Search

A unique genetic variation with respect to blast resistance was clarified in 201 rice accessions from Vietnam. These accessions were classified into three clusters—A, B1, and B2—based on their reactions to 26 standard differential blast isolates selected in Vietnam. Cluster A was the dominant cultivar group in Vietnam and the most susceptible of the three clusters. Cluster B1 was the smallest group and the most resistant. Cluster B2 was the second-most dominant group and of intermediate resistance between clusters A and B1. The percentages of accessions comprising each cluster varied by region and area. Accessions in cluster A were distributed widely throughout Vietnam and had the highest frequencies in both the Central and North regions. Accessions in cluster B2 were found with highest frequencies in the mountainous and intermediate areas of the North region. Accessions in cluster B1 were found with highest frequencies in the Central region and Red River Delta area (North region). These results suggest that rice accessions in Vietnam were basically susceptible (cluster A) or of intermediate resistance (cluster B2), and that high-resistance cultivars were mainly distributed in the low altitude areas, such as the Red River Delta area and Central region.

A total of 47 rice accessions collected from Kenya were investigated the genetic variations and classified into two cluster groups, A and B, by polymorphism data of 65 simple sequence repeat (SSR) markers. Clusters A and B corresponded to Japonica and Indica Groups, respectively. The number of Japonica Group accessions was limited in comparison with those of the Indica Group. Based on their patterns of reaction to standard differential blast isolates (SDBIs), these accessions and 57 control cultivars including differential varieties and several accessions harboring partial resistance genes were classified again into three cluster groups: Ia (high resistance), Ib (intermediate resistance) and II (susceptible). The rice accessions from Kenya were classified only into groups Ia and Ib. The accessions from Kenya were finally classified into three categories, A-Ia, B-Ia and B-Ib, based on the two classifications of polymorphism of SSR markers and resistance. The Indica Group accessions had wider genetic variation for blast resistance than did the Japonica Group accessions. The three leading cultivars (Basmati 217, Basmati 370 and ITA 310) categorized into Cluster group Ia were susceptible to some SDBIs from Kenya. The genetic variation for blast resistance in Kenya was demonstrated as the first report using SDBIs.

Additional file 1: Figure S1. Details of two major QTLs for HI. (a) qHI5.1 and (b) qHI8.1. The GSE5/GW5 gene is closely linked with RM1089. The dotted lines on the LOD value curves indicate a threshold calculated by a 1000-times permutation test (the value is 2.41). Figure S2. Identification of genomic polymorphism between IR 64 and YTH183. (a) Schematic image of LOC_Os05g09520. The white boxes, black triangle, and black bar indicate, respectively, the exon region, insertion position, and 1 Kbp scale bar. The two arrows indicate the primer positions, whose sequences are as follows: Forward primer: TCCATTTTATTGGCATCACTCA; Reverse primer: CCCAAATCCCAGGCTACTGAT (from Duan et al. 2017). (b) Electrophoresis image of the amplicons. M: 100 bp ladder. Figure S3. Graphical genotypes of YTH183. The open and closed bar represent genotypes at regions corresponding to the IR64 homozygous segment and the YP5 homozygous segment, respectively. The top numbers indicate the chromosome number. Figure S4. 1000-grain weight of IR64, YTH183, and the sib lines derived from the same parent (YP5) as YTH183 (Fujita et al. 2009) at Tsukuba in 2015. The black and white bars indicate the IR64-type and YTH183-type alleles at the GSE5/GW5 locus, respectively. The P value indicates the statistical analysis by Student’s t-test. Table S1. Heading date of IR 64 and YTH183. Table S2. The harvest index of IR 64, YTH183, and their derived RIL population. Table S3. Average daily temperature during the maturing stage.

We characterized a rice introgression line, YTH34, harboring a chromosome segment from a New Plant Type (NPT) cultivar, IR65600-87-2-2-3, in the genetic background of an Indica Group elite rice cultivar, IR 64, under upland and irrigated lowland conditions in Japan. The number of panicles (as an indicator of tiller number) and number of spikelets per panicle of YTH34 were lower than those of IR 64 under irrigated lowland conditions, but both of those as well as culm length, panicle length, seed fertility, panicle weight, whole plant weight, and harvest index were dramatically reduced under upland conditions. And the low tiller of YTH34 was confirmed to start after the maximum tiller stage. In particular, the decrease of panicle number was remarkable in upland, so we tried to identify the chromosome location of the relevant gene. Through segregation and linkage analyses using F3 family lines derived from a cross between IR 64 and YTH34, and SSR markers, we found that low tiller number was controlled by a single recessive gene, ltn2, and mapped with the distance of 2.1 cM from SSR marker RM21950, in an introgressed segment on chromosome 7. YTH34 harboring ltn2 and the genetic information for DNA markers linked will be useful for genetic modification of plant architectures of Indica Group rice cultivar.