Search

A greenhouse pot study was conducted on four cover crops (annual ryegrass, perennial tetraploid ryegrass, winter wheat cv. ‘Caledonia’ and sorghum-sudangrass) and one rotation crop (sweet corn cv. ...

Four species of plant parasitic nematodes were present in soil samples planted with forage legumes at Alachua County, Florida, USA. The detected species Belonolaimus longicaudatus, Criconemella ornate, Hoplolaimus galeatus, and Paratrichodorus minor were described in the present study. They belong to orders Rhabditida (Belonolaimus longicaudatus, Criconemella ornate, and Hoplolaimus galeatus) and Triplonchida (Paratrichodorus minor) and to taxonomical families Dolichodoridae (Belonolaimus longicaudatus), Hoplolaimidae (Hoplolaimus galeatus) Criconematidae (Criconemella ornate), and Trichodoridae (Paratrichodorus minor). The identification of the present specimens was based on the classical taxonomy, following morphological and morphometrical characters in the species specific identification keys

Nematodes in the family Trichodoridae (Thorne, 1935) Siddiqi, 1961, are commonly called "stubby-root" nematodes, because feeding by these nematodes can cause a stunted or "stubby" appearing root system. Paratrichodorus minor is the most common species of stubby-root nematode in Florida, and in tropical and sub-tropical regions worldwide. Paratrichodorus minor is important because of the direct damage it causes to plant roots, and also because it can transmit certain plant viruses. This document is EENY-339, one of a series of Featured Creatures from the Entomology and Nematology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. Published: November 2004. EENY339/IN616: Stubby-Root Nematode, Nanidorus minor (Colbran) Siddiqi (syn. Paratrichodorus minor, P. christiei, Trichodorus minor, T. christiei) (Nematoda: Adenophorea: Triplonchida: Diphtherophorina: Trichodoridea: Trichodoridae) (ufl.edu)

In early 2016, hop plants were introduced into Florida. By late 2016, the hop plants were showing stunted growth and were heavily parasitized by Meloidogyne javanica. In this study, we determined host susceptibility of 14 hop cultivars to M. javanica in a greenhouse experiment and monitored population development of plant-parasitic nematode species in the root zone of 17 hop cultivars planted in three newly established hop yards in Florida. Plant-parasitic nematodes in the rooting zone soil of field grown hop plants included M. javanica, Pratylenchus brachyurus, Paratrichodorus minor, Belonolaimus longicaudatus, Xiphinema setariae/vulgare complex, Mesocriconema xenoplax, and Helicotylenchus dihystera; however, soil population densities of P. minor, B. longicaudatus, X. setariae/vulgare complex, M. xenoplax, and H. dihystera remained low through the study. Root galling, M. javanica egg production, and soil population densities of M. javanica were consistently large on the 'Canadian Red Vine', 'Centennial', 'Chinook', and 'Comet' cultivars, and small on the 'Galena' and 'Triple Perle' cultivars. No differences were observed in soil population densities of P. brachyurus among hop cultivars. Overall, our study provides the first report of plant-parasitic nematode population development in the root zone on hop cultivars planted in Florida. In early 2016, hop plants were introduced into Florida. By late 2016, the hop plants were showing stunted growth and were heavily parasitized by Meloidogyne javanica. In this study, we determined host susceptibility of 14 hop cultivars to M. javanica in a greenhouse experiment and monitored population development of plant-parasitic nematode species in the root zone of 17 hop cultivars planted in three newly established hop yards in Florida. Plant-parasitic nematodes in the rooting zone soil of field grown hop plants included M. javanica, Pratylenchus brachyurus, Paratrichodorus minor, Belonolaimus longicaudatus, Xiphinema setariae/vulgare complex, Mesocriconema xenoplax, and Helicotylenchus dihystera; however, soil population densities of P. minor, B. longicaudatus, X. setariae/vulgare complex, M. xenoplax, and H. dihystera remained low through the study. Root galling, M. javanica egg production, and soil population densities of M. javanica were consistently large on the ‘Canadian Red Vine’, ‘Centennial’, ‘Chinook’, and ‘Comet’ cultivars, and small on the ‘Galena’ and ‘Triple Perle’ cultivars. No differences were observed in soil population densities of P. brachyurus among hop cultivars. Overall, our study provides the first report of plant-parasitic nematode population development in the root zone on hop cultivars planted in Florida.

Onions (Allium cepa L.) are the leading vegetable crop in Georgia accounting for 13.7% of total state vegetable production (Wolfe and Stubbs, 2017). In November 2017, two samples each of onion (var. Candy Ann) seedlings and soil were received from the University of Georgia Cooperative Extension office in Tattnall County, GA. The samples were collected from a nursery fumigated with metam sodium and used for sweet onion transplant production. Symptoms of the damaged plants included stunted growth both in the root system and foliage, tip die-back of the leaves (Fig. 1A,B), and slight swelling at the tip of roots. Vermiform life stages from the soil samples were extracted using centrifugal-flotation technique (Jenkins, 1964). On an average, 67 stubby-root nematodes per 100 cm3 of soil were obtained. Additional two soil samples were collected from the nursery in December 2017 to confirm the presence of the nematode. On an average, 1 and 75 nematodes per 100 cm3 of soil were recovered from areas with healthy and infested plants, respectively. Because the male individuals were not found in the soil samples, females were used for species identification. Morphological and molecular analyses of females (Fig. 2A-C) identified the species as Paratrichodorus minor (Colbran) Siddiqi; (Decraemer, 1995). Nematode body shape was “cigar-shaped” with dorsally curved “onchiostyle” stylet Females had an oval-shaped vagina, vulva a transverse slit, and lateral body pores were absent. The measurements of females (n = 20) included: body length 671.1 (570.1–785.3) µm; body width 32.5 (27.8–37.0) µm; onchiostyle 32.5 (31.1–34.8) µm; anterior end to esophagus-intestinal valve 117.6 (101.2–128.5) µm; a 21.5 (15.3–28.1) µm; b 5.2 (4.9–6.3) µm; V 52.9% (48.1–55.4%) µm; and vagina length 8.7 (7.8–10.7) µm. To confirm the identity of P. minor, DNA was extracted from single females (n = 3) using Extract-N-Amp™ Tissue PCR Kit (Sigma-Alredich Inc., St. Louis, MO). The partial 18S rRNA, the D2-D3 expansion segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5′ CTACCACATCCAAGGAAGGC 3′)/932R (5′ TATCTGATCGCTGTCGAACC 3′), D2A (5′ ACAAGTACCGTGAGGGAAAGTTG 3′)/D3B (5′ TCGGAAGGAACCAGCTACTA 3′), and BL18 (5′ CCCGTCGCTACTACCGATT 3′)/5818 (5′ ACGARCCGAGTGATCCAC 3′), respectively (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015; Shaver et al., 2016). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited in the GenBank databases (18S rRNA: MG856931; 28S rRNA: MG856933; ITS1 rDNA: MH464152). The 18S rRNA, 28S D2-D3, and ITS1 rDNA sequences shared 99% similarity (100% coverage) with GenBank accessions of P. minor from California, Arkansas, and China (18S rRNA: JN123365; 28S D2-D3: JN123395; ITS1 rDNA: GU645811). In a pathogenicity test, five sweet onion seeds var. Pirate were planted (one per pot) in 11.5-cm-diameter polyethylene pots containing 1,000 cm3 of equal parts of pasteurized field soil and sand, and then inoculated with 1,000 fresh P. minor. Plants were grown for 9 wk in a greenhouse at 25 ± 2°C prior to extraction of nematodes from soil. Plant roots were abbreviated and final population density of P. minor was 2,856 ± 104 per pot (285 nematodes/100 cm3 of soil) confirming the nematode parasitism on onion. To our knowledge, this is the first report of P. minor parasitizing onion in Georgia. Stubby-root nematode (Paratrichodorus sp.) has already been reported on corn, St. Augustine grass, and switchgrass in Georgia (Heald and Perry, 1969; Davis and Timper, 2000; Mekete et al., 2011). In the U.S.A, P. minor is known to occur on diverse crops in most of the states (Decraemer, 1995; CABI/EPPO, 2002). A survey of vegetable-producing areas in Georgia is currently under investigation to determine the distribution of this economically important nematode species. Figure 1 Damage symptoms caused by stubby-root nematode Paratrichodorus minor on sweet onion in Georgia. A large area of stunted and chlorotic plant foliage (A); Infested seedlings with abbreviated roots and necrotic leaf tips (B). Figure 2 Light microscopy micrographs showing morphological characters of stubby-root nematode, Paratrichodorus minor. Entire body (A), anterior end (B), and posterior region (C) of female nematode.

Non-linear regression models were used to estimate the effect of own and other taxa previous population levels, nitrogen application, and crop rotation on population dynamics of Mononchidae, Dorylaimidae, microbivorous (Rhabditidae), lance ( Hoplolaimus galeatus ), spiral ( Helicotylencus dihystera ), stubby root ( Paratrichodorus minor ), lesion ( Pratylenchus zeae ), and cotton root-knot ( Meloigogyne incognita ) nematodes using data from the Cullars rotation, which is the oldest soil fertility experiment in the Southern United States. Because field experimental data was used, a spatial component was included as populations in one plot were proved to be related to the population level of their neighbors. Own previous levels were found to be very important for all eight groups of nematodes (all groups’ current population relied heavily on its own previous population value) and all the groups had an interaction effect with at least one other group. Lesion and cotton root-knot nematodes were found to be competitive while Mononchidae, Dorylaimidae, microbivorous and lance nematodes were non-competitive. All the populations showed high seasonality patterns having lower populations during winter, to then remain steady until September–October when there is a significant increase in the population of cotton root-knot, Dorylaimidae, microbivorous, and lesion nematodes. Nitrogen had a positive effect on Mononchidae, microbivorous, spiral, and cotton root-knot nematodes. The use of clover after cotton in the rotation crop program proved to be significantly better in reducing plant parasitic nematodes compared to other treatments.

During the survey of plant parasitic nematode of Citrus orchard in Korea, Paratrichodorus minor (Colbran, 1956) Siddiqi is founded from the soil of Citrus unshiu Markovich for the first time in Korea. The body length of females is 428.34~506.22 ㎛ long: a = 12.08~22.79, b = 4.02~5.02, V(%) = 38.46~60.68. The excretory pore is located near the base of esophagus. Additionally, the morphological characteristics on P. porosus (Allen, 1957) Siddiqi, 1974 recorded in 1976 on Korea is redescribed in detail.

Abstract Sequence data were obtained for the full length of the ribosomal DNA (rDNA) 18S gene of specimens from three populations of Paratrichodorus christiei from the USA and four populations of P. minor from Brazil and Portugal. Alignment of the sequences and their application in a phylogenetic analysis revealed that the populations of P.christiei and P.minor formed a single cluster that differentiated from a second cluster comprising P.anemones and P.pachydermus. Previously, P.christiei had been proposed as a junior synonym of P.minor, but this synonymy had not been universally accepted, with many reports, particularly from the USA, continuing to refer to P. christiei. The results obtained here with the sequences of the rDNA 18S gene from the various populations confirm the validity of the synonymy of P.christiei with P.minor.

Two experiments were conducted during autumn 1997 and 1998 in west-central Florida to evaluate the effectiveness of soil solarization alone and in combination with the biological control agents Streptomyces lydicus (Actinovate) and Pseudomonas chlororaphis (syn. P. aureofasciens, AtEze) and the reduced-risk fungicide fludioxonil (Medallion) in managing soilborne pathogens of impatiens (Impatiens × wallerana, ‘Accent Burgundy’). Naturally infested soil was solarized for 47 or 48 days during September and October using two layers of 25-μm clear, low-density polyethylene mulch, separated by an air space of up to 7.5 cm. Solarization decreased the final incidence and progress of Rhizoctonia crown rot and blight, incidence of Pythium spp. in roots, and root discoloration, and increased shoot biomass in both experiments. The technique also consistently reduced root-knot severity and population densities of Meloidogyne incognita, Dolichodorus heterocephalus, Paratrichodorus minor, and Criconemella spp. The incidence of Rhizoctonia crown rot and blight was reduced by fludioxonil, but not by the biological control agents.

A survey was conducted in the food crop production area of western Kenya to characterise the nematode communities in different cropping systems and to monitor the effect of improved fallows on the abundance, diversity and community structure of plant-parasitic nematode assemblages. Soil samples were taken from short-term natural fallows ( 20 years), maize/beans cultivated fields and improved fallows with Crotalaria grahamiana , Sesbania sesban and Tephrosia vogelii . The Shannon diversity index and evenness were used to assess nematode diversity in the different cropping systems. The relationships between plant-parasitic nematodes and the soil physico-chemical properties were investigated with principal component analysis and co-inertia analysis. Planting trees/shrubs as improved fallows in croplands dramatically increased the populations of nematodes in the soil. However, the diversity of plant-parasitic nematodes was reduced. The distribution of plant-parasitic nematodes was correlated with that of some soil physical and chemical properties. Scutellonema spp. were dominant in the improved fallows where the highest values of magnesium and potassium were recorded. The plant-parasitic Dorylaimida ( Xiphinema spp. and Paratrichodorus minor ) were more abundant in the maize/beans plots and this abundance seemed related to high soil bulk density. Meloidogyne spp. and Rotylenchulus borealis had a strong positive correlation with soil organic matter and clay, and were abundant in the long-term natural fallows. The correlations between soil physico-chemical properties and nematodes indicate that, apart from the direct influence of the host plant, the soil characteristics play an important role in the abundance, distribution and structure of nematode communities. This validates the potential of nematodes as bio-indicator organisms of soil status.

The influence of underlying hydrology and overhead irrigation on plant parasitic nematode populations in upland and hydromorphic rice was examined during three successive seasons on a valley slope at the West Africa Rice Development Association station, Cote d’Ivoire. Nematode population densities and species composition were clearly affected by hydrology. Nematode populations in hydromorphic rice were characterised by Basiria spp., Coslenchus spp. and Filenchus spp. (combined) and Paratrichodorus minor . Upland rice was characterised by Scutellonema clathricaudatum, Pratylenchus zeae, and Mesocriconema tescorum . Rotylenchulus spp. and Heterodera sacchari being concentrated in the lower upland rice area whereas Helicotylenchus spp. and Meloidogyne incognita, were distributed over the hill slope. For many species peak population density shifted, relative to the slope, between sowing and harvest. Excepting the disappearance of rarer species, only H. sacchari population densities were correlated with time, increasing with duration of the experiment. There was little evidence that overhead irrigation had any influence on nematode species composition, but it influenced population densities of ectoparasitic nematodes and had a strong positive influence on yield. Yield was also positively correlated with proximity to the water table and declined as the experiment progressed. Because of the complexity of nematode communities it was difficult to determine the effects of individual species on plant growth characters or yield.

Twelve plant-parasitic nematode genera and 25 species were identified in soil and root samples collected from 17 localities in the soybean production areas of South Africa during the 1995/96 season. Predominant endoparasites found included Meloidogyne incognita, M. javanica, M. hapla, M. ethiopica, Pratylenchus zeae and P. brachyurus. Meloidogyne species occurred in 91% of all root samples, P. zeae in 87% and P. brachyurus in 33%. The occurrence of the three predominant endoparasites was not restricted to sandy soil, but they were also prevalent in soils with high clay contents. Other endoparasitic nematode species were Pratylenchus crenatus, P. teres, P. neglectus, P. thornei, Rotylenchulus parvus and Ditylenchus africanus. Nematodes found in soil included Helicotylenchus dihystera and Scutellonema brachyurus, which occurred in 78 and 71%, respectively, of all soil samples. Other nematodes found in soil samples were Helicotylenchus pseudorobustus, H. digonicus, H. microcephalus, Scutellonema truncatum, Rotylenchus unisexus, Mesocriconema sphaerocephalum, Paratrichodorus minor, Longidorus pisi, Xiphinema vanderlindei, X. elongatum and Tylenchorhynchus goffarti. Highest prominence values (PV) for Meloidogyne species were recorded on cultivars Prima, Bakgat, Tamboti, Hutcheson and Knap and the lowest on cultivars PAN812, SCS1, Nyala, Gazelle and A7119. Eight nematode genera and 19 species extracted during this study are reported for the first time in association with soybean in South Africa.

Adult and juvenile characters were used to identify Paratylenchus nanus Cobb, 1923 and Paratrichodorus minor (Colbran, 1956) Siddiqi, 1974 from soils under pasture in New Zealand. In glasshouse tests of 15 pasture plants, common in New Zealand, all good hosts (ratio of final to initial population >1) of P. nanus were grasses, namely Dactylis glomerata , Lolium multiflorum and L. perenne (Neotyphodium endophyte-infected and-free), all new host records for this species. Good hosts of P.minor included those listed for P.nanus and Festuca arundinacea (endophyte-free) , Poa annua , Trifolium pratense , T. repens and T. subterraneum. Except for T. repens, these are all new host records for P.minor in New Zealand.

Populations of both Paratrichodorus minor and Paratylenchus nanus in a grazed pasture in Waikato, New Zealand were assessed in single 2.5 cm diam. core samples over six successive seasons. Neither seasonal periodicity nor a consistent vertical distribution pattern was observed in the P.minor population. P.nanus had distinct spring and summer population maxima and was more abundant at 0-10 than 10-20 cm depth. P.minor but not P.nanus abundance was significantly correlated with rainfall and an activity index combining rainfall and soil temperature for the week before sampling. Significant correlations among P.minor, P.nanus and concentrations of some soil nutrients seemed to reflect soil nutrient interactions with other biotic factors such as plant growth. There was no evidence for competition between these two nematodes. Host root resource, spatial aggregation and differences in morphology that indicate niche differences are discussed as possible reasons for the observed lack of competition.

White clover and perennial ryegrass plants were grown in pots containing a sandy soil amended with chitin Soil nematode numbers were examined after 6 weeks of plant growth Amendment with chitin significantly reduced the abundance of Heterodera trifolii in white clover roots and Pratylenchus sp in perennial ryegrass roots Abundance of Paratrichodorus minor was significantly reduced by chitin amendment compared to unamended controls The total nematode fauna responded to chitin amendment with large increases in abundance

Using published records for the widespread, polyphagous, plant-parasitic nematode Paratrichodorus minor and the 'match climates' function of the computer model CLIMEX, we assessed the impact of a 2°C increase in mean annual temperature. Best current distribution records are from eastern Australia and South Africa (26 and 24 respectively). CLIMEX demonstrates a shift in the range of P. minor in Australia and Africa in response to climate warming. The actual changes are dependent on local interactions between topography and climate. With the available data it is reasonable to consider that similar changes in range would occur elsewhere on the globe. The new distribution would be affected by other environmental conditions and any climate-related changes in them.

A survey of virus vector nematodes based on a total of 320 published and recent records revealed that 3 Longidorus, 1 Paralongidorus, 6 Xiphinema, 2 Trichodoms, and 3 Paratrichodorus species are present in New Zealand. Xiphinema diversicaudatum and Paratrichodorus minor are the most common and widespread species. Longidorus orongorongensis, an undescribed Paralongidorus species and Trichodoms cottieri appear to be endemic species, and Longidorus taniwha, Paratrichodorus lobatus and probably one (still unidentified) species of the X. americanum group are also indigenous to New Zealand. Most of the other species (e.g. Longidorus elongatus, X. diversicaudatum, and Trichodoms primitivus) were probably introduced from Europe. Maps showing the distribution of the 15 species in New Zealand, and illustrations and tables of the morphological characters for species identification, are presented. Several species are of economic importance through direct damage they cause to cultivated plants, and all can be...

Observations are reported on the fine structure of the cuticle of Paratrichodorus minor, P. nanus, P. rhodesiensis and Trichodorus eburneus. The ultrastructure of the cuticle was similar in Paratrichodorus and Trichodorus species; six layers were observed, the innermost layer consisting of three multilaminate units. The anatomy of the cuticle in Trichodorids was quite different from previous observations in other orders of Adenophorea. Two sets of intracuticular canals were observed as well as a peculiar type of junction between cuticle and somatic muscles. These results confirm previous studies on the anatomy of trichodorids and support the withdrawal of the family Trichodoridae from Dorylaimida. Siddiqi's (1983) classification of the trichodorids under the order Triplonchida should be considered with attention.

Foi estudado comparativamente o efeito do cultivo de Crotalaria juncea, por um ano, com incorporação, a uma aplicação do nematicida sistêmico carbofuran, no momento do plantio, em cana-de-açúcar (Saccharum sp.), var. SP79-1011, em solos naturalmente infestados por Helicotylenchus dihystera, Criconemella ornata, Paratrichodorus minor e Trichodorus sp. Foram determinados os níveis populacionais dos nematóides, acompanhados ao longo do experimento, e o comportamento de cada um no solo. As populações dos fitonematóides ectoparasitos estudados apresentaram número reduzido de espécimes, sendo pouco influenciadas pela incorporação da crotalária ou da aplicação do nematicida. Todas as populações permaneceram baixas, ao longo do desenvolvimento da planta, observando-se pequeno incremento populacional a partir dos 90 dias. O comportamento da população de C. ornata em função do tempo nas parcelas tratadas com crotalária ou carbofuran foi expresso pelas equações Y = 100,56524 + 0,01504X - 0,00003032X2 (R² = 0,5605**) ou Y = 10 0,62059 + 0,01394X - 0,00002786X2 (R² = 0,6416**), respectivamente. Ainda, em cana tratada com carbofuran, o aumento populacional de Trichodorus sp., no decorrer do experimento, obecedeu ao modelo quadrático Y = 13,16667 - 0,10904X + 0,00065711X2 (R² = 0,6916**).

Paratrichodorus minor (Fig. 9 D���F) Measurements. See Table 16. Remarks. Paratrichodorus minor was described from Queensland, Australia (Colbran 1956). The type host was not indicated. The names of this species have changed from Trichodorus christiei to Paratrichodorus christiei to Paratrichodorus Nanidorus minor to Nanidorus minor (Rafael Rodriguez) to Paratrichodorus minor. It has been documented in many countries worldwide, including 11 in Europe, 11 in Asia, 13 in Africa, two in North America, five in Central America and Caribbean, six in South America, and four in Oceania (CABI 2002). In the USA, it has been found in 22 states (CABI 2002; Crow 2005 c; Hooper 1977; Karanastasi et al. 2006; Li et al. 2010). In this survey, P. m i n o r was found in 121 turfgrass samples taken in 33 counties in both states. It was common in three turf management zones (green, fairway and tee) and three grass species (bermudagrass, creeping bentgrass, zoysiagrass) in both states. The morphology and morphometrics of the identified population did not differ from previously described populations (Bell & Watson 2001). and in the format: mean �� S.D. (range). This survey revealed that turfgrasses including bermudagrass, creeping bentgrass, and zoysiagrass in NC and SC support a wide variety of plant-parasitic nematodes. Twenty nine nematode species were identified from turfgrasses in the Carolinas. Among them, 11 species (M. graminis, M. naasi, Cactodera sp., P. penetrans, H. conida, H. graminis, M. xenoplax, M. sphaerocephala, O. floridense, P. allius, and D. heterocephalus) were new records from turfgrass in both states; five (Heterodera sp., L. thienemanni, M. curvatum, L. paralongicaudatus, and F. cylindricus) were new in SC; and three (H. wessoni, X. bakeri and A. myceliophagus) were new in NC. The results also revealed a relatively wide distribution of eight species including B. longicaudatus, P. minor, M. graminis, M. xenoplax, H. dihystera, T. claytoni, H. galeatus and P. penetrans in golf courses. This survey clarified the identity of the soil-inhabiting nematodes that parasitize golf course turf in the Carolinas. The prevalence, population level, and distribution map of each nematode species, hazard species, damage threshold and standard management recommendations were presented in Ye et al. (2012). This work was a first step for future study to provide more precise and effective management options to golf-course superintendents., Published as part of Zeng, Yongsan, Ye, Weimin, Tredway, Lane, Martin, Samuel & Martin, Matt, 2012, Taxonomy and morphology of plant-parasitic nematodes associated with turfgrasses in North and South Carolina, USA, pp. 1-46 in Zootaxa 3452 on pages 36-37, DOI: 10.5281/zenodo.210165, {"references":["Colbran, R. C. (1956) Studies of plant and soil nematodes. 1. Two new species from Queensland. Queensland Journal of Agricultural Science, 13, 123 - 126.","Crow, W. T. (2005 c) Diagnosis of Trichodorus obtusus and Paratrichodorus minor on turfgrasses in the Southeastern United States. Plant Health Progress; St. Paul: Plant Management Network, 1 - 7.","Hooper, D. J. (1977) Paratrichodorus (Nanidorus) minor. Commonwealth Institute of Helminthology Descriptions of Plant- Parasitic Nematodes, set 7, no. 103. St. Albans, England: Commonwealth Agricultural Bureaux.","Karanastasi, E., Neilson, R. & Decraemer, W. (2006) First record of two trichodorid nematode species Paratrichodorus minor and Trichodorus sparsus (Nematoda: Trichodoridae Thorne 1935) from Greece. Annals of the Benaki Phytopathological Institute, 20, 129 - 133.","Li, X., Guo, K., Zhang, Y., Yan, X. & Zheng, J. (2010) First report of the stubby root nematode, Paratrichodorus minor, in Mainland China. Plant Disease, 94, 376.","Bell, N. L. & Watson, R. N. (2001) Identification and host range assessment of Paratylenchus nanus (Tylenchida: Tylenchulidae) and Paratrichodorus minor (Triplonchida: Trichodoridae). Nematology, 3, 483 - 490."]}

Vertical distribution of five plant-parasitic nematodes was examined in two north Florida soybean fields in 1987 and 1988. Soil samples were collected from 0-15 cm, 15-30 cm, and 30-45 cm deep at each site. Soil at the three depths consisted of approximately 96% sand. More than 50% of Belonolaimus longicaudatus population densities occurred in the upper 15-cm soil layer at planting, but the species became more evenly distributed through the other depths as the season progressed. Criconemella sphaerocephala was evenly distributed among the three depths in one field but was low (< 20% of the total density) in the upper 15 cm at a second site. Maximum population densities of Pratylenchus brachyurus were observed at 15-30 cm on most sampling dates. Vertical distributions of Meloidogyne incognita and Paratrichodorus minor were erratic and showed seasonal variation. A diagnostic sample from the upper 0-15 cm of these soybean fields revealed only a minority of the populations of most of the phytoparasitic species present.

Abstract In order to develop diagnostic tools for plant-parasitic nematodes of sugarcane in South Africa, this work investigated the potential biodiversity of these nematodes in the amount of nucleic acid available, the discrimination of species by a PCR-based method (targeting the ITS1 region) and the effect of some experimental conditions on their detection or discrimination. The ITS1 amplified fragment varied in size, ranging from 400 bp (Meloidogyne javanica) to 1200 bp (Longidorus pisi, Paratrichodorus minor, Xiphinema elongatum, Xiphinema zulu). Some species discrimination was possible by discernible differences in ITS1 amplified fragment sizes. The potential, as well as shortcomings (inhibitions, competition) of this approach are assessed and further steps/outcomes discussed. Part of the work also focused on DNA extraction. Nematode genomic nucleic acid was extracted from five nematode species (Pratylenchus zeae, Helicotylenchus dihystera, Meloidogyne javanica, Xiphinema elongatum and Paratrichodorus lobatus) and we discuss the significant differences obtained between species in the amount of nucleic acid extracted. There were also marked differences in the quantity and quality of nucleic acid extracted from nematode suspensions originating from soils, depending on the extraction buffer used.

“Stubby-root” nematodes are of agricultural importance as plant-pathogens and as vectors for plant viruses. Two species of stubby-root nematode have been identified as pathogens on warm-season turfgrasses in the southern U.S.: Paratrichodorus minor and Trichodorus obtusus. Both are pathogens of bermudagrass and St. Augustinegrass, with T. obtusus more damaging than P. minor. Methods for distinguishing these species are described that do not require mounting of specimens and can be used at ×100 magnification or less. Accepted for publication 24 November 2004. Published 21 January 2005.

Foi estudado comparativamente o efeito do cultivo de Crotalaria juncea, por um ano, com incorporação, a uma aplicação do nematicida sistêmico carbofuran, no momento do plantio, em cana-de-açúcar (Saccharum sp.), var. SP79-1011, em solos naturalmente infestados por Helicotylenchus dihystera, Criconemella ornata, Paratrichodorus minor e Trichodorus sp. Foram determinados os níveis populacionais dos nematóides, acompanhados ao longo do experimento, e o comportamento de cada um no solo. As populações dos fitonematóides ectoparasitos estudados apresentaram número reduzido de espécimes, sendo pouco influenciadas pela incorporação da crotalária ou da aplicação do nematicida. Todas as populações permaneceram baixas, ao longo do desenvolvimento da planta, observando-se pequeno incremento populacional a partir dos 90 dias. O comportamento da população de C. ornata em função do tempo nas parcelas tratadas com crotalária ou carbofuran foi expresso pelas equações Y = 100,56524 + 0,01504X - 0,00003032X2 (R² = 0,5605**) ou Y = 10 0,62059 + 0,01394X - 0,00002786X2 (R² = 0,6416**), respectivamente. Ainda, em cana tratada com carbofuran, o aumento populacional de Trichodorus sp., no decorrer do experimento, obecedeu ao modelo quadrático Y = 13,16667 - 0,10904X + 0,00065711X2 (R² = 0,6916**). A study was done on the effects of Crotalaria juncea and carbofuran on ectoparasite nematodes of sugarcane (Saccharum sp.) planted in soil naturally infested by Helicotylenchus dihystera, Criconemella ornata, Paratrichodorus minor, and Trichodorus sp. The stydy compared the use of C. juncea for one year, with incorporation, with one application of the systemic nematicide carbofuran at time of planting sugarcane var. SP79-1011. Evaluations were based upon soil nematode population densities throughout the first year of cropping. The nematode populations showed low number of specimens, being slighly influenced by the crotalaria incorporation and carbofuran application. Nematode population level remained low, during plant development, with low increment, in general, after 90 days of planting. The behavior of the C. ornata population in function of the time in plots treated with crotalaria or carbofuran was described by the equations Y = 100,56524 + 0,01504X - 0,00003032X2 (R² = 0,5605**) or Y = 10 0,62059 + 0,01394X - 0,00002786X2 (R² = 0,6416**), respectively. On sugarcane treated with carbofuran the increase of Trichodorus sp. population followed the quadractic model Y = 13,16667 - 0,10904X + 0,00065711X² (R² = 0,6916**).

Soil solarization was shown to be cost effective, compatible with other pest management tactics, readily integrated into standard production systems, and a valid alternative to preplant fumigation with methyl bromide under the tested conditions. Solarization using clear, photoselective, or gas-impermeable plastic was evaluated in combination with metham sodium, 1,3-dichloropropene + chloropicrin, methyl bromide + chloropicrin, pebulate, or cabbage residue. Strip solarization, applied to 20-cm-high, 0.9-m-wide beds, was conducted to achieve compatibility with standard production practices and resulted in soil temperatures 2 to 4°C above those temperatures resulting when using conventional flatbed solarization. Soil temperatures were 1 to 2°C higher at the edges of the raised beds, eliminating any border effects associated with solarization. Following a 40- to 55-day solarization period, the plastic was painted white and used as a production mulch for a subsequent tomato crop. The incidence of Southern blight and the density of Paratrichodorus minor and Criconemella spp. were lower (P < 0.05) in solarized plots. No differences (P < 0.05) in the incidence of Fusarium wilt and the density of nutsedge and Helicotylenchus spp. were observed between plots receiving solarization and plots fumigated with a mixture of methyl bromide + chloropicrin. The severity of root galling was lower (P < 0.05) when soil solarization was combined with 1,3-dichloropropene + chloropicrin (16.2 + 3.4 g/m2) and a gas-impermeable film. The incidence of bacterial wilt was not affected by soil treatments. Marketable yields in plots using various combinations of soil solarization and other tactics were similar (P < 0.05) to yields obtained in plots fumigated with methyl bromide + chloropicrin. The results were validated in several large scale field experiments conducted by commercial growers.

Laboratory studies showed that trichodorids from the semi-arid region of West Africa need relatively low soil temperature levels for reproduction. The nematodes are not able to enter anhydrobiosis. Their localization at depth is probably a response to desiccation of the soil during the dry season and to high soil temperatures in the upper layers of the soil during the rainy season. Laboratory experiments showed that P. minor is pathogenic to sorghum, cowpea and eggplant, P. nanus to millet and sorghum, and P. rhodesiensis to peanut and sorghum. In each case the weight of shoots and roots was reduced by the nematodes but otherwise there were no obvious disease symptoms.

Twenty-nine species of plant-parasitic nematodes were recovered from 282 soil samples collected from turfgrasses in 19 counties in North Carolina (NC) and 20 counties in South Carolina (SC) during 2011 and from previous collections. These nematodes belong to 22 genera in 15 families, including Belonolaimus longicaudatus, Dolichodorus heterocephalus, Filenchus cylindricus, Helicotylenchus dihystera, Scutellonema brachyurum, Hoplolaimus galeatus, Mesocriconema xenoplax, M. curvatum, M. sphaerocephala, Ogma floridense, Paratrichodorus minor, P. allius, Tylenchorhynchus claytoni, Pratylenchus penetrans, Meloidogyne graminis, M. naasi, Heterodera sp., Cactodera sp., Hemicycliophora conida, Loofia thienemanni, Hemicaloosia graminis, Hemicriconemoides wessoni, H. chitwoodi, Paratylenchus goldeni, Xiphinema americanum sensu lato, X. bakeri, X. chambersi, Longidorus paralongicaudatus, and Aphelenchoides myceliophagus. Eleven species (Meloidogyne graminis, M. naasi, Cactodera sp., Pratylenchus penetrans, Hemicycliophora conida, Hemicaloosia graminis, Mesocriconema xenoplax, M. sphaerocephala, Ogma floridense, Paratrichodorus allius, Dolichodorus heterocephalus) were new records from turfgrass in both states; five (Heterodera sp., Loofia thienemanni, M. curvatum, Longidorus paralongicaudatus, Filenchus cylindricus) were new in SC; and three (Hemicriconemoides wessoni, Xiphinema bakeri, Aphelenchoides myceliophagus) were new in NC. The morphological and morphometric characteristics of these species are presented.

The stubby root nematode, Paratrichodorus minor (Colbran, 1956) Siddiqi, 1974, is an economically important species. It not only causes direct damage to the meristemic tissues of plants, but also can be a vector of Tobacco rattle virus and Pepper ringspot virus (2). It has been documented in Afghanistan, Argentina, Australia, Brazil, Canary Islands, Cuba, Egypt, Fiji, India, Israel, Ivory Coast, Japan, Java, Mauritania, New Zealand, Nicaragua, Philippines, Puerto Rico, Senegal, South Africa, Taiwan, Upper Volta, the United States, the former USSR, and Venezuela (1). During a recent investigation on Trichodoridae occurring in China, eight stubby root nematode populations were detected in Hainan, Yunnan, and Fujian provinces in the rhizospheres of eggplant (Solanum melongena), Chinaberry (Melia azedarach), lettuce (Lactuca sativa), longan (Dimocarpus longan), peach (Prunus persica), pear (Pyrus sp.), and walnut (Juglans regia) in soils ranging from clay to sand. The eight populations had similar morphological and molecular characters. The females were cigar shaped with rod-shaped vaginal sclerotization parallel to the longitudinal body axis with a quadrangular vagina in side view having a short vulval slit. The key morphometrics of females were consistent with those of P. minor: body length, 631 to 757 μm; body diameter, 27 to 43 μm; onchiostyle, 35 to 36 μm; a, 18 to 24; b, 4.9 to 5.5; v%, 53 to 55; length of vagina, 10.8 to 11.1 μm; and size of vaginal pieces, 1.7 to 1.9 μm. Males in P. minor are rare and were not found in any of the eight populations. Partial sequences of the 18s RNA gene of each population were amplified with forward primer 5′-AAA GAT TAA GCC ATG CAT G-3′ (2), and reverse primer 5′-AGT CAA ATT AAG CCG CAG-3′ (3), which yielded a PCR fragment of 1,153 bp. PCR products from all eight populations were sequenced and submitted to GenBank and assigned Accession Nos. GQ995703, GQ995704, GQ995705, GQ995706, GQ995707, GQ995708, GQ995709, and GQ995710. The sequences exhibited 99.8 to 100% similarity with those of P. minor isolates DQ345526, AM269897, AJ438052, AJ438053, and AJ438058 from GenBank. Morphological and molecular identification confirmed that all populations were P. minor. To our knowledge, this is the first report of P. minor in mainland China. References: (1) K. Boutsika et al. Nematology 6:145, 2004. (2) W. Decramer. The Family Trichodiridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, the Netherlands, 1995. (3) I. S. Waite et al. Soil Biol. Biochem. 35:1165, 2003.

Damage to sugarcane caused by root-knot nematode (Meloidogyne spp.) is well documented in infertile coarse-textured soils, but crop losses have never been assessed in the fine-textured soils on which more than 95% of Australia’s sugarcane is grown. The impact of nematodes in these more fertile soils was assessed by repeatedly applying nematicides (aldicarb and fenamiphos) to plant and ratoon crops in 16 fields, and measuring their effects on nematode populations, sugarcane growth and yield. In untreated plant crops, mid-season population densities of lesion nematode (Pratylenchus zeae), root-knot nematode (M. javanica), stunt nematode (Tylenchorhynchus annulatus), spiral nematode (Helicotylenchus dihystera) and stubby-root nematode (Paratrichodorus minor) averaged 1065, 214, 535, 217 and 103 nematodes/200 mL soil, respectively. Lower mean nematode population densities were recorded in the first ratoon, particularly for root-knot nematode. Nematicides reduced populations of lesion nematode by 66–99% in both plant and ratoon crops, but control of root-knot nematode was inconsistent, particularly in ratoons. Nematicide treatment had a greater impact on shoot and stalk length than on shoot and stalk number. The entire community of pest nematodes appeared to be contributing to lost productivity, but stalk length and final yield responses correlated most consistently with the number of lesion nematodes controlled. Fine roots in nematicide-treated plots were healthier and more numerous than in untreated plots, and this was indicative of the reduced impact of lesion nematode. Yield responses averaged 15.3% in plant crops and 11.6% in ratoons, indicating that nematodes are subtle but significant pests of sugarcane in fine-textured soils. On the basis of these results, plant-parasitic nematodes are conservatively estimated to cost the Australian sugar industry about AU$82 million/annum.

Summary. Five plant–parasitic nematode species were found to be widespread on sugarcane crops surveyed in south Queensland, namely Pratylenchus zeae, Meloidogyne javanica, Paratrichodorus minor, Helicotylenchus dihystera and Tylenchorhynchus annulatus. Apart from Meloidogyne, high nematode populations were found in most soil types, suggesting more extensive crop losses could be occurring than previously estimated. The most important pests were P. zeae and M. javanica, as they were often found at high densities and their pathogenicity on sugarcane is established. Mean densities for most nematode genera did not differ significantly between sugarcane cultivars, except that fewer Pratylenchus were associated with cultivar CP51-21 than other cultivars surveyed. The density of Pratylenchus in roots was significantly higher in plant crops than in ratoon crops, whereas the density of Paratrichodorus was highest in first and second ratoons.

The effects of Tylenchorhynchus agri and Paratrichodorus minor on infection of creeping bentgrass roots by Meloidogyne naasi were studied in greenhouse experiments. High populations of both ectoparasites reduced M. naasi infection by inhibiting root growth and consequently decreasing the availability of penetration sites. There was evidence that T. christiei also was antagonistic to M. naasi through competition for feeding sites.

Studies on nepoviruses and tobraviruses, and their relationships with their associated vector nematodes, are scarce in Spain. However, virus disease symptoms have often been detected and their nematode vectors are widespread in Peninsular Spain. Nepovirus vector nematodes (Longidorus attenuatus, L. coespiticola, L. elongatus, L. macrosoma, Xiphinema coxi, X. diversicaudatum, X. index, X. italiae, X. pseudocoxi and X. vuittenezi) have been found associated with fruit and cereal crops. AH are also widespread in other crops and uncultivated areas, together with X. rivesi, which has not yet been found associated with fruit and cereal crops in Spain. Tobravirus vectors have been less studied in Spain. Ofthe five recorded species, Paratrichodorus minor and Trichodorus primitivus are present on maize and wheat respect­ ively. The geographical and host distribution ofthese nematodes are given and their ecological characteristics are discussed.

Tree growth, fruit production and population dynamics of three root-knot nematodes, Meloidogyne incognita, M. arenaria and M. javanica were evaluated during six years in a peach planting. The treatments were: 1) preplant soil fumigation with methyl bromide at 450 kg/ha + mycorrhizae at planting, 2) root-knot nematode + Dactylella oviparasitica (S isolate), 3) root-knot nematode + soil from an established peach orchard, and 4) root-knot nematode alone. These four treatments were evaluated under normal and high irrigation regimes. Methyl bromide treatment improved tree growth, fruit production, and nematode control most. D. oviparasitica did not improve growth. The high irrigation regime counteracted the detrimental effects of root-knot nematode without reducing the nematode population. After 6 years root-knot nematode numbers were declining in all treatments except those previously free of the nematode.

The relative importance of the effect of soil temperature, soil texture and host species on the increase and the pathogenicity of a population of Paratrichodorus minor from Israel was studied. Populations increased fastest at 26° C, followed by 30°, 22° and 18°, approaching the host-specific equilibrium density after 90 days. In the presence of a host, populations thrived better in sand and sandy loam than in clay, but were obviously sensitive to moisture fluctuations. Host species affected population increase more than soil temperatures and soil types. In fallow, survival was better in clay and sandy loam than in sand. In vitro, P. minor fed vigorously on epidermal cells in the elongation and meristematic zone of wheat and eggplant roots, causing browning and collapse of the epidermis and cessation of growth. After detaching itself from the feeding site, the nematode left a small tube attached to the cell wall. In pathogenicity trials, two good hosts - eggplant and cotton - showed different responses: growth of eggplant was drastically inhibited at an inoculation level of 200 nematodes per plant, while populations of up to 800 nematodes per plant stimulated growth of cotton roots and tops. Infested eggplant seedlings exhibited a severely thinned and shortened lateral root system and stunted tops.

Insecticidal rates of carbofuran and oxamyl were applied to a trial at Wairakei to control Argentine stem weevil (Listronotus bonariensis (Kuschel)) in ryegrass (Lolium perenne L.), but herbage responses were greatest in the white clover (Trifolium repens L.) component of the pasture. Autumn samples showed significant reductions in the populations of many nematodes, both vermiform and within roots. Nematodes likely to have been responsible for depressing white clover growth are Meloidogyne hapla, Heterodera trifolii, Paratrichodorus minor, Pratylenchus, and Paratylenchus. Because nematodes were probably largely responsible for the observed response to applied insecticide, care is needed in interpreting results of all such trials. It was not possible' to partition the effects of the various nematodes on pasture production.

Annual ryegrass (Lam.) is often double cropped with soybean [ (L.) Merr.] in much of the southeastern United States to provide winter grazing and ground cover. Little is known about the effect of annual ryegrass cultivars on nematodes associated with the grass, and with subsequent soybean crops. In several other taxonomically similar grasses, including tall fescue (Schreb.) and perennial ryegrass (L.), the presence of endophytic fungi imparts pest resistance to the grass. No information is available on the effect of these endophytic fungi on nematodes associated with the grass. Therefore, the objectives of this study were to determine: (i) the effect of annual ryegrass cnltivars on nematodes in the grass and in succeeding soybean, and (ii) the effect of Morgan-Jones and Gams in tall fescue on nematodes. Thirteen annual ryegrass cultivars, ‘Kentucky 31” tall fescue with and without infection, and a nematode-susceptible soybean check were grown for 7 wk in pots in the greenhouse in a Malibis sandy loam (fine-loamy, siliceous, thermic Plinthic Palendults) soil known to be infested with high numbers of phytonematodes. Plants were then removed from the soil, and the soybean was seeded into the pots and grown for 7 wk. Significant differences among nematode populations in the annual ryegrass cultivars occurred, and the nematode numbers were generally higher in the soybean that followed. However, these increased numbers did not affect soybean performance. Therefore, it does not appear that the use of annual ryegrass-soybean doublecropping systems will be effective in controlling most nematodes when using nematode-susceptible soybean cultivars. In tall fescue, lower spiral [ (cobb) Sher.] and stubby root [ (culbran) Siddiqi) nematode numbers were associated with in the grass. Since nematode damage has previously been associated with stand decline in tall fescue, breeders working in nematode-infested areas should be aware that decreased pest resistance may be associated with the removal of from tall fescue.