Search

Objective: We investigated whether co-incubation of 5-FU and gum-based cerium oxide nanoparticles (CeO2 NPs) would improve half-maximal inhibitory concentration (IC50) and apoptosis in the Caco-2 cancer cell line Materials and Methods: In this experimental study, we synthesized Ceo-2-XG by the nano perception method. X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), dynamic light scattering (DLS) and vibrating sample magnetometer (VSM) techniques were employed to characterize the synthesized nanoparticles. The Caco-2 cancer cells were cultured and treated with Ceo-2- XG and 5-FU. Cytotoxicity analysis was carried out using MTT assay on Caco-2 cancer cells. CXCR1, CXCR2, CXCL8, BAX, BCL-2, P53, CASPASE-3, CASPASE-8 and CASPASE-9 gene expression changes were assessed by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). The Caco-2 cancer cell mortality mechanism was analyzed using Annexin V-FITC/PI flow cytometry. Using the inverted microscope morphology changes of the Caco-2 cancer cells was observed. Results: With a sample size of roughly 11 nm, TEM analysis revealed spherical structures. Interestingly, after 72 hours, 400 μg/ml nanoparticles significantly lowered the IC50 of 5-FU from 101 to 71 μg/ml (P<000.1). Furthermore, qRT-PCR analysis showed that BCL-2, CXCR1, CXCR2 and CXCR8 expressions were significantly decreased in the 5-FU and Ceo-2-XG nanoparticles co-incubated group, compared to the 5-FU alone (P<0.001). Notably, gene expressions of BAX, P53, CASPASE-3, CASPASE-8 and CASPASE-9 were significantly higher in the 5-FU and Ceo2-XG nanoparticles co-incubated group, compared to the 5-FU alone (P<0.001). The findings revealed that dead cells owing to apoptosis were more than two times higher in 5-FU and Ceo-2-XG nanoparticles cancer cells than in 5-FU alone treated cancer cells. Conclusion: Co-incubation of 5-FU and Ceo-2-XG nanoparticles significantly increased apoptosis in the Caco-2 cancer cells. The antiproliferative activity of co-incubated 5-FU and Ceo-2-XG nanoparticles on Caco-2 cancer cells was substantially higher than that of 5-FU alone. [ABSTRACT FROM AUTHOR]

Objective: Salvia species which are medicinal herbs have been used to improve male reproductive functions in traditional medicine. They also, have been used to treat several diseases. In this present study, effects of Salvia hypoleuca on male rat reproductive function were investigated by sperm analysis and assessment of CREM expression at mRNA and protein levels. Materials and methods: Two hundred and fifty mg/kg/day of S. hypoleuca as treatment was given to 10-week old male wistar rats for 56 consecutive days. Sperm analysis, RT-PCR and western blot were carried out to investigate rat reproductive function. Results: Results indicated significant increase in the weights of testis, epididymal sperm counts, and sperm motility compared to control group. RT-PCR and western blot showed an increase in the expression of both CREM mRNA and protein levels. Conclusion: The findings in this study showed S. hypoleuca induced spermatogenesis by CREM activation in testis and improved male fertility.

Objective: Thirteen million cancer deaths and 21.7 million new cancer cases are expected in the world by 2030. Breast cancer is considered as the main cause of cancer mortality in women aged 20-59 years. microRNAs (miRNAs) regulate gene expression at the post-transcriptional level and they are highly expressed in malignancies,including breast cancer. The role of miRNAs in the pathogenesis of breast cancer is not fully understood. In the present study,for the first time,the impact of hsa-miR-423 rs6505162 on breast cancer risk was investigated in the central province of Iran,Isfahan. Materials and Methods: This case-control study was conducted on 153 clinicopathological proven breast cancer patients and 153 sex-matched healthy women with no history of any cancer type and relative patients. The patients and controls were genotyped and association of their clinical characteristics with hsa-miR-423 rs6505162 genotype was analyzed. Results: The findings indicated that CC genotype of hsa-miR-423 rs6505162 was associated with the increased risk of breast cancer [odds ratio (OR)=2.37,95% confidence interval (CI)=1.29-4.35 and P=0.0023,CC vs. AA]. Conclusion: The data suggested that hsa-miR-423 rs6505162 could be considered as a novel risk factor in breast cancer pathogenesis in Isfahan province of Iran. [ABSTRACT FROM AUTHOR]

Objective: The aim of current study was to provide a proof-of-concept on the mechanism of PLAU and PCDH10 gene expressions and caspases-3, -8, and -9 activities in the apoptotic pathway after treatment of malignant human glioma cell line (U87MG) with cytochalasin H. Materials and Methods: In the present experimental study, we have examined cytochalasin H cytotoxic activities as a new therapeutic agent on U87MG cells in vitro for the first time. The cells were cultured and treated with 10-5-10-9 M of cytochalasin H for 24, 48 and 72 hours. The assessment of cell viability was carried out by (3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyltetrazoliumbromide (MTT) assay at 578 nm. The data are the average of three independent tests. mRNA expression changes of PLAU and PCDH10 were then evaluated by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). The fluorometric of caspases-3, -8, and -9 activities were carried out. The morphology changes in the U87MG cells were observed by fluorescence microscope. Results: MTT assay showed that cytochalasin H (10-5 M) inhibited the U87MG cancer cells proliferation after 48 hours. Analysis of qRT-PCR showed that the PLAU expression was significantly decreased in comparison with the control (P<0.05). The expression of PCDH10 also showed a significant increase when compared to the control (P<0.001). Fluorescence microscope indicated morphological changes due to apoptosis in U87MG cancer cells, after treatment with cytochalasin H (10-5 M, 48 hours). The fluorometric evaluation of caspase-3, -8, and -9 activities showed no significant difference between the caspases and the control group. Conclusion: This study shows the effect of caspase-independent pathways of the programmed cell death on the U87MG cancer cell line under cytochalasin H treatment. Further studies are needed to explore the exact mechanism. [ABSTRACT FROM AUTHOR]

Objective: In this study, artificial neural network (ANN) analysis of virotherapy in preclinical breast cancer was investigated. Materials and Methods: In this research article, a multilayer feed-forward neural network trained with an error back-propagation algorithm was incorporated in order to develop a predictive model. The input parameters of the model were virus dose, week and tamoxifen citrate, while tumor weight was included in the output parameter. Two different training algorithms, namely quick propagation (QP) and Levenberg-Marquardt (LM), were used to train ANN. Results: The results showed that the LM algorithm, with 3-9-1 arrangement is more efficient compared to QP. Using LM algorithm, the coefficient of determination (R2) between the actual and predicted values was determined as 0.897118 for all data. Conclusion: It can be concluded that this ANN model may provide good ability to predict the biometry information of tumor in preclinical breast cancer virotherapy. The results showed that the LM algorithm employed by Neural Power software gave the better performance compared with the QP and virus dose, and it is more important factor compared to tamoxifen and time (week). [ABSTRACT FROM AUTHOR]

Background: Epstein-Barr Virus (EBV) has a great co relationship with human malignancies such as gastric carcinoma. Synonymous codon investigations in viruses could help designing vaccine, to generate immunity. Codon Adaptation Index (CAI) has measured translation elongation rate, among the highly expressed genes. The aim of this study was: usage of "CAI" to measure translation efficiency to know how fast EBV-GD1 could produce its proteins. Methods:The complete genomic sequences of human herpes virus 4 strain GD1 have retrieved from http://www.ncbi.nlm.nih.gov/sites/gquery (GenBank accession no. AY961628) to extract all protein-coding genes. The sequences have analyzed with DAMBE software. Results: The results have shown that CAI values for the EBV-GD1 genes were 0.76356 ± 0.02957. The highest and lowest CAI values were 0.82233 and 0.68321 respectively. The results have shown that highly expressed genes mostly had more codon usage bias than low expressed genes. Conclusion: The results provide and introduce not only a system, but also the principles in order to understand the pathogenesis and evolution of EBV-GD1, to open a window, in order to make a better product or vaccine to challenge with the virus. [ABSTRACT FROM AUTHOR]

New cancer therapies with novel mechanisms and functions are needed to treat patients with different cancers. Virotherapy is a good scenario for such treatment. The advantages of virotherapy include the potential lack of cross resistance with standard therapies and the ability to cause tumor destruction by numerous mechanisms. Oncolytic virus not only possesses unique mechanisms of action that are distinct from other treatment modalities, its self-perpetuating nature provides an ideal platform for therapeutic transgenic insertion. In this review article, a variety of oncolytic viruses in cancer gene therapy will be described. [ABSTRACT FROM AUTHOR]

Objective: Breast cancer is the most common cause of cancer-related deaths in women both worldwide and in Malaysia. Azadirachta indica (A. Juss), commonly known as neem, is one of the most versatile medicinal plants that has gained worldwide prominence due to its medicinal properties. However, the anticancer effect of ethanolic neem leaf extract against breast cancer has not been documented. The purpose of the present study is to investigate the effect of neem leaf extract on c-Myc oncogene expression in 4T1 breast cancer BALB/c mice. Materials and Methods: In this experimental study, A total of 48 female BALB/c mice were divided randomly into four groups of 12 mice per group: i.cancer control (CC) treated with 0.5% Tween 20 in PBS, ii. 0.5 pg/mL tamoxifen citrate (CT), iii. 250 mg/kg neem leaf extract (C250), and iv. 500 mg/kg neem leaf extract (C500). In situ reverse transcription polymerase chain reaction (in situ RT-PCR) was applied to evaluate suppression of c-Myc oncogene expression in breast cancer tissue. Results: The C500 group showed significant (p<0.05) suppression of c-Myc oncogene expression compared to the CC group. Conclusion: c-Myc was found to be down regulated under the effect of 500 mg/kg ethanolic neem leaf extract. [ABSTRACT FROM AUTHOR]

Objective: This study was carried out to investigate the oncolytic effect of the Newcastle disease virus (NDV) strain AF2240 on the MCF-7 breast cancer cell line. Materials and Methods: The NDV-AF2240 was propagated in 11 days old embryonated chicken eggs for 72 hours. The virus in the allantoic fluid was harvested and purified. The haemagglutination (HA) test was conducted on the purified virus to determine the virus titre which was 16384 haemagglutination units (HAUs). The microculture tetrazolium assay (MTA) was carried out via two methods-the monolayer and co-culture techniques- to determine the inhibitory concentration (IC50) of NDV-AF2240 against the MCF-7 breast cancer cell line. Confocal laser scanning microscopy was carried out on polyclonal chicken antibody and fluorescein isothiocynate (FITC) conjugated goat antichicken antibody to observe virus localization in the cells. The terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay was conducted to quantify the percentage of apoptotic cells. Results: IC50 value of NDV-AF2240 was two HAUs in both the monolayer and co-cultures. Virus particles were detected in the cytoplasm of MCF-7 breast cancer cell line after 24 and 48 hours post treatment. Virus budding was detected 72 hours post treatment. The number of apoptotic cells was significantly increased (p<0.05) 72 hours post NDV-AF2240 treatment. Conclusion: The findings of this study show that NDV-AF2240 has an oncolytic effect against the MCF-7 breast cancer cell line. Further studies are needed to understand the anti cancer mechanism of this virus. [ABSTRACT FROM AUTHOR]

Objective: We investigated whether co-incubation of 5-FU and gum-based cerium oxide nanoparticles (CeO 2 NPs) would improve half-maximal inhibitory concentration (IC 50 ) and apoptosis in the Caco-2 cancer cell line Materials and Methods: In this experimental study, we synthesized Ceo-2-XG by the nano perception method. X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), dynamic light scattering (DLS) and vibrating sample magnetometer (VSM) techniques were employed to characterize the synthesized nanoparticles. The Caco-2 cancer cells were cultured and treated with Ceo-2- XG and 5-FU. Cytotoxicity analysis was carried out using MTT assay on Caco-2 cancer cells. CXCR1, CXCR2, CXCL8, BAX, BCL-2, P53, CASPASE-3, CASPASE-8 and CASPASE-9 gene expression changes were assessed by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). The Caco-2 cancer cell mortality mechanism was analyzed using Annexin V-FITC/PI flow cytometry. Using the inverted microscope morphology changes of the Caco-2 cancer cells was observed., Results: With a sample size of roughly 11 nm, TEM analysis revealed spherical structures. Interestingly, after 72 hours, 400 μg/ml nanoparticles significantly lowered the 50 of 5-FU from 101 to 71 μg/ml (P<000.1). Furthermore, qRT-PCR analysis showed that BCL-2, CXCR1, CXCR2 and CXCR8 expressions were significantly decreased in the 5-FU and Ceo-2-XG nanoparticles co-incubated group, compared to the 5-FU alone (P<0.001). Notably, gene expressions of BAX, P53, CASPASE-3, CASPASE-8 and CASPASE-9 were significantly higher in the 5-FU and Ceo- 2-XG nanoparticles co-incubated group, compared to the 5-FU alone (P<0.001). The findings revealed that dead cells owing to apoptosis were more than two times higher in 5-FU and Ceo-2-XG nanoparticles cancer cells than in 5-FU alone treated cancer cells., Conclusion: Co-incubation of 5-FU and Ceo-2-XG nanoparticles significantly increased apoptosis in the Caco-2 cancer cells. The antiproliferative activity of co-incubated 5-FU and Ceo-2-XG nanoparticles on Caco-2 cancer cells was substantially higher than that of 5-FU alone.

Objective: In this study, artificial neural network (ANN) analysis of virotherapy in preclinical breast cancer was investigated., Materials and Methods: In this research article, a multilayer feed-forward neural network trained with an error back-propagation algorithm was incorporated in order to develop a predictive model. The input parameters of the model were virus dose, week and tamoxifen citrate, while tumor weight was included in the output parameter. Two different training algorithms, namely quick propagation (QP) and Levenberg-Marquardt (LM), were used to train ANN., Results: The results showed that the LM algorithm, with 3-9-1 arrangement is more efficient compared to QP. Using LM algorithm, the coefficient of determination (R(2)) between the actual and predicted values was determined as 0.897118 for all data., Conclusion: It can be concluded that this ANN model may provide good ability to predict the biometry information of tumor in preclinical breast cancer virotherapy. The results showed that the LM algorithm employed by Neural Power software gave the better performance compared with the QP and virus dose, and it is more important factor compared to tamoxifen and time (week).

Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC&#95;020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.

The prevalence of Hepatitis C virus (HCV) is approximately 3% around the world. This virus causes chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. The effectiveness of interferon-α and ribavirin therapy is about 50% and is associated with significant toxicity and cost. Hence, generating new vaccines or drugs is an obligation. However, there is no vaccine available for clinical use. DNA vaccines have some advantages such as producing feasibility and generating intensive cellular and humoral immune responses. Activation and improvement of natural immune defense mechanisms is a necessity for the development of an effective HCV vaccine. This article discusses the current status of therapies for hepatitis C, the promising new therapies and the experimental strategies to develop an HCV vaccine.

Objective: Azadirachta indica (Neem) has been used traditionally for many centuries. Some impressive therapeutic qualities have been discovered. However, the therapeutic effect of neem leaf extract in 4T1 breast cancer has not been documented. The purpose of the present study is to investigate the therapeutic effect of ethanolic Neem leaf extract in an in vivo 4T1 breast cancer model in mice., Materials and Methods: A total of 84 female BALB/c mice were divided randomly into 7 groups (3 non-cancerous groups and 4 cancerous groups) consisting of 12 mice per group. The 3 non-cancerous groups were normal mice treated with 0.5% of Tween 20 in phosphate buffer saline (PBS) (NC), 250 mg/kg Neem (N250) or 500 mg/kg Neem (N500). The 4 cancerous groups were; cancer controls treated with 0.5% of Tween 20 in PBS (CC), and cancerous mice treated with 0.5 µg/mL tamoxifen citrate (CT), 250 mg/kg Neem leaf extract (CN 250) or 500 mg/kg Neem leaf extract (CN 500). Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assays were used to evaluate apoptosis (cell death) in the breast cancer tissues. SPSS software, version 14 was used for statistical analysis. Statistical significance was defined as p≤0.05. Non parametric analysis of variance (ANOVA) was performed with the Kruskal Wallis test for the TUNEL assays. Parametric data among the groups was compared using ANOVA., Results: TUNEL assays showed that the CN 250 and CN 500 groups had a higher incidence of apoptosis compared with the cancer controls., Conclusion: The findings showed that neem leaf extract induces apoptosis in 4T1 breast cancer BALB/c mice.