Search

Huanglongbing (HLB) is the most devastating citrus disease and is associated with three bacterial species of the genus 'Candidatus Liberibacter' transmitted by insect vectors. The early detection of HLB is based on PCR methods, and it is one of the cornerstones for preventing incursion into disease-free countries. However, the detection of phytopathogenic bacteria with PCR-based methods is problematic in surveys that include a variety of samples of different origins. Here, we first report the proportion of amplifications obtained by two standardized real-time PCR methods for the diagnosis of HLB in various environmental samples that include plants, psyllid vectors, and parasitic wasps of the psyllids. The results of 4915 samples showed that 9.3% of them were amplified by the first rapid screening test and only 0.3% by the more specific tests. Most of the amplifications were associated with parasitic wasps. We designed the primers external to the target regions of both real-time PCR protocols to determine if amplifications belonged to one of three 'Ca. Liberibacter' species associated with HLB. The bioinformatic analysis of the sequences obtained with these primers revealed that all these amplifications came from the presence of other prokaryotic organisms in the samples. The primers developed in this study overcome the problem of undesired amplification in environmental samples. Thus, they could be used in future survey protocols to prevent the eradication of negative trees and the generation of unjustified alarms. [ABSTRACT FROM AUTHOR]

Huanglongbing (HLB) is a devastating disease that affects all commercial citrus species worldwide. The disease is associated with bacteria of three species of the genus ' Candidatus Liberibacter' transmitted by psyllid vectors. To date, HLB has no cure, so preventing its introduction into HLB-free areas is the best strategy to control its spread. For that, the use of accurate, sensitive, specific, and reliable detection methods is critical for good integrated management of this serious disease. This study presents a new real-time recombinase polymerase amplification (RPA) protocol able to detect the three ' Ca . Liberibacter' species associated with HLB in both plant and insect samples, validated according to European and Mediterranean Plant Protection Organization (EPPO) guidelines and tested on 365 samples from nine different geographic origins. This new protocol does not require nucleic acid purification or specialized equipment, making it ideal to be used under field conditions. It is based on specific primers and probe targeting a region of fusA gene, which shows a specificity of 94%-100%, both in silico and in vitro , for the ' Ca . Liberibacter' species associated with HLB. The analytical sensitivity of the new protocol is excellent, with a reliable detection limit in the order of 10 1 copies per microliter in HLB-infected plant and insect material. The repeatability and reproducibility of the new methods showed consistent results. Diagnostic parameters of the new RPA protocol were calculated and compared with the gold standard technique, a quantitative real-time PCR, in both crude extracts of citrus plants and insect vectors. The agreement between the two techniques was almost perfect according to the estimated Cohen's kappa index, with a diagnostic sensitivity and specificity of 83.89% and 100%, respectively, and a relative accuracy of 91.59%. Moreover, the results are obtained in less than 35 min. All these results indicate the potential of this new RPA protocol to be implemented as a reliable on-site detection kit for HLB due to its simplicity, speed, and portability., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Morán, Herrero-Cervera, Carvajal-Rojas and Marco-Noales.)

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).