Search

Indigofera santapaui Sanjappa is a little known endemic legume described from the northern Western Ghats. It is rediscovered and collected from other localities quite away from the type locality. This is found to be the only known species of Indigofera with yellow flowers. A brief description, image, distribution, and ecological notes have been provided to facilitate correct identification and to know its extent of distribution.

The correct authority of Astragalus vogelii subsp. fatimensis and its distribution range in India are discussed. The taxon, which is considered rare in India, has been recollected from Gujarat State from new localities in the Banaskantha District. The description of the taxon along with photographs and other taxonomic details are provided here for easy identification.

Background The insular nature and unique geographical set up of Andaman and Nicobar Islands has led to the evolution of variety of rare and distinct flora with high endemism. Despite several efforts to document the floristic richness of the islands, there are no efforts to understand the spatial patterns in the taxonomic and phylogenetic diversity, and thence to arrive at the biogeographic origin and evolutionary history of the vegetation of this Island archipelago. Methods We used a fine scale spatial distribution and abundance data of woody plants documented from 841 grids along with their phylogenetic data and estimated metrics of taxonomic and phylogenetic similarity to identify taxonomically and phylogenetically distinct woody plant ‘phytoregions’ within Andaman and Nicobar Islands. We then arrived at the spatial patterns of the taxonomic richness and diversity and, of phylogenetic diversity across the entire Archipelago. Results We found that taxonomic richness and diversity of woody flora is high in Andaman and low in Nicobar Islands, whereas Nicobar Islands have a more phylogenetically diverse woody flora compared to Andaman. We identified three distinct woody plant ‘phytoregions’ within Andaman and Nicobar Islands. The three identified ‘phytoregions’ broadly match with the geographically isolated Island groups such as Andaman, Car Nicobar and Great Nicobar Islands; these ‘phytoregions’ also highlight the existence of two broadly distinct biogeographic zones of woody plants within the Islands. Conclusion Our analysis provides new insights into the spatial patterns of diversity of woody flora in Andaman and Nicobar Islands. We show that (i) both taxonomic and evolutionary affinities identify distinct ‘phytoregions’ closely segregated across the geographic distribution of the major islands of the archipelago, and (ii) there are two distinct biogeographic zones, i.e. Andaman flora most closely allied with flora of South western Burma and Nicobar more related with the flora of Malayan peninsula and Sumatra.

Glochidion kingii M. V. Ramana, Sanjappa, Venu & Alok Chorghe, a new species from the scrub forests of North Andaman Islands, is described and illustrated. Its morphological similarities/dissimilarities in relation to G. rubrum Blume from the Malay Peninsula and Sumatra is discussed and information about the distribution and conservation status for the new species is provided.

Centotheca ganeshaiahiana M. V. Ramana, Alok Chorghe, Prasanna & Sanjappa, a new species from Saddle Peak National Park, north Andaman, Andaman and Nicobar Islands, India is described and illustrated. It is closely allied to C. uniflora Swallen, a Vietnamese species, but differs mainly in shorter culms, leaf blades and inflorescences, longer pedicels, spikelets with 2 fertile florets and lemmas with bulbous based hairs.

The current distribution and threat assessment of Dendrobium tenuicaule Hook. f. (Orchidaceae), an endemic orchid of Middle Andaman Island is presented here. New data available from field surveys indicated the species is Critically Endangered as per the 2001 IUCN Red List Catagories and Criteria.

This paper presents distribution, relative abundance incl. threats, phenology and available field data of 25 taxa belonging to six genera of Ericaceae in Talle Wildlife Sanctuary in Lower Subansiri district of Arunachal Pradesh. A map of Arunachal Pradesh along with a trek route from Ziro (Hapoli) to Talle valley is also provided. Besides, taxa belonging to new records, new to science, recollections and status are also provided.

Moringa species grow in arid and semiarid areas with mean annual rainfall below 100 cm. They are usually fast-growing and reach maturity in a couple of years. The species are greatly valued for their traditional uses, socio-economic significance and therapeutic applications. Apart from being used as salad/vegetable, many species are effective in the cure of obesity, diabetes, cancer and other diseases. Further, seeds of Moringa stenopetala (Baker.f.) Cufod., the African Moringa, are used in cleansing turbid water in Ethiopia. For these varied and veritable attributes and at different degrees of authenticity/efficacy, a focused publication on these ‘miracle plants’ is in fact called for and a book of this kind is truly welcome.

Ethnopharmacological relevance Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. Aim of the study To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. Materials and methods Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Results Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Conclusion Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Agapetes variegata (Roxb.) D. Don ex G. Don var. bhareliana Airy Shaw is treated here as a separate species; A. bhareliana (Airy Shaw) D. Banik & M. Sanjappa. Resurrected A. macrantha (Hook.) Hook. f., earlier treated as a variety under A. variegata (Roxb.) D. Don ex G. Don as A. variegata var. macrantha (Hook. f.) Airy Shaw. Two new combinations A. macrantha var. grandiflora (Hook.f.) Q.Banik & M.Sanjappa and A. macrantha var. oblanceolata (Airy Shaw) D. Banik & M. Sanjappa are proposed here. A. macrantha var. macrantha and A. macrantha var. oblanceolata are reported for the first time from India.

Three new species of Agapetes (Ericaceae) from Arunachal Pradesh, India are described and illustrated with critical comments: Agapetes arunachalensis D.Banik & M.Sanjappa (Agapetes ser. Graciles subser. Parvifoliae), Agapetes dalaiensis D.Banik & M.Sanjappa (Agapetes ser. Agapetes subser. Agapetes) and Agapetes siangensis D.Banik & M.Sanjappa (Agapetes ser. Graciles subser. Longifoliae).

Linnaeus described the genus Cycas with the lone species C. circinalis L. from India, which was based on Rheede’s, Hortus malabaricus. Roxburgh included three species, viz. C. circinalis Willd., C. revoluta Thunb. and C. sphaerica Roxb. All three were reportedly introduced in the Botanical Garden, Howrah during 1798–99 from different countries ( C. circinalis , Indonesia; C. sphaerica , Moluccas and C. revoluta cultivated in West Bengal gardens).

Summary. A new species of Staurogyne (Acanthaceae), S. andamanica, is described and illustrated. Its affinities with S. zeylanica and conservation status are discussed.

Murdannia saddlepeakensis (Commelinaceae), a new species from the Andaman and Nicobar Islands, India, is described and illustrated. The new species is remarkable for its narrowly linear leaves, two fertile stamens, single seeded locule and scorbiculate seeds.

The current distribution and threat assessment of Murdannia saddlepeakensis Ramana & Nandikar (Commelinaceae), an endemic plant of Saddle Peak National Park, northern Andaman is presented here. The data available from field surveys indicate that this species is Critically Endangered according to the 2011 IUCN Red List Categories and Criteria.

During field surveys in Brahmakarmali (North Goa, India) we collected Semecarpus kathalekanensis Dasappa & Swaminath (2000: 78). In order to confirm the identity of the specimens, we examined the protologue and realized that the name Semecarpus kathalekanensis was not validly published, because the authors failed to indicate the herbarium in which the type is conserved (art. 40.7 of the ICN, McNeill et al ., 2012). The authors, however, provided a Latin description and indicated a single gathering “ 10 Jan. 1998 , Dasappa 758 - WGP ” as the holotype. They also cited “ Dasappa 1865 - WGP ” and “ Dasappa 1890 - WGP ” as paratypes. We traced the original material at the Herbarium of Karnataka Forest Department’s Research and Utilization Division, Doresanipalya, Bangalore (Office of the Additional Principal Chief Conservator of Forests, Karnataka). So, the name Semecarpus kathalekanensis is validated here by reference to the previously published description by Dasappa & Swaminath (2000) and by indicating the herbarium in which the holotype is conserved.

ferent tribes or subtribes: Candolle (1825) to the Phaseoleae DC., based on fruit characters; Wight & Arnott (1834) to the Phaseolinae (DC.) Wight & Arn.; Bentham & Hooker (1865) to the Trifolieae Bercht. & J. Presl, based on habit; Schulz (1901) to the Trifoliinae DC., along with Trifolium L. and Ononis L., based on ovule morphology and seed position within the pods. Small (1987, 1989) and Small & Jomphe (1989) pointed out the anomalous position of Parochetus and Ononis in the Trifolieae and their not being closely related to the other genera of that tribe. Further, studies were therefore essential to elucidate the definite affinity of Parochetus with other papilionoid genera. While revising the Trifolieae (excluding Ononis) of India we also reached the conclusion that Parochetus differs considerably from the other genera of the tribe in many morphological characters of the stipules, leaves, bracts and flowers. As the genus does not fit within either of the described subtribes of the Trifolieae, Trifolii

6 species of the genus Alysicarpus are investigated. The detailed karyotypic analysis revealed the presence of 1 pair of secondarily constricted chromosomes (D type) in all the species justifying their inclusion in one genus. Though karyotypes exhibit gross similarity, they differ from each other in minor details. The regularity of meiotic behaviour is noticed, in all the taxa. However, some abnormalities are also recorded. The basic number x=8 for the genus is supported by this work.

The present paper deals with the chromosome numbers and morphology of thirteen species of the genus Desmodium. Twelve out of thirteen species show 2n=22, while one species (D. salicifolium) shows 2n=20. A review of present and previous chromosome number reports justifies the basic numbers x=11 and 10 for the genus. The karyotype analysis is made for the first time in ten species. In all the species investigated here only nearly median and nearly submediam chromosomes are observed. On the basis of karyomorphology D. salicifolium is relatively primitive compared to D. gangeticum, while D. laxiflorum, D. uncinatum, D. triflorum, D. sandwiscence, D. velutinum, D. distortum, D. ritchiei, D. heterocarpon var. strigosum, D. dichotomum, D. elegans and D. intortum occupy the intermediate position. The interrelationship among the species is reticulate. The minor differences between the karyotypes of different species indicate that structural alterations have played an important role in speciation. Karyornorphological observations are discussed in light of Ohashi's infrageneric classification.

The present communication deals with the chromosome number and karyotype analysis of seven species of the genus Indigofera. The karyotype study is made for the first time in the species investigated here. Among the seven species studied, four are diploids with 2n=16 (I. vicioides, I. arrecta, I. duthiei and I. spicata), one is a tetraploid with 2n=32 (I. angulosa) and two are hexaploids with 2n=48 (I. heterantha and I. amblyantha). The basic chromosome number x=8 for the genus is supported by this work. Karyotype analysis revealed that I. duthiei is primitive and I. amblyantha the advanced, the five other species are being intermediate be-tween these two. The chromosomes showed only nearly median and nearly submedian centromeres. The karyotypes further, show that structural changes and to a certain extent polyploidy might have played an important role in speciation and evolution of the genus.

The Andaman and Nicobar Islands, located in the Andaman Sea between peninsular India and Indo-Malaya, are part of two of the 34 mega-diversity hotspots of the world. These islands are characterized by their unique vegetation types such as littoral, mangroves, wet and semi-evergreen forests, and rainforests and for being the home for six aboriginal tribes of Negrito and Mongoloid descent. The islands are also home to a number of migrants and “settlers” from the Indian mainland and Myanmar. The aboriginal tribes and the settlers have a long history of association with the island’s bioresources. In this paper, we survey the ethnic uses of rattans, the unique climbing palms, about 63% of which are endemic to these islands. Our ethnobotanical survey revealed several uses of rattans by the Nicobarese and Shompens, the two major ethnic communities of the Nicobar Islands. In this study, besides the ethnic uses, we also estimated the revenue generated among those involved in the rattan trade (collectors, processors, and exporters).