on grafted plants or nontreated grafted control.

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV&#95;2-1 and RRV&#95;2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV&#95;3-2 and RRV&#95;3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV&#95;3-5 showing 100% positive detection, while RRV&#95;2-1, RRV&#95;2-2 and RRV&#95;3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Bacterial spot of tomato, a major problem in many tomato production areas, is caused by Xanthomonas euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri. In order to detect and identify the bacterial spot pathogens, we evaluated a region of hrpB operon as a source for primers and probes for real-time polymerase chain reaction (PCR). A 420-bp fragment of the hrpB7 gene was amplified by PCR from 75 strains representing the four species. The PCR products were sequenced and phylogenetic analysis revealed that hrpB7 is highly conserved within each species, with a single-nucleotide polymorphism (SNP) among the X. vesicatoria strains. X. euvesicatoria and X. perforans varied by two SNP. Four probes and two primer sets were designed to target the four bacterial spot pathogens based on their hrpB7 gene sequences. In order to simultaneously detect the four bacterial spot pathogens, the four probes and two primer sets were optimized for a multiplex real-time TaqMan PCR assay. The optimized multiplex assay was determined to be highly specific to the four bacterial spot pathogens. Because the optimized multiplex assay facilitated the identification of each bacterial spot pathogen from pure cultures and infected plant tissue, it holds great potential as a diagnostic tool.