Search

Background: Older adults are at risk of decreasing functional status due to their condition and many factors. Although many studies have been conducted about declining in functional status, based on the author’s knowledge, only this study that has conducted about functional status changes in the elderly involving the frailty status which undergoing surgery in Indonesia. There are many factor was postulated, some of that was checked routine and applicable in clinical practice. Furthermore, identification of these risk factors can be used a basis for decision making to perform surgeries in older adults because poor functional status causes declining quality of life in the elderly patients. The aim of this research was to determine the risk factors for declined functional status within 30 days after elective surgeries in elderly patients. Methods: We conducted a prospective cohort study from July 2021 to December 2021 at Dr. Kariadi Hospital, Semarang, Indonesia. We included patients aged 60 or older who underwent elective surgery under general anesthesia. We excluded those who underwent emergency surgery, day care surgery, or were unwillingness to participate. The functional status were assessed using the ADL (Activity of Daily Living) Barthel index. To identify risk factors of declined ADL scores, a logistic regression analysis was performed on the age variable, gender, body mass index, frailty status, postoperative complications, as well as haemoglobin, and albumin levels. Results: This study included 191 participants, with 97 women (50.79%) and 94 men (42.21%). Declined in functional status within 30-days after surgery occurred in 54 participants (28.2%). There was a significant changed of functional status before and after surgery. Multivariate analysis showed that independently significant variables for declined functional status were male sex (OR 4.48, p value < 0.001), hypoalbuminemia (OR 2.59, p value 0.02), preoperative functional status (OR 2.37; p value 0.05), and postoperative complications (OR 24.885; p value < 0.001). Conclusion: Risk factors for declined functional status within 30 days after elective surgery in older patients are postoperative complications, preoperative functional status, hypoalbuminemia, and male gender.

BACKGROUND People living with HIV (PLHIV) receiving antiretroviral therapy (ART) exhibit persistent immune dysregulation and microbial dysbiosis, leading to development of cardiovascular diseases (CVDs). We initially compared plasma proteomic profiles between 205 PLHIV and 120 healthy control participants (HCs) and validated the results in an independent cohort of 639 PLHIV and 99 HCs. Differentially expressed proteins (DEPs) were then associated to microbiome data. Finally, we assessed which proteins were linked with CVD development in PLHIV.METHODS Proximity extension assay technology was used to measure 1,472 plasma proteins. Markers of systemic inflammation (C-reactive protein, D-dimer, IL-6, soluble CD14, and soluble CD163) and microbial translocation (IFABP) were measured by ELISA, and gut bacterial species were identified using shotgun metagenomic sequencing. Baseline CVD data were available for all PLHIV, and 205 PLHIV were recorded for development of CVD during a 5-year follow-up.RESULTS PLHIV receiving ART had systemic dysregulation of protein concentrations, compared with HCs. Most of the DEPs originated from the intestine and lymphoid tissues and were enriched in immune- and lipid metabolism–related pathways. DEPs originating from the intestine were associated with specific gut bacterial species. Finally, we identified upregulated proteins in PLHIV (GDF15, PLAUR, RELT, NEFL, COL6A3, and EDA2R), unlike most markers of systemic inflammation, associated with the presence and risk of developing CVD during 5-year follow-up.CONCLUSION Our findings suggest a systemic dysregulation of protein concentrations in PLHIV; some proteins were associated with CVD development. Most DEPs originated from the gut and were related to specific gut bacterial species.TRIAL REGISTRATION ClinicalTrials.gov NCT03994835.FUNDING AIDS-fonds (P-29001), ViiV healthcare grant (A18-1052), Spinoza Prize (NWO SPI94-212), European Research Council (ERC) Advanced grant (grant 833247), and Indonesia Endowment Fund for Education.

BackgroundThe immunopathogenesis of dengue virus (DENV) infection remains incompletely understood. To increase our understanding of inflammatory response in non-severe dengue, we assessed longitudinal changes in the inflammatory proteome in patients with an acute DENV infection.MethodsUsing a multiplex proximity extension assay (PEA), we measured relative levels of 368 inflammatory markers in plasma samples from hospitalized patients with non-severe DENV infection in the acute (n = 43) and convalescence (n = 35) phase of the infection and samples of healthy controls (n = 10).ResultsWe identified 203 upregulated and 39 downregulated proteins in acute versus convalescent plasma samples. The upregulated proteins had a strong representation of interferon (IFN) and IFN-inducible effector proteins, cytokines (e.g. IL-10, IL-33) and cytokine receptors, chemokines, pro-apoptotic proteins (e.g. granzymes) and endothelial markers. A number of differentially expressed proteins (DEPs) have not been reported in previous studies. Functional network analysis highlighted a central role for IFNγ, IL-10, IL-33 and chemokines. We identified different novel associations between inflammatory proteins and circulating concentrations of the endothelial glycocalyx disruption surrogate marker syndecan-1. Conclusion: This unbiased proteome analysis provides a comprehensive insight in the inflammatory response in DENV infection and its association with glycocalyx disruption.

[This corrects the article DOI: 10.1371/journal.pntd.0007927.].

Latar belakang: Leptospirosis merupakan zoonosis penting di dunia, yang masih sering terjadi salah diagnosis. Deteksi laboratorium Leptospira menjadi tantangan karena bakterimea cukup singkat untuk dideteksi molekuler, namun antibodi juga muncul sangat lambat. Urine dapat menjadi sampel alternatif untuk deteksi PCR pada leptospirosis. Pengerjaan PCR membutuhkan DNA berkualitas dan andal, dan diperoleh dari metode ekstraksi DNA yang baik. Penelitian bertujuan untuk mengetahui metode ekstraksi DNA Leptospira terbaik untuk sampel urin, serta mengevaluasi pengaruh waktu penyimpanan dan suhu terhadap kestabilan DNA. Metode: Penelitian ini menggunakan tiga metode isolasi DNA yang berbeda; berbasis silika dengan spin kolom, kromatografi spin column menggunakan resin sebagai matriks pemisah, dan metode larutan dengan guanidine isothiocyanate. Hasil ekstraksi diperiksa konsentrasi dan kemurniannya. Gen SecY pada Leptospira dideteksi dengan PCR real-time. Pengaruh suhu dan lama penyimpanan DNA juga dilihat. Hasil: Hasil isolasi DNA menggunakan resin menunjukkan konsentrasi tertinggi (7,94 + 2,11 μg / mL) dan jumlah salinan amplifikasi DNA Leptospira tertinggi (50167,92 + 1,19). Suhu penyimpanan pada suhu 4°C, -20°C, dan -80°C dan umur simpan 91 hari tidak berpengaruh terhadap kualitas dan kuantitas DNA Leptospira hasil isolasi spike urin. Kesimpulan: Isolasi DNA menggunakan spin column chromatography dengan resin sebagai matriks separasi memiliki kualitas dan kuantitas terbaik berdasarkan kemurnian dan konsentrasi DNA serta jumlah gen SecY yang teramplifikasi. Kata kunci: Leptospira, Leptospirosis, ekstraksi DNA, sampel urin, penyimpanan sampel. Abstract Background: Leptospirosis is a worldwide zoonotic disease, which is still often misdiagnosed. Laboratory detection of Leptospira is challenging since the bacteraemia is quite short for molecular detection, however, the rise of the antibody is late to post the infection. Urine can be a potential alternative sample for PCR detection in leptospirosis. The PCR method requires a reliable DNA template, which is obtained from good DNA extracting methods. The study aimed to determine the best method of extraction Leptospira DNA from the urine sample, as well as evaluating the effect of time storage and temperature for its DNA stability. Methods: This study was utilizing three different DNA isolation methods; silica based with spin column, spin column chromatography using resin as separation matrix, and solution method with guanidine isothiocyanate. The yields were examined for its concentration and purity. Leptospira’s SecY gene was detected with realtime PCR. The influences of storage temperature and the life time of the DNA were also studied. Results: The yield of DNA isolation using resin showed the highest concentration (7.94+2.11 μg/mL) and highest Leptospira DNA amplification copy number (50167.92+1.19). Storage temperature at 4°C, -20°C, and -80°C and life time of 91 days did not have any effect on the quality and quatnity of Leptospira DNA isolated from spiked urine. Conclusions: DNA isolation using spin column chromatography with resin as separation matrix has the best quality and quantity based on the purity and concentration of DNA and the higher number of amplified SecY gene. Keywords: Leptospira, Leptospirosis, DNA extraction, urine sample, sample storage

Abstract Background Reports of human rickettsial infection in Indonesia are limited. This study sought to characterize the epidemiology of human rickettsioses amongst patients hospitalized with fever at 8 tertiary hospitals in Indonesia. Methods Acute and convalescent blood from 975 hospitalized non-dengue patients was tested for Rickettsia IgM and IgG by ELISA. Specimens from cases with seroconversion or increasing IgM and/or IgG titers were tested for Rickettsia IgM and IgG by IFA and Rickettsia genomes using primers for Rickettsia (R.) sp, R. typhi, and Orientia tsutsugamushi. Testing was performed retrospectively on stored specimens; results did not inform patient management. Results R. typhi, R. rickettsii, and O. tsutsugamushi IgG antibodies were identified in 269/872 (30.8%), 36/634 (5.7%), and 19/504 (3.8%) of samples, respectively. For the 103/975 (10.6%) non-dengue patients diagnosed with acute rickettsial infection, presenting symptoms included nausea (72%), headache (69%), vomiting (43%), lethargy (33%), anorexia (32%), arthralgia (30%), myalgia (28%), chills (28%), epigastric pain (28%), and rash (17%). No acute rickettsioses cases were suspected during hospitalization. Discharge diagnoses included typhoid fever (44), dengue fever (20), respiratory infections (7), leptospirosis (6), unknown fever (6), sepsis (5), hepatobiliary infections (3), UTI (3), and others (9). Fatalities occurred in 7 (6.8%) patients, mostly with co-morbidities. Conclusions Rickettsial infections are consistently misdiagnosed, often as leptospirosis, dengue, or Salmonella typhi infection. Clinicians should include rickettsioses in their differential diagnosis of fever to guide empiric management; laboratories should support evaluation for rickettsial etiologies; and public policy should be implemented to reduce burden of disease.

Abstract Background The burden of leptospirosis in Indonesia is poorly understood. Data from an observational study conducted from 2013 to 2016 in seven cities across Indonesia was used to estimate the incidence of leptospirosis and document its clinical manifestations in patients requiring hospitalization. Methods Specimens from patients hospitalized with acute fever were collected at enrollment, 14–28 days, and 3 months. Demographic and clinical information were collected during study visits and/or retrieved from medical records and double-entered into clinical report forms. After initially screening for dengue virus and other pathogens, specimens were tested at a central Reference Laboratory for anti-Leptospira IgM using commercial ELISA kits and for Leptospira DNA using an in-house quantitative real-time PCR assay. Results Of 1464 patients enrolled, 45 (3.1%) confirmed cases (by PCR and/or sero-coversion or four-fold increase of IgM) and 6 (0.4%) probable cases (by high titer IgM) of leptospirosis were identified by the Reference Laboratory. Disease incidence at sites ranged from 0 (0%) cases in Denpasar to 17 (8.9%) cases in Semarang. The median age of patients was 41.2 years (range of 5.3 to 85.0 years), and 67% of patients were male. Twenty-two patients (43.1%) were accurately diagnosed at sites, and 29 patients (56.9%) were clinically misdiagnosed as having another infection, most commonly dengue fever (11, 37.9%). Clinically, 20 patients (39.2%) did not present with hyperbilirubinemia or increased creatinine levels. Two patients (3.9%) died, both from respiratory failure. Fifteen patients (29.4%) clinically diagnosed with leptospirosis at sites were negative based on IgM ELISA and/or PCR at the Reference Laboratory. Conclusions Leptospirosis remains an important cause of hospitalization in Indonesia. It can have diverse clinical presentations, making it difficult to differentiate from other common tropical infections. PCR combined with ELISA is a powerful alternative to the cumbersome gold-standard microscopic agglutination test, particularly in resource-limited settings.

BackgroundThrombocytopenia, bleeding and plasma leakage are major complications of dengue. Activation of endogenous sialidases with desialylation of platelets and endothelial cells may underlie these complications. We aimed to assess the effects of the neuraminidase inhibitor oseltamivir on platelet recovery and plasma leakage in dengue.MethodsWe performed a phase 2, double-blind, multicenter, randomized trial in adult dengue patients with thrombocytopenia (ResultsA total of 70 patients were enrolled; the primary outcome could be assessed in 64 patients (31 oseltamivir; 33 placebo). Time to platelet count ≥100,000/μl (n = 55) or discharge (n = 9) were similar in the oseltamivir and placebo group (3.0 days [95% confidence interval, 2.7 to 3.3] vs. 2.9 days [2.5 to 3.3], P = 0.055). The kinetics of platelet count and parameters of plasma leakage (gall bladder thickness, hematocrit, plasma albumin, syndecan-1) were also similar between the groups.DiscussionIn this trial, adjunctive therapy with oseltamivir phosphate had no effect on platelet recovery or plasma leakage parameters.Trial registrationISRCTN35227717.

Blood culturing remains the "gold standard" for bloodstream infection (BSI) diagnosis, but the method is inaccessible to many developing countries due to high costs and insufficient resources. To better understand the utility of blood cultures among patients in Indonesia, a country where blood cultures are not routinely performed, we evaluated data from a previous cohort study that included blood cultures for all participants. An acute febrile illness study was conducted from July 2013 to June 2016 at eight major hospitals in seven provincial capitals in Indonesia. All participants presented with a fever, and two-sided aerobic blood cultures were performed within 48 hours of hospital admission. Positive cultures were further assessed for antimicrobial resistance (AMR) patterns. Specimens from participants with negative culture results were screened by advanced molecular and serological methods for evidence of causal pathogens. Blood cultures were performed for 1,459 of 1,464 participants, and the 70.6% (1,030) participants that were negative by dengue NS1 antigen test were included in further analysis. Bacteremia was observed in 8.9% (92) participants, with the most frequent pathogens being Salmonella enterica serovar Typhi (41) and Paratyphi A (10), Escherichia coli (14), and Staphylococcus aureus (10). Two S. Paratyphi A cases had evidence of AMR, and several E. coli cases were multidrug resistant (42.9%, 6/14) or monoresistant (14.3%, 2/14). Culture contamination was observed in 3.6% (37) cases. Molecular and serological assays identified etiological agents in participants having negative cultures, with 23.1% to 90% of cases being missed by blood cultures. Blood cultures are a valuable diagnostic tool for hospitalized patients presenting with fever. In Indonesia, pre-screening patients for the most common viral infections, such as dengue, influenza, and chikungunya viruses, would maximize the benefit to the patient while also conserving resources. Blood cultures should also be supplemented with advanced laboratory tests when available.

BackgroundEndothelial hyper-permeability with plasma leakage and thrombocytopenia are predominant features of severe dengue virus infection. It is well established that heparanase, the endothelial glycocalyx degrading enzyme, plays a major role in various diseases with vascular leakage. It is yet to be elucidated whether heparanase activity plays a major role in dengue-associated plasma leakage. Moreover, the major source of heparanase secretion and activation in dengue remains elusive. Since a relatively high amount of heparanase is stored in platelets, we postulate that heparanase released by activated platelets contributes to the increased plasma heparanase activity during dengue virus infection.MethodsHeparanase activity (plasma and urine), and heparan sulfate and syndecan-1 (plasma levels) were measured in dengue patients with thrombocytopenia in acute phase (n=30), during course of disease (n=10) and in convalescent phase (n=25). Associations with clinical parameters and plasma leakage markers were explored. Platelets from healthy donors were stimulated with dengue non-structural protein-1, DENV2 virus and thrombin to evaluate heparanase release and activity ex vivo.ResultsHeparanase activity was elevated in acute dengue and normalized during convalescence. Similarly, glycocalyx components, such as heparan sulfate and syndecan-1, were increased in acute dengue and restored during convalescence. Increased heparanase activity correlated with the endothelial dysfunction markers heparan sulfate and syndecan-1, as well as clinical markers of plasma leakage such as ascites, hematocrit concentration and gall-bladder wall thickening. Notably, platelet number inversely correlated with heparanase activity. Ex vivo incubation of platelets with thrombin and live DENV2 virus, but not dengue virus-2-derived non-structural protein 1 induced heparanase release from platelets.ConclusionTaken together, our findings suggest that the increase of heparanase activity in dengue patients is associated with endothelial glycocalyx degradation and plasma leakage. Furthermore, thrombin or DENV2 activated platelets may be considered as a potential source of heparanase.

BACKGROUND:Chikungunya virus (CHIKV) is often overlooked as an etiology of fever in tropical and sub-tropical regions. Lack of diagnostic testing capacity in these areas combined with co-circulation of clinically similar pathogens such as dengue virus (DENV), hinders CHIKV diagnosis. To better address CHIKV in Indonesia, an improved understanding of epidemiology, clinical presentation, and diagnostic approaches is needed. METHODOLOGY/PRINCIPAL FINDINGS:Acutely hospitalized febrile patients ≥1-year-old were enrolled in a multi-site observational cohort study conducted in Indonesia from 2013 to 2016. Demographic and clinical data were collected at enrollment; blood specimens were collected at enrollment, once during days 14 to 28, and three months after enrollment. Plasma samples negative for DENV by serology and/or molecular assays were screened for evidence of acute CHIKV infection (ACI) by serology and molecular assays. To address the co-infection of DENV and CHIKV, DENV cases were selected randomly to be screened for evidence of ACI. ACI was confirmed in 40/1,089 (3.7%) screened subjects, all of whom were DENV negative. All 40 cases initially received other diagnoses, most commonly dengue fever, typhoid fever, and leptospirosis. ACI was found at five of the seven study cities, though evidence of prior CHIKV exposure was observed in 25.2% to 45.9% of subjects across sites. All subjects were assessed during hospitalization as mildly or moderately ill, consistent with the Asian genotype of CHIKV. Subjects with ACI had clinical presentations that overlapped with other common syndromes, atypical manifestations of disease, or persistent or false-positive IgM against Salmonella Typhi. Two of the 40 cases were possibly secondary ACI. CONCLUSIONS/SIGNIFICANCE:CHIKV remains an underdiagnosed acute febrile illness in Indonesia. Public health measures should support development of CHIKV diagnostic capacity. Improved access to point-of-care diagnostic tests and clinical training on presentations of ACI will facilitate appropriate case management such as avoiding unneccessary treatments or antibiotics, early response to control mosquito population and eventually reducing disease transmission.

Active Cytomegalovirus (CMV) infection has been realated to immunocompromise conditions (malignancy, HIV-AIDS, longterm use of corticosteroids, transplant patient). Nowadays, severa studies have shown that immunocompetent critically ill patients were suffered from active CMV infection. Alteration of immune system in critically immunocompetent patient (without clear history of immunocompromise condition), might become the most possible reason enderlying this event. To document the prevalence of active CMV infection in critically ill immunocompetent patient; and to find out the difference in the degree of severity between groups of patients with and without active CMV infection, admitted in the ICU (Intensive Care Unit) . A cross sectional study was conducted from Appril 1st until June 30th 2013. Subjects were patient aged ≥ 14 years, hospitalized in ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients having a history of malignancy, HIV-AIDS, longterm use of corticosteroids, and receiving transplatation were excluded from the study. The degree of severity was calculated (using APACHE II score) in the first 24 hours in ICU. EDTA sample for qualitative PCR examination (procedure as described elsewhere) was collected after 4 days of treatment. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Finally, datas ware analyzed using bivariate analysis. From 50 subjects included, 16 patients had active CMV infection. The degree of severity due to APACHE II score were normally distributed with mean 11.8±6.43. The mean of APACHE II score in group with active CMV infection was higher than group without .tive CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510). The Prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in ICU of Dr. Kariadi Hospital Semarang and the degree of severity due to APACHE II score was higher in group with active CMV infection than group without active CMV infection. A qualitative PCR testing was useful in the diagnosis of active CMV among immunocompeten critically-ill patients in the ICU. Key Words: Immunocompetent, critically ill, active CMV infection, PCR

BackgroundThe epidemiology of acute febrile illness, a common cause of hospitalization in Indonesia, has not been systematically studied.Methodology/principal findingsThis prospective observational study enrolled febrile patients (temperature ≥38°C) aged ≥1 year from July 2013 until June 2016 at eight government referral teaching hospitals in seven provincial capitals in Indonesia. Patients were managed according to the hospital standard-of-care (SOC), and blood samples were drawn for molecular and serological assays. Clinical data, laboratory results, and specimens for additional tests were collected at enrollment, days 14-28, and at three months. Regular follow-up visits were then scheduled for every three months either until symptoms resolved or until one year. In total, this study included 1,486 adult and pediatric patients presenting with multi-organ (768, 51.7%), gastrointestinal (497, 33.0%), respiratory (114, 7.7%), constitutional (62, 4.2%), skin and soft-tissue (24, 1.6%), central nervous system (17, 1.1%), or genitourinary (4, 0.3%) manifestations. Microbiological diagnoses were found in 1,003/1,486 (67.5%) participants, of which 351/1,003 (35.0%) were not diagnosed during hospitalization using SOC diagnostic tests. Missed diagnoses included all cases caused by Rickettsia spp., chikungunya, influenza, and Seoul virus. The most common etiologic agents identified were dengue virus (467, 46.6%), Salmonella spp. (103, 10.3%), and Rickettsia spp. (103, 10.3%). The overall mortality was 89 (5.9%).Conclusions/significanceFebrile illness in Indonesia has various microbiologic etiologies and substantial overall mortality. Diagnostic limitations and lack of epidemiologic data resulted in potentially treatable, and at times fatal, diseases being missed.

Abstract Background : TLR4 Asp299Gly and TNF-α -308G/A polymorphisms have been shown to be associated with increased susceptibility and severity of infection. TLR4 Asp299Gly polymorphism could affect the host’s ability to respond to leptospira sp. TNF-α -308G/A polymorphism, is associated with the high producer of TNF-α. Methods : Total of 36 leptospirosis patients (IgM anti leptospira and MAT positive) and healthy individual with the equal number were included. The polymorphisms were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using site spesific restriction enzyme. Results : Distribution of homozygous wild-type TLR4 Asp299Gly polymorphism was higher in both of groups ( 94.5:97.2%.) and homozygous mutant allele was absent. There was not significantly difference of TLR4 Asp299Gly in leptospirosis patients and healthy group ( ρ=1.00; OR 0.5; 95%CI, 0.04-5.6) and between mild and severe leptospirosis (ρ=0.54; OR 1.54 ; 95% CI, 1.20-1.98). The presence of homozygous wild-type TNF-α -308G/A polymorphism was higher between leptospirosis patients and healthy group (100:94.5%) andhomozygous mutant allele was not found in both of the groups. No significantly different of TNF-α -308G>A polymorphism between leptospirosis patient and healthy group (ρ=0.49). Conclusions : In this study, the polymorphisms of TLR4 Asp299Gly and TNF-α -308G/A were not associated with the susceptibility and severity of leptospirosis. Keywords : Leptospirosis, TLR4 Asp299Gly polymorphism, TNF-α -308G/A polymorphism

Severe leptospirosis is frequently complicated by a hemorrhagic diathesis, of which the pathogenesis is still largely unknown. Thrombocytopenia is common, but often not to the degree that spontaneous bleeding is expected. We hypothesized that the hemorrhagic complications are not only related to thrombocytopenia, but also to platelet dysfunction, and that increased binding of von Willebrand factor (VWF) to platelets is involved in both platelet dysfunction and increased platelet clearance.A prospective study was carried out in Semarang, Indonesia, enrolling 33 hospitalized patients with probable leptospirosis, of whom 15 developed clinical bleeding, and 25 healthy controls. Platelet activation and reactivity were determined using flow cytometry by measuring the expression of P-selectin and activation of the αIIbβ3 integrin by the binding of fibrinogen in unstimulated samples and after ex vivo stimulation by the platelet agonists adenosine-diphosphate (ADP) and thrombin-receptor activating peptide (TRAP). Platelet-VWF binding, before and after VWF stimulation by ristocetin, as well as plasma levels of VWF, active VWF, the VWF-inactivating enzyme ADAMTS13, thrombin-antithrombin complexes (TAT) and P-selectin were also measured. Bleeding complications were graded using the WHO bleeding scale. Our study revealed that platelet activation, with a secondary platelet dysfunction, is a feature of patients with probable leptospirosis, especially in those with bleeding manifestations. There was a significant inverse correlation of bleeding score with TRAP-stimulated P-selectin and platelet-fibrinogen binding (R = -0.72, P = 0.003 and R = -0.66, P = 0.01, respectively) but not with platelet count. Patients with bleeding also had a significantly higher platelet-VWF binding. Platelet counts were inversely correlated with platelet-VWF binding (R = -0.74; P = 0.0009. There were no correlations between platelet-VWF binding and the degree of platelet dysfunction, suggesting that increased platelet-VWF binding does not directly interfere with the platelet αIIbβ3 signaling pathway in patients with probable leptospirosis.Platelet dysfunction is common in probable leptospirosis patients with manifest bleeding. Increased VWF-platelet binding may contribute to the activation and clearance of platelets.