Search

Objective: To describe pediatric patients with CACNA1F-associated incomplete X-linked congenital stationary night blindness presenting without nyctalopia, and review the causes leading to diagnosis delay., Design: Retrospective cohort., Methods: This was set in a single institution between 2004 and 2019. There were12 patients. The intervention or observation procedures used were clinical course, visual acuity, refractive error, images, electrophysiology, genetic testing, pedigree. The main outcome measures were cohort description and causes of diagnosis delay., Results: For these 12 cases, the referring diagnosis was congenital nystagmus (7), reduced best-corrected visual acuity (BCVA, 4), and progressive myopia (1). Nyctalopia was not a presenting symptom and developed in 4 patients during follow-up. Seven patients presented with nystagmus. All patients developed early-onset myopia. Myopia progressed more rapidly before age 6 than after (average 1.14 D vs 0.25 D) (p = 0.0033). The average final BCVA was 20/50 (20/30-20/150). Vision at presentation was correlated with final visual acuity (r 2  = 0.87, p = 5.4E-06). The first cycloplegic refraction was correlated to the final refractive error (r 2  = 0.49, p = 0.009). Patients with nystagmus had worse BCVA on average. Full-field electroretinogram was abnormal and diagnostic in all cases, as confirmed by genetic testing. The average time to diagnosis was 4.2 years, and the average age at diagnosis was 7.9 years. The delay in diagnosis was due to the absence of nyctalopia, not performing an electroretinogram and/or an alternative diagnosis., Conclusions: In children, CACNA1F-associated synaptic dysfunction does not usually present with night blindness. It should be suspected in male patients with early-onset myopia, especially with a history of nystagmus., Competing Interests: Footnotes and Disclosure Funding/Support: Dr. Drack is supported by Ronald Keech Professorship. Dr. Dumitrescu is supported by Chakraborty Family Professor in Pediatric Genetic Retinal Diseases. Financial Disclosures: Alina Dumitrescu: Consultant for PureTech Health Inc. (Boston, MA ReVision Therapeutics Inc. (Ridgewood, NJ). Advisory board Janssen Pharmaceutica (Titusville, NJ). Arlene Drack: Research Grants Chakraborty Family Foundation, Fighting Blindness Canada, InVision2020, Spark Therapeutics, Regeneron. Advisory Board NOAH and ProQr. Wanda L Pfeifer: Employee of iScreen Vision Inc. Memphis TN. Monica Arhens—No financial disclosures. Jeaneen L Andorf—No financial disclosures., (Copyright © 2023 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.)

Introduction: Infantile nystagmus and foveal hypoplasia associated with AHR gene defects is a newly recognized and rare disorder. Our aim was to present a patient with a novel biallelic AHR pathogenic variant with electrophysiological evidence of chiasmal misrouting., Materials and Methods: Complete ocular examination, fundus imaging, visual evoked potentials (VEP) and full-field electroretinography were performed at initial presentation. Genetic testing was performed by whole exome sequencing., Results: Female patient of 6 years old presented a reduced best corrected visual acuity, an infantile nystagmus and a grade III typical foveal hypoplasia without ocular hypopigmentation. A crossed asymmetry was discovered on pattern onset/offset VEP. Genetic testing put in evidence a novel homozygous variant in AHR: c.2242del, p. (Gln748Lysfs * 5). During 11-years follow-up period, BCVA gradually improved. There was no evidence of retinal degeneration., Conclusion: AHR gene defects could be associated with infantile nystagmus, foveal hypoplasia and chiasmal misrouting., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Purpose: Mutations of G protein-coupled receptor 143 (GPR143) and FERM domain containing 7 (FRMD7) may result in congenital nystagmus (CN) in the first 6 months of life. We aimed to compare the differences in ocular oscillations between patients with these two gene mutations as well as the functional and structural changes in their retinas and visual pathways., Methods: Medical records were retrospectively reviewed to identify patients of congenital nystagmus with confirmed mutations in either GPR143 or FMRD7 genes from January 2018 to May 2023. The parameters of the ocular oscillations were recorded using Eyelink 1000 Plus. The retinal structure and function were evaluated using optical coherence tomography and multi-focal electroretinography (mERG). The visual pathway and optical nerve projection were evaluated using visual evoked potentials. The next-generation sequencing technique was used to identify the pathogenic variations in the disease-causing genes for CN., Results: Twenty nystagmus patients of GPR143 and 21 patients of FMRD7 who had been confirmed by molecular testing between January 2018 and May 2023 were included. Foveal hypoplasia was detected only in patients with the GPR143 pathogenic variant. mERG examination showed a flat response topography in the GPR143 group compared to the FRMD7 group. VEP showed that bilateral amplitude inconsistency was detected only in the patients with GPR143 gene mutation. The amplitude and frequency of the ocular oscillations were not found to differ between patients with two different genetic mutations., Conclusions: Although the etiology and molecular mechanisms are completely different between CN patients, they may have similar ocular oscillations. A careful clinical examination and electrophysiological test will be helpful in making a differential diagnosis. Our novel identified variants will further expand the spectrum of the GPR143 and FRMD7 variants., (Copyright © 2024 Copyright: © 2024 Indian Journal of Ophthalmology.)

Idiopathic congenital nystagmus (ICN) manifests as involuntary and periodic eye movements. To identify the genetic defect associated with X-linked ICN, Whole Exome Sequencing (WES) was conducted in two affected families. We identified two frameshift mutations in FRMD7, c.1492dupT/p.(Y498Lfs*15) and c.1616delG/p.(R539Kfs*2). Plasmids harboring the mutated genes and qPCR analysis revealed mRNA stability, evading degradation via the NMD pathway, and corroborated truncated protein production via Western-blot analysis. Notably, both truncated proteins were degraded through the proteasomal (ubiquitination) pathway, suggesting potential therapeutic avenues targeting this pathway for similar mutations. Moreover, we conducted a comprehensive analysis, summarizing 140 mutations within the FRMD7 gene. Our findings highlight the FERM and FA structural domains as mutation-prone regions. Interestingly, exons 9 and 12 are the most mutated regions, but 90% (28/31) mutations in exon 9 are missense while 84% (21/25) mutations in exon 12 are frameshift. A predominant occurrence of shift code mutations was observed in exons 11 and 12, possibly associated with the localization of premature termination codons (PTCs), leading to the generation of deleterious truncated proteins. Additionally, our conjecture suggests that the loss of FRMD7 protein function might not solely drive pathology; rather, the emergence of aberrant protein function could be pivotal in nystagmus etiology. We propose a dependence of FRMD7 protein normal function primarily on its anterior domain. Future investigations are warranted to validate this hypothesis., (© 2024. The Author(s).)

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation., Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143 . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations., Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia., Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes., (Copyright © 2023 Molecular Vision.)

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Nystagmus is an ocular condition characterized by bilateral involuntary ocular oscillation which can severely affect vision. When not associated with other ocular or systemic diseases, it is referred to as idiopathic or congenital motor nystagmus (CMN). Genome-wide linkage studies have previously identified several loci associated with CMN, however the genes responsible for some of these loci have yet to be identified. We have examined a large, five-generation family with autosomal dominant CMN. Our purpose was to characterize the clinical manifestations and reveal the molecular basis of the disease in this family. In addition to full ophthalmic examination and imaging, molecular analysis included copy number variation analysis, linkage studies, and Sanger sequencing. Expression analyses of candidate genes was done by real-time PCR. Of the 68 family members, 27 subjects in five-generations had CMN, in line with an autosomal dominant inheritance pattern. Molecular analysis was performed on 27 members, 15 of them affected by CMN. Copy number variation analysis using array comparative genomic hybridization (aCGH) revealed a novel deletion located on 1q32 (NYS7) among affected individuals. Linkage analysis using polymorphic markers demonstrated full segregation with a heterozygous haplotype in all affected patients, with a LOD score of >5. Sanger sequencing of affected subjects revealed a novel deletion of 732,526 bp in the linkage interval. No protein-coding genes exist within the deleted region; however, the deletion disrupts topologically associated domains encompassing the gene NR5A2 and the non-protein coding MIR181A. Both are strongly associated with other genes expressed in the retina such as PROX1, which in turn is also associated with genes related to nystagmus such as PAX6. We therefore hypothesized that the deletion might affect NR5A2 and MIR181A expression, causing CMN. Expression analysis by real-time PCR showed significantly lower expression of NR5A2, and significantly higher expression of PROX1 among patients compared with controls. To conclude, among a large five-generation family with autosomal dominant CMN, a large deletion in the interval of NYS7 was linked with the disease. No protein-coding genes exist inside the deleted region, and so the exact mechanism in which CMN is caused is uncertain. Based on topological association and expression analyses we suggest a possible mechanism for the pathogenesis., Competing Interests: Declaration of competing interest The authors declare that they have no conflicts of interest., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Nystagmus describes an involuntary, periodic movement of one or both eyes. About 1/600 children and adolescents have nystagmus, most of them idiopathic infantile nystagmus (IIN), also called "congenital nystagmus", which can be caused by mutations in the FRMD7 gene. Other frequent forms of nystagmus are latent nystagmus, which is usually associated with infantile strabismus, and nystagmus associated with albinism. Sometimes difficult to distinguish in young infants is a sensory nystagmus, where a defect in the visual system reduces vision and causes nystagmus. Causes include retinal dystrophies, congenital stationary night blindness and structural ocular defects including optic nerve hypoplasia or dense bilateral congenital cataracts. Unilateral nystagmus can be the sign of an anterior visual pathway lesion. Seesaw nystagmus may be associated with suprasellar and mesodiencephalic lesions and - rarely - with retinal dystrophies.The ophthalmology plays a key role in identifying the form of nystagmus. Children with new onset nystagmus, with spasmus nutans, with vertical or unilateral nystagmus and those with seesaw nystagmus require neurologic evaluation including imaging of the brain.The treatment of nystagmus depends on the underlying cause. Even minor refractive errors should be corrected, contact lenses offer advantages over glasses.Gabapentin and memantine, possibly also carbonic anhydrase inhibitors, are effective in treating IIN, nystagmus in albinism and sensory nystagmus. Nevertheless, pharmacologic treatment of nystagmus is rarely used in children; the reasons are the limited effects on vision, the need for lifelong therapy, and potential side effects. Eye muscle surgery (Anderson procedure, Kestenbaum procedure) can correct a nystagmus-related anomalous head posture. The concept of "artifical divergence" of Cüppers may help to decrease nystagmus intensity in patients whose nystagmus dampens with convergence. The four-muscle-tenotomy, which involves disinsertion and reinsertion of the horizontal muscles at the original insertion of both eyes, has a proven but limited positive effect on visual acuity., Competing Interests: Erklärung zu finanziellen Interessen Forschungsförderung erhalten: nein; Honorar/geldwerten Vorteil für Referententätigkeit erhalten: nein; Bezahlter Berater/interner Schulungsreferent/Gehaltsempfänger: nein; Patent/Geschäftsanteile/Aktien (Autor/Partner, Ehepartner, Kinder) an im Bereich der Medizin aktiven Firma: nein; Patent/Geschäftsanteile/Aktien (Autor/Partner, Ehepartner, Kinder) an zu Sponsoren dieser Fortbildung bzw. durch die Fortbildung in ihren Geschäftsinteressen berührten Firma: nein. Erklärung zu nichtfinanziellen Interessen Die Autorinnen/Autoren geben an, dass kein Interessenkonflikt besteht., (Thieme. All rights reserved.)

Congenital idiopathic nystagmus (CIN) is an oculomotor disorder characterized by repetitive and rapid involuntary movement of the eye that usually develops in the first six months after birth. Unlike other forms of nystagmus, CIN is widely associated with mutations in the FRMD7 gene. This study involves the molecular genetic analysis of a consanguineous Pakistani family with individuals suffering from CIN to undermine any potential pathogenic mutations. Blood samples were taken from affected and normal individuals of the family. Genomic DNA was extracted using an in-organic method. Whole Exome Sequencing (WES) and analysis were performed to find any mutations in the causative gene. To validate the existence and co-segregation of the FRMD7 gene variant found using WES, sanger sequencing was also carried out using primers that targeted all of the FRMD7 coding exons. Additionally, the pathogenicity of the identified variant was assessed using different bioinformatic tools. The WES results identified a novel nonsense mutation in the FRMD7 (c.443T>A; p. Leu148 *) gene in affected individuals from the Pakistani family, with CIN resulting in a premature termination codon, further resulting in the formation of a destabilized protein structure that was incomplete. Co-segregation analysis revealed that affected males are hemizygous for the mutated allele c.443T>A; p. Leu148 * and the affected mother is heterozygous. Overall, such molecular genetic studies expand our current knowledge of the mutations associated with the FRMD7 gene in Pakistani families with CIN and significantly enhance our understanding of the molecular mechanisms involved in genetic disorders.

Aim: To analyse the neuro-ophthalmological data of children referred for further work-up of infantile nystagmus where ophthalmological evaluation had not achieved a diagnosis., Method: We retrospectively reviewed medical records of patients presenting with infantile nystagmus at our institution between 2007 and 2019. Inclusion criteria were onset before 6 months of age, availability of complete ophthalmic examination, visual electrophysiological tests, and neurological examination. Children with a previous definite ophthalmological diagnosis at onset and those with uncertain nystagmus onset age were not recruited., Results: Out of 142 infants (mean age at nystagmus onset 3.6 mo, SD 1.7, range 0-6 mo; 56 females, 86 males), 23% had neurological nystagmus, 7% mixed neurological and sensory nystagmus, 48% sensory defect, and 22% idiopathic infantile nystagmus. The neurological diagnoses were inborn errors of metabolism, white matter genetic disorders, and brain malformations. The prevalent diagnosis in the sensory defect subgroup was retinal dystrophy., Interpretation: Infantile nystagmus without diagnostic ocular findings may be due to neurological, retinal, and optic nerve disorders or be a benign idiopathic condition. In infants with and without neurological abnormalities, the search for a sensory defect should include visual electrophysiology performed early in the diagnostic pathway., What This Paper Adds: Infantile nystagmus without diagnostic ophthalmological signs has an underlying neurological cause in 30% of cases. Neurological diagnoses include congenital brain malformations, and metabolic and genetic disorders. Sensory defects are part of systemic neurological disorders in 23% of infants. Electrophysiology is useful when ophthalmological examination is uninformative., (© 2022 The Authors. Developmental Medicine & Child Neurology published by John Wiley & Sons Ltd on behalf of Mac Keith Press.)

Mutations in the FERM domain containing 7 (FRMD7) gene have been proven to be responsible for infantile nystagmus (IN). The purpose of this study is to investigate FRMD7 gene mutations in patients with IN, and to evaluate the nystagmus intensity among patients with and without FRMD7 mutations. The affected males were subdivided into three groups according to whether or not having FRMD7 mutations and the types of mutations. Fifty-two mutations were detected in FRMD7 in 56 pedigrees and 34 sporadic patients with IN, including 28 novel and 24 previous reported mutations. The novel identified mutations further expand the spectrum of FRMD7 mutations. The parameters of nystagmus intensity and the patients' best corrected visual acuity were not statistically different among the patients with and without identified FRMD7 mutations, and also not different among patients with different mutant types. The FERM-C domain, whose amino acids are encoded by exons 7, 8 and 9, could be the harbor region for most mutations. Loss-of-function is suggested to be the common molecular mechanism for the X-linked infantile nystagmus., (© 2022. The Author(s).)

Purpose: We aim to report noncoding pathogenic variants in patients with FRMD7-related infantile nystagmus (FIN)., Methods: Genome sequencing (n = 2 families) and reanalysis of targeted panel next generation sequencing (n = 2 families) was performed in genetically unsolved cases of suspected FIN. Previous sequence analysis showed no pathogenic coding variants in genes associated with infantile nystagmus. SpliceAI, SpliceRover, and Alamut consensus programs were used to annotate noncoding variants. Minigene splicing assay was performed to confirm aberrant splicing. In silico analysis of exonic splicing enhancer and silencer was also performed., Results: FRMD7 intronic variants were identified based on genome sequencing and targeted next-generation sequencing analysis. These included c.285-12A>G (pedigree 1), c.284+63T>A (pedigrees 2 and 3), and c. 383-1368A>G (pedigree 4). All variants were absent in gnomAD, and the both c.285-12A>G and c.284+63T>A variants were predicted to enhance new splicing acceptor gains with SpliceAI, SpliceRover, and Alamut consensus approaches. However, the c.383-1368 A>G variant only had a significant impact score on the SpliceRover program. The c.383-1368A>G variant was predicted to promote pseudoexon inclusion by binding of exonic splicing enhancer. Aberrant exonizations were validated through minigene constructs, and all variants were segregated in the families., Conclusions: Deep learning-based annotation of noncoding variants facilitates the discovery of hidden genetic variations in patients with FIN. This study provides evidence of effectiveness of combined deep learning-based splicing tools to identify hidden pathogenic variants in previously unsolved patients with infantile nystagmus., Translational Relevance: These results demonstrate robust analysis using two deep learning splicing predictions and in vitro functional study can lead to finding hidden genetic variations in unsolved patients.

In recent years, exome sequencing (ES) has shown great utility in the diagnoses of Mendelian disorders. However, after rigorous filtering, a typical ES analysis still involves the interpretation of hundreds of variants, which greatly hinders the rapid identification of causative genes. Since the interpretations of ES data require comprehensive clinical analyses, taking clinical expertise into consideration can speed the molecular diagnoses of Mendelian disorders. To leverage clinical expertise to prioritize candidate genes, we developed PhenoApt, a phenotype-driven gene prioritization tool that allows users to assign a customized weight to each phenotype, via a machine-learning algorithm. Using the ability to rank causative genes in top-10 lists as an evaluation metric, baseline analysis demonstrated that PhenoApt outperformed previous phenotype-driven gene prioritization tools by a relative increase of 22.7%-140.0% in three independent, real-world, multi-center cohorts (cohort 1, n = 185; cohort 2, n = 784; and cohort 3, n = 208). Additional trials showed that, by adding weights to clinical indications, which should be explained by the causative gene, PhenoApt performance was improved by a relative increase of 37.3% in cohort 2 (n = 471) and 21.4% in cohort 3 (n = 208). Moreover, PhenoApt could assign an intrinsic weight to each phenotype based on the likelihood of its being a Mendelian trait using term frequency-inverse document frequency techniques. When clinical indications were assigned with intrinsic weights, PhenoApt performance was improved by a relative increase of 23.7% in cohort 2 and 15.5% in cohort 3. For the integration of PhenoApt into clinical practice, we developed a user-friendly website and a command-line tool., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2021 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.)

Purpose: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene., Methods: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants., Results: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%., Conclusions: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.

Background : Infantile nystagmus syndrome (INS) is a genetically heterogeneous disorder. Identifying genetic causes of INS would help clinicians to facilitate clinical diagnosis and provide appropriate treatment. The aim of this study was to determine the diagnostic utility of targeted next-generation sequencing (NGS) for INS. Materials and methods : We recruited 37 patients who were referred to the Neuro-ophthalmology clinics for evaluations of INS. NGS was performed using a targeted panel that included 98 candidate genes associated with INS. We identified pathogenic variants according to guidelines of the American College of Medical Genetics and Genomics. We also calculated the sensitivity and specificity of each clinical sign to assess the diagnostic yield of our gene panel. Results : After variant filtering, annotation, and interpretation, the potential pathogenic variants were detected in 13 of the 37 patients, achieving a molecular diagnostic rate of 35%. The identified genes were PAX6 (n = 4), FRMD7 (n = 4), GPR143 (n = 2), CACNA1F (n = 1), CNGA3 (n = 1) and GUCY2D (n = 1). In approximately 30% (n = 4) of the patients, the initial clinical diagnosis was revised after a molecular diagnosis was performed. The presence of a family history had the highest predictive power for a molecular diagnosis (sensitivity = 61.5%, specificity = 91.7%), and the sensitivity increased when the family history was considered together with one of two clinical signs such as pendular nystagmus waveforms or anterior segment dysgenesis. Conclusions : Our study shows that targeted NGS can be useful to determine a molecular diagnosis for patients with INS. Targeted NGS also helps to confirm a clinical diagnosis in atypical phenotypes or unresolved cases.

Purpose: Foveal hypoplasia (FVH) is defined as the lack of fovea with a relatively preserved neuroretina, occurring either as an isolated FVH (IFVH) condition or associated with other diseases. This study aimed to systemically molecularly characterize IFVH., Methods: Genetic defects in 33 families with IFVH were analyzed by exome sequencing. Variants in three genes (PAX6, SLC38A8, and AHR) were selected and evaluated with multistep bioinformatic tools., Results: Mutations in the three genes were identified in 69.7% (23/33) of families with IFVH and infantile nystagmus, including 18 families with PAX6 mutations, 5 with SLC38A8 mutations, but none with AHR mutations. Clinical data from 32 patients in the 23 families showed FVH, infantile nystagmus, and full iris. Careful follow-up visits revealed subtle changes in iris in 9 of 14 patients with PAX6 variants. The PAX6 variants of the 18 families (15 missense and one stop-loss) were mostly located in the C-terminal region of the paired box domain. Variants in AHR, SLC38A8, and PAX6 contributed to IFVH in one (2%), 25 (45%), and 30 (53%) families with identified genetic defects (23 families in this study and 33 reported previously), respectively., Conclusions: PAX6 and SLC38A8 mutations are the main cause of IFVH based on our data and a systematic review. IFVH-associated PAX6 variants are mostly missense with a specific location, indicating a specific correlation of these variants with IFVH but not with typical aniridia. Full iris with subtle structural abnormalities is more common in patients with PAX6-associated IFVH, suggesting a potential diagnostic indicator.

Infantile nystagmus syndrome (INS) denominates early-onset, involuntary oscillatory eye movements with different etiologies. Nystagmus is also one of the symptoms in oculocutaneus albinism (OCA), a heterogeneous disease mainly caused by defects in melanin synthesis or melanosome biogenesis. Dopachrome tautomerase (DCT, also called TYRP2) together with tyrosinase (TYR) and tyrosin-related protein 1 (TYRP1) is one of the key enzymes in melanin synthesis. Although DCT´s role in pigmentation has been proven in different species, until now only mutations in TYR and TYRP1 have been found in patients with OCA. Detailed ophthalmological and orthoptic investigations identified a consanguineous family with two individuals with isolated infantile nystagmus and one family member with subtle signs of albinism. By whole-exome sequencing and segregation analysis, we identified the missense mutation c.176G > T (p.Gly59Val) in DCT in a homozygous state in all three affected family members. We show that this mutation results in incomplete protein maturation and targeting in vitro compatible with a partial or total loss of function. Subsequent screening of a cohort of patients with OCA (n = 85) and INS (n = 25) revealed two heterozygous truncating mutations, namely c.876C > A (p.Tyr292*) and c.1407G > A (p.Trp469*), in an independent patient with OCA. Taken together, our data suggest that mutations in DCT can cause a phenotypic spectrum ranging from isolated infantile nystagmus to oculocutaneous albinism.

Aniridia is most commonly caused by haploinsufficiency of the PAX6 gene, characterized by variable iris and foveal hypoplasia, nystagmus, cataracts, glaucoma, and aniridia-related keratopathy (ARK). Genotype-phenotype correlations have previously been described; however, detailed longitudinal studies of aniridia are less commonly reported. We identified 86 patients from 62 unrelated families with molecularly confirmed heterozygous PAX6 variants from a UK-based single-center ocular genetics service. They were categorized into mutation groups, and a retrospective review of clinical characteristics (ocular and systemic) from baseline to most recent was recorded. One hundred and seventy-two eyes were evaluated, with a mean follow-up period of 16.3 ± 12.7 years. Nystagmus was recorded in 87.2% of the eyes, and foveal hypoplasia was found in 75%. Cataracts were diagnosed in 70.3%, glaucoma in 20.6%, and ARK in 68.6% of eyes. Prevalence, age of diagnosis and surgical intervention, and need for surgical intervention varied among mutation groups. Overall, the missense mutation subgroup had the mildest phenotype, and surgically naive eyes maintained better visual acuity. Systemic evaluation identified type 2 diabetes in 12.8% of the study group, which is twice the UK prevalence. This is the largest longitudinal study of aniridia in the UK, and as such, it can provide insights into prognostic indicators for patients and guiding clinical management of both ocular and systemic features.

Background : To describe genetic molecular findings in individuals with congenital nystagmus, foveal hypoplasia, and subnormal vision, with normal ocular pigmentation (absence of diffuse transillumination or transparent retinal pigment typical for albinism). Methods : This is a retrospective, multicenter study of ophthalmic, systemic, and genetic features, as collected from medical records of patients diagnosed with infantile nystagmus and foveal hypoplasia. Ophthalmic findings include best-corrected visual acuity (BCVA), biomicroscopic examination, cycloplegic refraction, retinal examination, macular optical coherence tomography, and electroretinography. Genetic information was retrieved from the participating genetic clinics and included ethnicity and molecular diagnosis. Results : Thirty-one individuals met the inclusion criteria and had a secure molecular diagnosis. Mutations in two genes predominated, constituting 77.4% of all the represented genes: SLC38A8 (45.1%) and PAX6 (32.3%). Seventy-eight percent of the subjects who had a measurable BCVA had moderate and severe visual impairment (range 20/80 to 20/270). Most patients with a mutation in SLC38A8 had mild to moderate astigmatism, while most patients with PAX6 mutation had moderate and severe myopia. Patients in the PAX6 group had variable degrees of anterior segment manifestations. Conclusion : In our cohort, the main causative genes for congenital nystagmus and foveal hypoplasia in normally pigmented eyes were SLC38A8 and PAX6 . A mild phenotype in PAX6 mutations may be an under-diagnosed cause of nystagmus and foveal hypoplasia. Reaching an accurate genetic diagnosis is essential for both the patients and their family members. This enables predicting disease prognosis, tailoring correct follow-up, and providing genetic counseling and family planning to affected families.

Background: Congenital aniridia is a complex ocular disorder, usually associated with severe visual impairment, generally caused by mutations on the PAX6 gene. The clinical phenotype of PAX6 mutations is highly variable, making the genotype-phenotype correlations difficult to establish., Methods: we describe the phenotype of eight patients from seven unrelated families with confirmed mutations in PAX6 , and very different clinical manifestations., Results: Only two patients had the classical aniridia phenotype while the other two presented with aniridia-related manifestations, such as aniridia-related keratopathy or partial aniridia. Congenital cataracts were the main manifestation in three of the patients in this series. All the patients had nystagmus and low visual acuity., Conclusions: The diagnosis of mild forms of aniridia is challenging, but these patients have a potentially blinding hereditary disease that might present with a more severe phenotype in future generations. Clinicians should be aware of the mild aniridia phenotype and request genetic testing to perform an accurate diagnosis.

Foveal hypoplasia is the major cause of visual loss. Here we report an isolated foveal hypoplasia patient without nystagmus. It is very rare, and its etiology is not completely understood. Using whole-exome sequencing and foveal hypoplasia-related gene filtering from a family with two generations, we identified a novel variant c.859T>C (p.S287P) and a rare non-frameshift variant c.229_230insGGG (p.Arg77_Glu78insGly) in the tyrosinase (TYR) gene that co-segregated in the affected member of this family. The compound heterozygous variants inherited in the proband were confirmed by Sanger sequencing and predicted from in silico studies to have an effect on protein function. In conclusion, our finding extends the spectrum of TYR variants and supports the important role of TYR in the development of eyes.

Variants in the TUBB3 gene, one of the tubulin-encoding genes, are known to cause congenital fibrosis of the extraocular muscles type 3 and/or malformations of cortical development. Herein, we report a case of a 6-month-old infant with c.967A>G:p.(M323V) variant in the TUBB3 gene, who had only infantile nystagmus without other ophthalmological abnormalities. Subsequent brain magnetic resonance imaging (MRI) revealed cortical dysplasia. Neurological examinations did not reveal gross or fine motor delay, which are inconsistent with the clinical characteristics of patients with the M323V syndrome reported so far. A protein modeling showed that the M323V mutation in the TUBB3 gene interferes with αβ heterodimer formation with the TUBA1A gene. This report emphasizes the importance of considering TUBB3 and TUBA1A tubulinopathy in infantile nystagmus. A brain MRI should also be considered for these patients, although in the absence of other neurologic signs or symptoms.

PAX6 is considered the master regulator of eye development, the majority of variants affecting this gene cause the pan-ocular developmental eye disorder aniridia. Although no genotype-phenotype correlations are clearly established, missense variants affecting the DNA-binding paired domain of PAX6 are usually associated with non-aniridia phenotypes like microphthalmia, coloboma or isolated foveal hypoplasia. In this study, we report two missense heterozygous variants in the paired domain of PAX6 resulting in isolated foveal hypoplasia with nystagmus in two independent families: c.112 C > G; p.(Arg38Gly) and c.214 G > C; p.(Gly72Arg) in exons 5 and 6, respectively. Furthermore, we provide evidence that paternal postzygotic mosaicism is the cause of inheritance, with clinically unaffected fathers and reduced affected allele fraction. This work contributes to increase the phenotypic spectrum caused by PAX6 variants, and to our knowledge, is the first report to describe the presence of postzygotic parental mosaicism causing isolated foveal hypoplasia with nystagmus. These results support the growing evidence that suggest an overestimation of sporadic cases with PAX6 variants, which has strong implications for both genetic counselling and family planning.

Foveal hypoplasia, optic nerve decussation defects and anterior segment dysgenesis is an autosomal recessive disorder arising from SLC38A8 mutations. SLC38A8 is a putative glutamine transporter with strong expression within the photoreceptor layer in the retina. Previous studies have been limited due to lack of quantitative data on retinal development and nystagmus characteristics. In this multi-centre study, a custom-targeted next generation sequencing (NGS) gene panel was used to identify SLC38A8 mutations from a cohort of 511 nystagmus patients. We report 16 novel SLC38A8 mutations. The sixth transmembrane domain is most frequently disrupted by missense SLC38A8 mutations. Ninety percent of our cases were initially misdiagnosed as PAX6-related phenotype or ocular albinism prior to NGS. We characterized the retinal development in vivo in patients with SLC38A8 mutations using high-resolution optical coherence tomography. All patients had severe grades of arrested retinal development with lack of a foveal pit and no cone photoreceptor outer segment lengthening. Loss of foveal specialization features such as outer segment lengthening implies reduced foveal cone density, which contributes to reduced visual acuity. Unlike other disorders (such as albinism or PAX6 mutations) which exhibit a spectrum of foveal hypoplasia, SLC38A8 mutations have arrest of retinal development at an earlier stage resulting in a more under-developed retina and severe phenotype., (© The Author(s) 2020. Published by Oxford University Press.)

Purpose: Autosomal dominant foveal hypoplasia (FVH1) is a rare disorder associated with mutations in the PAX6 gene. As an isolated disease entity, FVH1 does not include ocular disorders such as aniridia, microphthalmia, albinism, and achromatopsia. However, it only includes isolated foveal hypoplasia and foveal hypoplasia with presenile cataract. The purpose of this report is to present our findings in four patients from two families with FVH1 without visible ophthalmic macular abnormalities., Study Design: A review of the medical records of two families with FVH1 and genetic confirmation of mutations in the PAX6 gene., Methods: Fundus photographs, optical coherence tomographic (OCT) and OCT angiographic (OCTA) images, and slit-lamp anterior segment findings were determined. The type of mutation of the PAX6 gene was determined., Results: A 3-year-old girl (Patient 1) had signs and symptoms of an impairment in the development of vision without other retinal abnormalities OU. OCT images showed a shallow foveal pit, and OCTA showed the absence of the foveal avascular zone. The second patient (Patient 2) was a 6-year-old girl with unilateral mild cataract and shallow foveal pits OU. Similar shallow foveal pits were found in her asymptomatic mother (Patient 3) and maternal grandfather (Patient 4). Although the iris and posterior fundus were normal, all patients with FVH1 had goniodysgenesis. Genetic testing of the PAX6 gene revealed that Patient 1 had a novel heterozygous mutation (p.Asn365Lys) as a de novo mutation, and Patients 2, 3 and 4 had a novel heterozygous mutation (p.Pro20Ser)., Conclusions: Heterozygous mutations in the PAX6 gene can cause FVH1 with nearly normal appearing macula. FVH1 is difficult to diagnose, but detailed observations of the foveal structure and vasculature, and detecting the presence of goniodysgenesis can be helpful in identifying patients with FVH1.

Background: To characterize the phenotype and genotype of a syndrome associating posterior microphthalmos (PM), retinitis pigmentosa (RP), foveoschisis, and foveal hypoplasia (FH) in a consanguineous Portuguese family., Materials and Methods: Three siblings were studied and underwent comprehensive eye examinations for best-corrected visual acuity, axial length, refractive error, B-mode ultrasound, electroretinography, retinography, fluorescein angiography (FA), kinetic visual field (VF), and optical coherence tomography (OCT). Molecular analysis was performed by Sanger sequencing of the entire coding region of the MFRP gene., Results: All members presented nyctalopia, decreased visual acuity, and constriction of the VF, as well as bilateral shortening of the posterior ocular segment and normal anterior segment dimensions. The fundoscopy and ERG results were compatible with RP. Macular OCT analysis revealed schisis of the outer retinal layer, FH, as well as retinal and choroidal folds. We identified a homozygous mutation in intron 9 of the membrane frizzled-related protein (MFRP) gene (c.1124 + 1 G > A)., Conclusions: Our study shows a family with PM and RP due to a mutation in the MFRP gene. The relationship has previously been proven, but this specific mutation has never been described. These gene mutations show wide phenotypic variability, being evident in the presence of foveoschisis, retinal and choroidal folds, and FH, other than PM and RP.

In this study, we seek to exclude other pathophysiological mechanisms by which Frmd7 knock-down may cause Idiopathic Infantile Nystagmus (IIN) using the Frmd7 .tm1a and Frmd7 .tm1b murine models. We used a combination of genetic, histological and visual function techniques to characterize the role of Frmd7 gene in IIN using a novel murine model for the disease. We demonstrate that the Frmd7 .tm1b allele represents a more robust model of Frmd7 knock-out at the mRNA level. The expression of Frmd7 was investigated using both antibody staining and X-gal staining confirming previous reports that Frmd7 expression in the retina is restricted to starburst amacrine cells and demonstrating that X-gal staining recapitulates the expression pattern in this model. Thus, it offers a useful tool for further expression studies. We also show that gross retinal morphology and electrophysiology are unchanged in these Frmd7 mutant models when compared with wild-type mice. High-speed eye-tracking recordings of Frmd7 mutant mice confirm a specific horizontal optokinetic reflex defect. In summary, our study confirms the likely role for Frmd7 in the optokinetic reflex in mice mediated by starburst amacrine cells. We show that the Frmd7 .tm1b model provides a more robust knock-out than the Frmd7 .tm1a model at the mRNA level, although the functional consequence is unchanged. Finally, we establish a robust eye-tracking technique in mice that can be used in a variety of future studies using this model and others. Although our data highlight a deficit in the optiokinetic reflex as a result of the starburst amacrine cells in the retina, this does not rule out the involvement of other cells, in the brain or the retina where Frmd7 is expressed, in the pathophysiology of IIN.

Overall, approximately one-quarter of patients with genetic eye diseases will receive a molecular diagnosis. Patients with developmental eye disorders face a number of diagnostic challenges including phenotypic heterogeneity with significant asymmetry, coexisting ocular and systemic disease, limited understanding of human eye development and the associated genetic repertoire, and lack of access to next generation sequencing as regarded not to impact on patient outcomes/management with cost implications. Herein, we report our real world experience from a pediatric ocular genetics service over a 12 month period with 72 consecutive patients from 62 families, and that from a cohort of 322 patients undergoing whole genome sequencing (WGS) through the Genomics England 100,000 Genomes Project; encompassing microphthalmia, anophthalmia, ocular coloboma (MAC), anterior segment dysgenesis anomalies (ASDA), primary congenital glaucoma, congenital cataract, infantile nystagmus, and albinism. Overall molecular diagnostic rates reached 24.9% for those recruited to the 100,000 Genomes Project (73/293 families were solved), but up to 33.9% in the clinic setting (20/59 families). WGS was able to improve genetic diagnosis for MAC patients (15.7%), but not for ASDA (15.0%) and congenital cataracts (44.7%). Increased sample sizes and accurate human phenotype ontology (HPO) terms are required to improve diagnostic accuracy. The significant mixed complex ocular phenotypes distort these rates and lead to missed variants if the correct gene panel is not applied. Increased molecular diagnoses will help to explain the genotype-phenotype relationships of these developmental eye disorders. In turn, this will lead to improved integrated care pathways, understanding of disease, and future therapeutic development., (© 2020 The Authors. American Journal of Medical Genetics Part C: Seminars in Medical Genetics published by Wiley Periodicals LLC.)

Congenital motor nystagmus (CMN) is characterized by early-onset bilateral ocular oscillations without other ocular deficits. To date, mutations in only one gene have been identified to be responsible for CMN, i.e., FRMD7 for X-linked CMN. Four loci for autosomal dominant CMN, including NYS7 (OMIM 614826), have been mapped but the causative genes have yet to be identified. NYS7 was mapped to 1q32.1 based on independent genome-wide linkage scan on two large families with CMN. In this study, mutations in all known protein-coding genes, both intronic sequence with predicted effect and coding sequence, in the linkage interval were excluded by whole-genome sequencing. Then, long-read genome sequencing based on the Nanopore platform was performed with a sample from each of the two families. Two deletions with an overlapping region of 775,699 bp, located in a region without any known protein-coding genes, were identified in the two families in the linkage region. The two deletions as well as their breakpoints were confirmed by Sanger sequencing and co-segregated with CMN in the two families. The 775,699 bp deleted region contains uncharacterized non-protein-coding expressed sequences and pseudogenes but no protein-coding genes. However, Hi-C data predicted that the deletions span two topologically associated domains and probably lead to a change in the 3D genomic architecture. These results provide novel evidence of a strong association between structural variations in non-coding genomic regions and human hereditary diseases like CMN with a potential mechanism involving changes in 3D genome architecture, which provides clues regarding the molecular pathogenicity of CMN.

Purpose: To identify the pathogenic gene of infantile nystagmus syndrome (INS) in three Chinese families and explore the potential pathogenic mechanism of FERM domain-containing 7 (FRMD7) mutations., Methods: Genetic testing was performed via Sanger sequencing. Western blotting was used to analyze protein expression of FRMD7. Glutathione S-transferase pull-down and immunoprecipitation were conducted to investigate the proteins interacting with FRMD7. Rescue assays were performed in Caenorhabditis elegans to explore the potential role of FRMD7 in vivo., Results: We recruited three Chinese families with X-linked INS and identified a duplication and two missense mutations in FRMD7: c.998dupA/p.His333Glnfs*2, c.580G>A/p.Ala194Thr, and c.973A>G/p.Arg325Gly (one in each family). Expression levels of three mutants were similar to that of wild-type FRMD7 in vitro. Interestingly, the mutant p.His333Glnfs*2 exhibited a predominantly nuclear location, whereas wild-type FRMD7 localized to the cytoplasm. In addition, we found FRMD7 to directly interact with the loop between transmembrane domains 3 and 4 of GABRA2, a type A gamma-aminobutyric acid (GABA) receptor (GABAARs) subunit critical for receptor transport and localization, whereas the mutants p.Ala194Thr and p.Arg325Gly exhibited decreased binding to GABRA2. In frm-3 (a nematode homologue of FRMD7) null C. elegans, we found that FRMD7 mutants exhibited a poor rescue effect on the defects of locomotion and fluorescence recovery after photobleaching of GABAARs., Conclusions: Our findings identified three FRMD7 mutants in three Chinese families with X-linked INS and confirmed GABRA2 as a novel binding partner of FRMD7. These findings suggest that FRMD7 plays an important role by targeting GABAARs.

Purpose: A recently described subtype of foveal hypoplasia with congenital nystagmus and optic-nerve-decussation defects was found to be associated with mutations in the SLC38A8 gene. The aim of this study is to advance the clinical and molecular knowledge of SLC38A8 gene mutations., Methods: Five Israeli families with congenital foveal hypoplasia were studied, two of Karait Jewish origins and three of Indian Jewish origins. Subjects underwent a comprehensive ophthalmic examination including retinal photography and ocular coherence tomography. Molecular analysis including whole exome sequencing and screening of the SLC38A8 gene for specific disease-causing variants was performed., Results: Eight affected individuals were identified, all had congenital nystagmus and all but one had hypoplastic foveal pits. Anterior segment dysgenesis was observed in only one patient, one had evidence of developmental delay and another displayed early age-related macular degeneration (AMD). Molecular analysis revealed a recently described homozygous mutation, c.95T > G; p.Ile32Ser, in two families of Jewish Indian descent, and the same mutation in two families of Karaite Jewish descent. In a patient with only one pathogenic mutation (c.95T > G; p.Ile32Ser), a possible partial clinical expression of the disorder was seen. One patient of Jewish Indian descent was found to be compound heterozygous for c.95T > G; p.Ile32Ser and a novel mutation c.490_491delCT; p.L164Vfs*41., Conclusions: In five unrelated families with congenital nystagmus and foveal hypoplasia, mutations in the SLC38A8 gene were identified. Possible partial expression in a heterozygous patient was observed and novel potential disease-related phenotypes were identified including early-onset AMD and developmental delay. A novel mutation was also identified and a similar mutation in both Indian and Karaite Jewish ethnicities could be suggestive for common ancestry., Competing Interests: Declaration of competing interest The authors declare that they have no conflicts of interest., (Copyright © 2020 Elsevier Ltd. All rights reserved.)

Background: Idiopathic infantile nystagmus (IIN) is a high genetically heterogeneous ophthalmic disease and is often associated with pathogenic mutations in FRMD7 and GPR143, respectively. Idiopathic infantile nystagmus manifests as involuntary periodic rhythmic oscillation of the eyes in the very early life, which decreases visual acuity and affects the quality of life., Objective and Methods: The aim of our study was to reveal a possible pathogenic variant through the investigation of a Chinese Han family with IIN with an implementation of a next-generation sequencing method. Isolated DNA analysis was followed by Sanger sequencing validation. We also performed the detailed ophthalmological examination of family members., Results: We identified a novel frameshift variant in FRMD7 (NM_194277.2: c.1419_1422dup, p.Tyr475fs), which leads to a frameshift mutation since tyrosine (Tyr) at 475 codon of FRMD7 protein (p.Tyr475fs) and co-segregates with IIN phenotype in this family., Conclusions: We found a novel frameshift FRMD7 variant in a Chinese Han family, which may be causative variant for IIN and can further enrich the mutation spectrum and uncover the etiology of IIN., (© 2019 The Authors. Journal of Clinical Laboratory Analysis Published by Wiley Periodicals, Inc.)

Aims: Idiopathic congenital nystagmus (ICN) is an oculomotor disorder caused by the defects in the ocular motor control regions of the brain. Mutations in FRMD7, a member of the FERM family of proteins, associated with cytoskeletal dynamics, are the most frequent causes of X-linked ICN. Previous studies illustrated that FRMD7 is involved in the elongation of neurites during neuronal development; however, almost all the studies were performed on mice cell models. The complexity in the human neuronal network might suggest a unique vulnerability of human neurons to FRMD7 mutations., Methods: Herein, we successfully established human neuronal cell models with FRMD7 mutations, from fibroblasts-reprogrammed neurons (iNs). In these neurons, the complexity of the neuronal processes was measured by the induced ratio, total neurite length, the number of terminals, and the number of maturation neurons., Results: The complexity of the neuronal processes was greatly reduced during various reprogramming stages in the presence of FRMD7 mutations. Consistently, the expression of the three main Rho GTPases was significantly increased by FRMD7 mutations. Interestingly, a slightly diverse phenotype is observed in different derived neurons., Conclusion: We established ideal human neuron models and confirmed that the mutation in FRMD7 influences the maturation and complexities of neuronal processes, which might be involved with the Rho GTPase signaling., (© 2019 The Authors. Brain and Behavior published by Wiley Periodicals, Inc.)

Background: Hereditary spastic paraplegia (HSP) refers to a group of neurodegenerative disorders characterized by bilateral weakness, spasticity, and hyperreflexia in the lower limbs. The autosomal dominant HSP (ADHSP) predominantly presents as the pure form, but the clinical profiles and causal genetic variants underlying ADHSP are complex, and many remain unknown., Methods: A cohort of 15 Chinese HSP pedigrees (including 35 patients and their 22 relatives) were screened by multiplex ligation-dependent probe amplification (MLPA) or whole-exome sequencing (WES). Neurological assessments were also conducted., Results: The main subtypes of HSP above detected in our cohort were SPG4, SPG3A, and SPG6. Fifteen HSP-inducing mutations were identified, among which six were novel mutations: SPAST c.1277T>C, c.1292G>C, c.1562T>C, and c.1693A>T, NIPA1 c.748A>C, and KIDINS220 c.4448C>G. As expected, the most common presentation of the ADHSP cases was the pure form, manifesting spasticity of lower limbs and hyperreflexia, as well as pyramidal signs. Differing substantially from previous reports for KIDINS220 variants, our study family exhibited autosomal dominant inheritance, and only presented with spastic paraplegia, with no signs of intellectual disability, nystagmus, or obesity., Conclusion: Our work reveals a non-classical spastic paraplegia, intellectual disability, nystagmus, and obesity phenotype for a KIDINS220 mutation, which broadens both the clinical and genetic spectrum for ADHSP. Beyond underscoring the utility of using both MLPA and WES in studies of HSP, our work deepens the scientific understanding of phenotypes for ADHSP and defines new genetic variants to facilitate future diagnoses.

Background : Achromatopsia has been previously associated with mutations in the ATF6 gene. Rod-monochromatism, foveal hypoplasia, and disruption of the subfoveal photoreceptor layer are described as phenotypical features. We report detailed structural and electrophysiological assessment of two patients from two families, one manifesting severe macular maldevelopment and one with foveal hypoplasia. Materials and methods : The patients underwent a complete ophthalmic examination including electroretinography (ERG), spectral-domain optical coherence tomography (SD-OCT), fundus autofluorescence, and fundus photography. Genetic testing was performed by next-generation sequencing. Results : In one patient, fundoscopy and SD-OCT revealed well-demarcated coloboma-like excavated lesions at the central macula of both eyes. Genetic analysis identified a novel homozygous p.Asp140Ter mutation in the ATF6 gene. The second patient had foveal hypoplasia in association with a homozygous ATF6 mutation affecting a splice donor site (c.1187 + 5G>C). In both patients, electrophysiological assessment showed normal rod-specific (DA 0.01) and dark-adapted bright white-flash ERGs (DA 10.0). 30 Hz flicker ERGs were undetectable. There were low-amplitude single-flash photopic ERGs (LA 3.0) with timing and shape suggesting S-cone origin. Conclusions : The findings, particularly a case with severe macular maldevelopment, may expand on the phenotype previously associated with ATF6 -mediated achromatopsia. In addition, the comprehensive electrophysiological assessment suggests that preserved S-cone activity can be detected in this particular molecular sub-type of cone dysfunction.

Nystagmus is a disorder of uncontrolled eye movement and can occur as an isolated trait (idiopathic INS, IINS) or as part of multisystem disorders such as albinism, significant visual disorders or neurological disease. Eighty-one unrelated patients with nystagmus underwent routine ocular phenotyping using commonly available phenotyping methods and were grouped into four sub-cohorts according to the level of phenotyping information gained and their findings. DNA was extracted and sequenced using a broad utility next generation sequencing (NGS) gene panel. A clinical subpanel of genes for nystagmus/albinism was utilised and likely causal variants were prioritised according to methods currently employed by clinical diagnostic laboratories. We determine the likely underlying genetic cause for 43.2% of participants with similar yields regardless of prior phenotyping. This study demonstrates that a diagnostic workflow combining basic ocular phenotyping and a clinically available targeted NGS panel, can provide a high diagnostic yield for patients with infantile nystagmus, enabling access to disease specific management at a young age and reducing the need for multiple costly, often invasive tests. By describing diagnostic yield for groups of patients with incomplete phenotyping data, it also permits the subsequent design of 'real-world' diagnostic workflows and illustrates the changing role of genetic testing in modern diagnostic workflows for heterogeneous ophthalmic disorders.

Congenital nystagmus (CN) is a heterogeneous disease that shows variable clinical features. There are a few mutations that are known to cause CN. Among them, a PAX6 mutation is known to cause CN with an extremely high frequency of aniridia. Here, we report on a family with an autosomal dominant PAX6 mutation, c.214G > A (p.Gly72Ser.), who presented with CN in the absence of aniridia. This study describes detailed clinical findings, including videonystagmography and fundus photography findings and emphasizes the importance of screening for the PAX6 gene in patients who present with CN in the absence of aniridia, as this will further elucidate the known phenotypes of PAX6-related diseases., (Copyright © 2019 Elsevier B.V. All rights reserved.)

Herein we present a consanguineous family with three children affected by foveal hypoplasia with infantile nystagmus, following an autosomal recessive mode of inheritance. The patients showed normal electroretinography responses, no signs of albinism, and no anterior segment or brain abnormalities. Upon whole exome sequencing, we identified a homozygous mutation (c.1861C>T;p.Q621*) in the aryl hydrocarbon receptor (AHR) gene that perfectly co-segregated with the disease in the larger family. AHR is a ligand-activated transcription factor that has been intensively studied in xenobiotic-induced toxicity. Further, it has been shown to play a physiological role under normal cellular conditions, such as in immunity, inflammatory response and neurogenesis. Notably, knockout of the Ahr gene in mouse impairs optic nerve myelin sheath formation and results in oculomotor deficits sharing many features with our patients: the eye movement disorder in Ahr-/- mice appears early in development and presents as conjugate horizontal pendular nystagmus. We therefore propose AHR to be a novel disease gene for a new, recessively inherited disorder in humans, characterized by infantile nystagmus and foveal hypoplasia., (© The Author(s) (2019). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

Background: Congenital nystagmus is one of the most common neuro-ophthalmological disorders. X chromosome-linked forms are associated with pathogenic variants of the GPR143 and FRMD7 genes., Materials and Methods: Patients' DNA was analyzed using a next-generation sequencing (NGS) panel of genes involved in albinism and related pathologies (TYR, OCA2, TYRP1, SLC45A2, SLC24A5, C10ORF11, GPR143, SLC38A8, HPS 1 to 10, LYST, MITF, FRMD7) Results: We report a 4 generation family with 5 affected members initially referred for molecular diagnosis of ocular albinism. A missense variant of FRMD7 was found in 3 affected cases and one female carrier. We show that the disease in the affected girl is due to skewed inactivation of the X chromosome., Conclusions: By compiling all the published cases we discuss the variable penetrance among females due to different types of mutation and to X-inactivation.

Background: Congenital nystagmus (CN) and congenital cataracts are distinct eye diseases and are usually isolated. Cases with CN and congenital cataracts caused by different genes in one family have been rarely reported., Case Presentation: A 27-year-old man presented with CN and congenital cataracts and he underwent cataract extraction 2 weeks after birth. Three years later, he had posterior chamber intraocular lens implantation. The proband's mother was only afflicted by bilateral lens opacities. Lensectomy was performed in both eyes at age 15. The proband's daughter had bilateral central cataracts and no nystagmus. She had undergone cataract extraction when she was two months old. In this family, 8 affected individuals were affected by bilateral cataracts, and three of them presented with CN. The genetic analysis was performed using a specific Hereditary Ophthalmological Disease Gene Panel on proband and his parents (one of which was a patient). PCR and Sanger sequencing verified the presence of these variants in all members of the family. The novel mutation, c.498-3C > T, in FRMD7 explains why X-Linked recessive inheritance of CN was found in a subset of patients. A heterozygous mutation of the GJA8 gene (c.139G > C), was identified in all patients and thus explains the autosomal dominant pattern of inheritance of congenital cataracts within the family., Conclusions: This is the first time that FRMD7 and GJA8 gene mutations have been linked to the pathogenesis of a family with both CN and congenital cataracts. The phenomenon of two different genetic patterns coexisting in one family is rare.

In this report, we described a large Han-Chinese family which presents with various phenotypes from unaffected to manifested nystagmus in females. Infantile nystagmus (IN) is characterized by bilateral, involuntary, and periodic eyeball oscillation, occurring at birth or within the first 6 months. The most common inheritance pattern of IN is an X-linked form with incomplete penetrance among females, and the FERM domain containing 7 gene (FRMD7) is a main disease-causing gene. A combination of exome sequencing and Sanger sequencing, as well as detailed clinical examinations were performed on the Chinese IN family. An FRMD7 c.47T>C (p.Phe16Ser) variant was proposed as the disease-causing variant. Incomplete penetrance was found in females with the FRMD7 c.47T>C variant, and hemizygous male affected subjects presented more severe manifestations compared to heterozygous female affected subjects. These findings could enhance genetic counseling and antenatal diagnosis of IN.

Idiopathic congenital nystagmus (ICN) is a genetically heterogeneous eye movement disorder which seriously reduces childhood visual acuity. X-linked inheritance is the most common pattern, and mutations in FERM domain-containing protein 7 (FRMD7) are the major cause. Here, we recruited a four-generation Chinese family with X-linked ICN for the causative mutational screening of FRMD7. A novel missense variant, c.805 A > C, was identified in the proband. The mutation was confirmed in all the affected individuals but was not detected in unaffected family members or 100 unrelated Chinese male controls. The mutation causes a substitution of lysine to glutamine at position 269 (p.Lys269Gln, K269Q). The FRMD7 mutant inhibits the formation and extension of neurites. Moreover, the mutation disrupts FRMD7 interaction with calcium/calmodulin-dependent serine protein kinase and neurite formation. Together, our data expand the mutation spectrum of FRMD7 causing ICN and provide an insight into the pathogenesis of nystagmus., (© The Author(s) 2018. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Background: Infantile nystagmus (IN) is an oculomotor disorder that is characterized by conjugate involuntary, rapid and repetitive movement of the eyes. To date, the pathogenesis of IN remains unclear. Many patients show an X-linked inheritance pattern. In this study, we explored the mutation in the FERM domain-containing 7 (FRMD7) gene in a Chinese family with X-linked infantile nystagmus., Methods: We conducted comprehensive ocular examinations and collected 5 ml of blood samples from members of a family with X-linked IN and 100 normal controls. Mutations in FRMD7 were identified by sequencing PCR products., Results: We found a 7-bp deletion(c.823-829delACCCTAC) in the 9th exon of FRMD7 in a Chinese family with IN, which predicted a truncation of the protein., Conclusions: This study reported a novel mutation of the FRMD7 gene occurred in a Chinese family with IN, thus expanding the spectrum of FRMD7 mutations causing IN, and further confirming that the mutations of FRMD7 are the underlying molecular cause of IN.

Exploring the genetic basis for idiopathic congenital nystagmus is critical for improving our understanding of its molecular pathogenesis. In the present study, direct sequencing using gene specific primers was performed in order to identify the causative mutations in two brothers from a Chinese family who had been diagnosed with idiopathic congenital nystagmus. A comprehensive ophthalmological examination, including eye movement recordings, fundus examination, and retinal optical coherence tomography imaging was also conducted, to characterize the disease phenotype. The results revealed that the two brothers exhibited clear signs of nystagmus without any other ocular anomalies. Direct sequencing revealed a G to T transition (c.886G>T) in exon 9 of the four‑point‑one, ezrin, radixin, moesin domain‑containing 7 (FRMD7) gene, which resulted in a conservative substitution of glycine to cysteine at codon 296 (p.G296C), leading to idiopathic congenital nystagmus in the two affected brothers. c.886G>T is a novel idiopathic congenital nystagmus‑inducing mutation in the FRMD7 gene. This finding expands the spectrum of known gene mutations in idiopathic congenital nystagmus, and may be useful for faster gene diagnosis, prenatal testing, the development of potential gene therapies, and for improving the understanding of the molecular pathogenesis of idiopathic congenital nystagmus.

The present study investigated the clinical and mutational spectrum of aniridia in a cohort of 17 affected individuals from six families from Cyprus. Each proband was initially evaluated for copy number variants at the PAX6 locus and subsequently underwent PAX6 mutation screening. Sequence analysis of FOXC1 and PITX2 was performed in patients who did not carry a PAX6 mutation. The most common clinical features in the group of aniridia patients associated with aniridia were nystagmus, cataracts and glaucoma. PAX6 pathogenic mutations were identified in five out of six families (a diagnostic yield of 84%). Previously reported pathogenic mutations in PAX6 were identified in four families, which comprise p.R203*, p.R240* and p.R317*. In addition, a novel pathogenic variant (p.E220Gfs*23) was identified in a single family. No pathogenic mutations were detected in PAX6, FOXC1 or PITX2 in the only patient with a sporadic form of aniridia‑like phenotype, confirming the genetic heterogeneity associated with this disease. To the best of our knowledge this is the first report on the mutational spectrum of PAX6 in aniridia patients of Cypriot ancestry. Mutational screening of PAX6 serves a crucial role in distinguishing isolated from syndromic forms of aniridia, and it may therefore eliminate the need for renal ultrasound scan surveillance, delineate the phenotype and improve genetic counseling.

Purpose: Inherited retinal dystrophies are a clinically and genetically heterogeneous group of disorders. Molecular diagnosis has proven utility for affected individuals. In this study, we report an individual enrolled in the Australian Inherited Retinal Disease Registry and DNA Bank diagnosed with clinical features overlapping between Leber congenital amaurosis and retinitis pigmentosa., Methods: DNA from the proband was sequenced using a gene panel for inherited retinal disorders, and a single nucleotide polymorphism (SNP) array was conducted to detect the presence of deletions and uniparental disomy., Results: We identified a novel homozygous variant (c.524dupC, p.(Pro176ThrfsTer7)) in TULP1 resulting from maternal uniparental isodisomy of chromosome 6. The patient had clinical features consistent with biallelic pathogenic variants in TULP1 , including congenital nystagmus, night blindness, non-recordable electroretinogram, mild myopia, and mild peripheral pigmentary changes in the fundus., Conclusions: This is the first report of uniparental disomy 6 and a homozygous variant in TULP1 associated with a rod-cone dystrophy. Molecular diagnosis of inherited retinal dystrophies is essential to inform the mode of transmission and clinical management, and to identify potential candidates for future gene-specific therapies.

Purpose: We investigate the genotype and phenotype spectrum of FRMD7-associated infantile nystagmus syndrome in Korean probands., Methods: A total of 37 patients with infantile nystagmus syndrome were recruited prospectively for genetic analysis. We performed polymerase chain reaction (PCR)-based direct sequencing and haplotype analysis for FRMD7. Detailed ophthalmic examinations and eye movement recordings were compared between FRMD7 and non-FRMD7 groups., Results: In 13 (35%) of 37 patients, five different mutations of FRMD7 were detected: start codon mutation c.1A>G, splice site mutation c.162+6T>C, and three missense mutations (c.575A>C, c.722A>G, and c.875T>C). The latter mutation was identified in seven unrelated patients, and always was accompanied with two single nucleotide polymorphisms of exon 12 (rs6637934, rs5977623). Compared to non-FRMD7 groups, a cup-to-disc ratio was significantly decreased in FRMD7 groups (P < 0.001), and a disc-macula distance to disc diameter ratio markedly increased in the FRMD7 group (P = 0.015). Most patients in the FRMD7 group had at least two types of the nystagmus waveforms, and the most common type was unidirectional jerk nystagmus (75%), such as pure jerk and jerk with extended foveation, followed by pendular (25%), bidirectional jerk (19%), and dual jerk (6%) nystagmus. No significant differences were observed between FRMD7 and non-FRMD7 groups in terms of the nystagmus waveform, presence of periodic alternating nystagmus, and mean foveation time., Conclusions: We identified five FRMD7 mutations in 35% of our infantile nystagmus syndrome cohort, expanding its mutational spectrum. The missense mutation c.875T>C may be a common mutation arisen from the founder effect in Korea. Optic nerve dysplasia associated with FRMD7 mutations suggests that the abnormal development of afferent visual systems may affect neural circuitry within the oculomotor system.

Importance: Infantile nystagmus syndrome (INS) is a group of disorders presenting with genetic and clinical heterogeneities that have challenged the genetic and clinical diagnoses of INS. Precise molecular diagnosis in early infancy may result in more accurate genetic counseling and improved patient management., Objective: To assess the accuracy of genomic data from next-generation sequencing (NGS) and phenotypic data to enhance the definitive diagnosis of INS., Design, Setting, and Participants: A single-center retrospective case series was conducted in 48 unrelated, consecutive patients with INS, with or without associated ocular or systemic conditions, who underwent genetic testing between June 1, 2015, and January 31, 2017. Next-generation sequencing analysis was performed using a target panel that included 113 genes associated with INS (n = 47) or a TruSight One sequencing panel that included 4813 genes associated with known human phenotypes (n = 1). Variants were filtered and prioritized by in-depth clinical review, and finally classified according to the American College of Medical Genetics and Genomics guidelines. Patients underwent a detailed ophthalmic examination, including electroretinography and optical coherence tomography, if feasible., Main Outcomes and Measures: Diagnostic yield of targeted NGS testing., Results: Among the 48 patients (21 female and 27 male; mean [SD] age at genetic testing, 9.2 [10.3] years), 8 had a family history of nystagmus and 40 were simplex. All patients were of a single ethnicity (Korean). Genetic variants that were highly likely to be causative were identified in 28 of the 48 patients, corresponding to a molecular diagnostic yield of 58.3% (95% CI, 44.4%-72.2%). FRMD7, GPR143, and PAX6 mutations appeared to be the major genetic causes of familial INS. A total of 10 patients (21%) were reclassified to a different diagnosis based on results of NGS testing, enabling accurate clinical management., Conclusions and Relevance: These findings suggest that NGS is an accurate diagnostic tool to differentiate causes of INS because diagnostic tests, such as electroretinography and optical coherence tomography, are not easily applicable in young infants. Accurate application of NGS using a standardized, stepwise, team-based approach in early childhood not only facilitated early molecular diagnosis but also led to improved personalized management in patients with INS.