Search

Takayasu's arteritis is a chronic inflammatory disease of the large and medium-sized arteries. It commonly involves the aorta with its branches and the pulmonary arteries. The retinal hemodynamics suggest that the carotid artery involvement causes diminished retinal blood flow. This is the pathogenetic mechanism of Takayasu's retinopathy with characteristic features of microaneurysms, arterio-venous anastomosis and non-perfused retinal areas. Our case presented as branch retinal artery occlusion with collaterals and iris neovascularization. The branch retinal artery, a small retinal artery occlusion in our case is an unusual presenting feature of Takayasu's aorto-arteritis. [ABSTRACT FROM AUTHOR]

Background: Bacterial panicle blight, incited by Burkholderia glumae, has impacted rice production globally. Despite its significance, knowledge about the disease and the virulence pattern of the causal agent is very limited. Bacterial panicle blight is a major challenge in the rice-growing belts of North-western India, resulting in yield reduction. However, the management of B. glumae has become a challenge due to the lack of proper management strategies., Methodology and Results: Twenty-one BG strains have been characterized using the 16S rRNA and the gyrB gene-based sequence approach in the present study. The gyrB gene-based phylogenetic analysis resulted in geographic region-specific clustering of the BG isolates. The virulence screening of twenty-one BG strains by inoculating the pathogenic bacterial suspension of 1 × 10 -8  cfu/ml at the booting stage (55 DAT) revealed the variation in the disease severity and the grain yield of rice plants. The most virulent BG1 strain resulted in the highest disease incidence (82.11%) and lowest grain yield (11.12 g/plant), and the least virulent BG10 strain resulted in lowest disease incidence of 18.94% and highest grain yield (24.62 g/plant). In vitro evaluation of various biocontrol agents and nano copper at different concentrations by agar well diffusion method revealed that nano copper at 1000 mg/L inhibited the colony growth of B. glumae. Under net house conditions, nano copper at 1000 mg/L reduced the disease severity to 21.23% and increased the grain yield by 20.91% (31.76 g per plant) compared to the positive control (COC 0.25% + streptomycin 200 ppm). Remarkably, pre-inoculation with nano copper at 1000 mg/L followed by challenge inoculation with B. glumae enhanced the activity of enzymatic antioxidants viz., Phenyl ammonia-lyase (PAL), Polyphenol oxidase (PPO) and Peroxidase (POX) and non-enzymatic antioxidant phenol. Additionally, we observed a substantial transcript level upregulation of six defense-related genes to several folds viz., OsPR2, OsPR5, OsWRKY71, OsPAL1, OsAPX1, and OsPPO1 in comparison to the pathogen control and healthy control., Conclusions: Overall, our study provides valuable insights into the potential and practical application of nano copper for the mitigation of bacterial panicle blight, offering promising prospects for commercial utilization in disease management., (© 2024. The Author(s), under exclusive licence to Springer Nature B.V.)

Pusa Basmati 1509 (PB1509) is one of the major foreign-exchange-earning varieties of Basmati rice; it is semi-dwarf and early maturing with exceptional cooking quality and strong aroma. However, it is highly susceptible to various biotic stresses including bacterial blight and blast. Therefore, bacterial blight resistance genes, namely, xa13 + Xa21 and Xa38 , and fungal blast resistance genes Pi9 + Pib and Pita were incorporated into the genetic background of recurrent parent (RP) PB1509 using donor parents, namely, Pusa Basmati 1718 (PB1718), Pusa 1927 (P1927), Pusa 1929 (P1929) and Tetep, respectively. Foreground selection was carried out with respective gene-linked markers, stringent phenotypic selection for recurrent parent phenotype, early generation background selection with Simple sequence repeat (SSR) markers, and background analysis at advanced generations with Rice Pan Genome Array comprising 80K SNPs. This has led to the development of Near isogenic lines (NILs), namely, Pusa 3037, Pusa 3054, Pusa 3060 and Pusa 3066 carrying genes xa13 + Xa21 , Xa38 , Pi9 + Pib and Pita with genomic similarity of 98.25%, 98.92%, 97.38% and 97.69%, respectively, as compared to the RP. Based on GGE-biplot analysis, Pusa 3037-1-44-3-164-20-249-2 carrying xa13 + Xa21 , Pusa 3054-2-47-7-166-24-261-3 carrying Xa38 , Pusa 3060-3-55-17-157-4-124-1 carrying Pi9 + Pib , and Pusa 3066-4-56-20-159-8-174-1 carrying Pita were identified to be relatively stable and better-performing individuals in the tested environments. Intercrossing between the best BC 3 F 1 s has led to the generation of Pusa 3122 ( xa13 + Xa21 + Xa38 ), Pusa 3124 ( Xa38 + Pi9 + Pib ) and Pusa 3123 ( Pi9 + Pib + Pita ) with agronomy, grain and cooking quality parameters at par with PB1509. Cultivation of such improved varieties will help farmers reduce the cost of cultivation with decreased pesticide use and improve productivity with ensured safety to consumers.

Menstruation is a natural phenomenon for every female, starting from adolescents to menopausal age. Any disturbances in menstrual patterns can eventually affect one's physical as well as psychological health which in turn hamper the quality of life of women. Several factors including genetic predisposition as well as lifestyle modifications adversely affect normal menstrual patterns. Hence, this study aims to evaluate the prevalence of menstrual disorders among adolescents and young women as well as the associated risk factors. A cross-sectional random survey was conducted from January 2020 to January 2022 in various schools and colleges. A structured questionnaire was prepared which include anthropometric details, demographic information, and lifestyle patterns. The data were extracted for further statistical analysis. In the overall study population, the prevalence of PCOS, Dysmenorrhea, Menorrhagia, Polymenorrhea, Hypomenorrhea and the irregular menstrual cycle was found at 14.14%, 15.14%, 6.29%, 3.70%, 5.16% and 44.83% respectively. The mean BMI of the study population was 19.949 ± 4.801 kg/m 2 and the mean WHr was 0.872 ± 0.101, indicating a moderate to high risk of metabolic disorder among the study population. Increased BMI, short sleep, and sedentary and vigorous physical activity can contribute to the risk of developing menstrual disorders. Unhealthy food habits are a major risk factor for menstrual disorders. Lifestyle modifications like healthy food habits, sleeping patterns, physical activity, etc. can effectively reduce the risk of menstrual disorders and also cut down the severity of more complex health problems. In-depth biochemical and molecular analysis is required to identify specific biomarkers., (© 2023. The Author(s).)

Bacterial panicle blight (BPB) caused by Burkholderia glumae (BG) has become significantly more prevalent in the rice-growing regions of North India. Based on virulence screening and in vitro quantification of toxoflavin, the BG strains were classified as hyper- (BG1 and BG3), moderate- (BG2, BG4, BG6, BG8, and BG9), and hypo- (BG5, BG7, and BG10) virulent. Plant inoculation assays with cell-free culture filtrate revealed strains with higher toxoflavin-producing ability had higher virulence. Based on 16S rRNA sequence, 6 isolates from Uttar Pradesh were grouped in clad C1; whereas, clad C2 exhibited 4 isolates, two each from Delhi and Uttar Pradesh. Strain BG1 being the most virulent Indian strain from Uttar Pradesh was further profiled for 11 tox genes. We found all the 11 tox genes present in strain BG1. In toxRABCDE cluster, all tox genes showed high similarity to B. glumae BGR1 except toxB , whereas in toxFGHIJ cluster toxF , toxG, toxH and toxI shared maximum similarity to B. glumae 336gr-1. tox genes of BG1 exhibited homology as well as divergence with B. gladioli . The domain prediction and protein association network analysis indicated the possible involvement of tox genes in the toxoflavin biosynthesis. As per our knowledge, this is the first report in India on characterization of tox genes cluster in B. glumae . Altogether, our study unravels a reliable method for identifying and characterizing B. glumae using tox genes and its relationship with disease production., Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03660-6., Competing Interests: Conflict of interestThe authors declare no conflict of interest/competing interests., (© King Abdulaziz City for Science and Technology 2023. Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.)

Ectopic fat deposition is more strongly associated with obesity-related health problems including type 2 diabetes mellitus (T2DM), cardiovascular diseases (CVD), hypothyroidism, arthritis, etc. Our study aimed at identifying the cumulative role of several risk factors in developing obesity and the role of ectopic fat (visceral fat) in predicting cardiovascular disease risk in varied age groups among urban adult academic professionals in West Bengal. 650 adults (Male = 456; Female = 194) associated with the academic job (age 20-65 years) in urban West Bengal were randomly selected for anthropometric, blood biochemical, and questionnaire-based analyses. Body Mass Index and Visceral Fat% exhibited comparable association with all the other anthropometric parameters (e.g. Whole body Subcutaneous fat%: male-Linear Regression Comparison: F = 11.68; P < 0.001; female-F = 6.11; P < 0.01). Therefore, VF% acts as a risk factor alongside BMI in instances where BMI fails alone. The presence of T2DM, hypertension, and hypothyroidism in the case groups confirmed their obesity-associated longitudinal pattern of inheritance. Unhealthy diet pattern indicates improper liver function, vitamin D deficiency, and increased erythrocytic inflammation. An overall sedentary lifestyle with parental history of obesity was found to be significant in the longitudinal transmission of the disease., (© 2023. The Author(s).)

Cold-induced sweetening (CIS) is an unwanted physiological phenomenon in which reducing sugars (RS) get accumulated in potato ( Solanum tuberosum ) upon cold storage. High RS content makes potato commercially unsuitable for processing due to the unacceptable brown color in processed products like chips, fries, etc., and the production of a potential carcinogen, acrylamide. UDP-glucose pyrophosphorylase (UGPase) catalyzes the synthesis of UDP-glucose towards the synthesis of sucrose and is also involved in the regulation of CIS in potato. The objective of the present work was RNAi-mediated downregulation of the StUGPase expression level in potato for the development of CIS tolerant potato. Hairpin RNA (hpRNA) gene construct was developed by placing UGPase cDNA fragment in sense and antisense orientation intervened by GBSS intron. Internodal stem explants ( cv. Kufri Chipsona-4) were transformed with hpRNA gene construct, and 22 transgenic lines were obtained by PCR screening of putative transformants. Four transgenic lines showed the highest level of RS content reduction following 30 days of cold storage, with reductions in sucrose and RS (glucose & fructose) levels of up to 46% and 57.5%, respectively. Cold stored transgenic potato of these four lines produced acceptable chip colour upon processing. The selected transgenic lines carried two to five copies of the transgene. Northern hybridization revealed an accumulation of siRNA with a concomitant decrease in the StUGPase transcript level in these selected transgenic lines. The present work demonstrates the efficacy of StUGPase silencing in controlling CIS in potato, and the strategy can be employed for the development of CIS tolerant potato varieties., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Jaiswal, Paul, Raman, Tyagi, Saakre, Tilgam, Bhattacharjee, Vijayan, Mondal, Sreevathsa and Pattanayak.)

Xanthomonas oryzae pv. oryzae (Xoo) is a destructive pathogen that causes bacterial blight disease of rice worldwide. Xoo uses T3SS (type III secretion system) effectors to subvert rice innate immunity. However, the comprehensive knowledge of rice genes involved in T3SS effectors-mediated interaction remains unclear. In this study, the transcriptome profiles of rice infected with a virulent Xoo strain from North-eastern region of India relatives to its avirulent strain (that lacks functional T3SS) were analyzed at early (2-6 hpi) and late (16-24 hpi) hours of infection. Out of total 255 differentially expressed genes (DEGs), during early infection, 62 and 70 genes were upregulated and downregulated, respectively. At late infection, 70 and 53 genes were upregulated and downregulated, respectively. The transcriptomic data identified many differentially expressed resistant genes, transposons, transcription factors, serine/threonine protein kinase, cytochrome P450 and peroxidase genes that are involved in plant defense. Pathway analysis revealed that these DEGs are involved in hormone signaling, plant defense, cellular metabolism, growth and development processes. DEGs associated with plant defense were also validated through quantitative real-time PCR. Our study brings a comprehensive picture of the rice genes that are being differentially expressed during bacterial blight infection. Nevertheless, the DEG-associated pathways would provide sensible targets for developing resistance to bacterial blight., Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-022-03193-4., Competing Interests: Conflict of interestOn behalf of all authors, the corresponding author states that there is no conflict of interest., (© King Abdulaziz City for Science and Technology 2022.)

The pandemic COVID-19 outbreak has been caused due to SARS-CoV-2 pathogen, resulting in millions of infections and deaths worldwide, the United States being on top at the present moment. The long, complex orf1ab polyproteins of SARS-CoV-2 play an important role in viral RNA synthesis. To assess the impact of mutations in this important domain, we analyzed 1134 complete protein sequences of the orf1ab polyprotein from the NCBI virus database from affected patients across various states of the United States from December 2019 to 25 April 2020. Multiple sequence alignment using Clustal Omega followed by statistical significance was calculated. Four significant mutations T265I (nsp 2), P4715L (nsp 12), and P5828L and Y5865C (both at nsp 13) were identified in important nonstructural proteins, which function either as replicase or helicase. A comparative analysis shows 265 T→I, 5828 P→L, and 5865Y→C are unique to the United States and not reported from Europe or Asia; while one, 4715 P→L is predominant in both Europe and the United States. Mutational changes in amino acids are predicted to alter the structure and function of the corresponding proteins, thereby, it is imperative to consider the mutational spectra while designing new antiviral therapeutics targeting viral orf1ab., (© 2020 Wiley Periodicals LLC.)

Xanthomonas axonopodis pv. punicae (Xap), the bacterial blight pathogen of pomegranate, incurs substantial loss to yield and reduces export quality of this economically important fruit crop. During infection, the bacterium secretes six non-TAL (Xop) effectors into the pomegranate cells through a specialized type three secretion system (T3SS). Previously, we demonstrated the role of two key effectors, XopL and XopN in pathogenesis. Here, we investigate the role of rest effectors (XopC2, XopE1, XopQ and XopZ) on disease development. We generated null mutants for each individual effector and mutant bacterial suspension was infiltrated into pomegranate leaves. Compared to Xap wild, the mutant bacterial growth was reduced by 2.7-11.5 folds. The mutants produced lesser water-soaked lesions when infiltrated on leaves by 1.13-2.21 folds. Among the four effectors, XopC2 contributes highest for in planta bacterial growth and disease development. XopC2 efficiently suppressed the defense responses like callose deposition, reactive oxygen species (ROS) and the activation of immune responsive genes. Being a major contributor, we further characterize XopC2 for its subcellular localization, its protein structure and networking. XopC2 is localized to the plasma membrane of Nicotiana benthamiana like XopL and XopN. XopC2 is a 661 amino acids protein having 15 alpha and 17 beta helix. Our STRING and I-TASSER based analysis hinted that XopC2 interacts with multiple membrane localized plant proteins including transcription regulator of CCR4-NOT family, TTN of maintenance of chromosome family and serine/threonine-protein phosphatase 2A (PP2A) isoform. Based on the interaction it is predicted that XopC2 might involve in diverse functions like nuclear-transcribed mRNA catabolic process, maintenance of chromosome, hormone signaling and protein dephosphorylation activities and thereby suppress the plant immunity. Altogether, our study suggests that Xap largely depends on three non-TAL (Xop) effectors, including XopC2, XopL and XopN, to modulate pomegranate PTI for its unrestricted proliferation during bacterial blight development., (Copyright © 2020 Elsevier GmbH. All rights reserved.)

Human hair is considered as a potential biowaste worldwide, and improper disposal of hair can create multiple environmental problems. Due to unique characteristic features, human waste hair can be efficiently utilized for versatile applications, from agricultural industries to fashion industries. There is a huge business of human hair in many multinational countries and also in some rural areas of India. The continuous demand of such keratinous waste for human need in turn is producing residual waste at an alarming rate that causes environmental degradation. Therefore, our study aims to investigate the possible impacts of waste hair reprocessing activity on environmental health in rural India, citing examples from Radhapur village. Physico-chemical parameters of pond water and soil from the dumpsite were assessed. Along with this, elemental profile of waste hair, pond water and soil was estimated. To assess the deterioration of water quality, zooplankton diversity was also measured. Water quality index showed that the studied ponds are unsuitable for drinking purpose and aquaculture. The Shannon index further indicated comparatively lower diversity of zooplankton community in the studied ponds. Due to the presence of total organic carbon and available N-P-K, the soil can sustain the growth and survival of plants; however, the risk of toxic metal accumulation may be persisted. Hence, to enhance the utilization of waste hair in a large scale, a policy framework is extremely required that will incorporate environmental and social well-being and provide necessary support towards sustainable development. Future study needs to be carried out to eliminate the toxic elements from the water and soil using some phytoremediation strategies.

Xanthomonas oryzae pv. oryzae , the causal bacterium of bacterial blight limits rice production globally. Currently, genome sequences for only a few X. oryzae pv. oryzae isolates are available from India. Based on the next-generation sequencing and single-molecule sequencing in real-time technologies, we present here the complete genome sequence of X. oryzae pv. oryzae race 4, a highly virulent member of the Indian X. oryzae pv. oryzae population that has been extensively used in different research studies. The genome data will contribute to our understanding of X. oryzae pv. oryzae genomic features and pave the way for research on rice- X. oryzae pv. oryzae interactions.

Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight disease that limits the rice production globally. The bacterium secretes effector proteins directly into plant cells through a type III secretion system (T3SS). Here, we examined the role of a conserved XopR T3SS-effector in the suppression of host basal defense response. Phylogenetic and sequence analysis showed that XopR is well conserved within Xoo strains but shares varying degree of similarity among the other Xanthomonas species. The expression of XopR was shown to be regulated by hrpX , a key regulator of hrp cluster. For functional analysis we employed two mutant strains of Xoo, one lacks xopR gene and other lacks hrpX gene (making the strain defective in T3SS). Programmed cell death (PCD) events was examined both in rice and tobacco leaves through trypan blue staining method. In XopR expressing tobacco leaves the PCD induction was compromised. We observed higher PCD on rice leaves inoculated with Xoo mutants lacking either xopR or functional T3SS as compared to wild type. Contrary, when xopR gene was complemented in mutated strain the PCD was suppressed which clearly suggests that XopR acts as suppressor of the PCD mediated defense response. The EYFP::XopR fusion protein was shown to be localized to the plasma membrane of Nicotiana benthamiana and onion epidermal cells. Altogether our study leads to the understanding that XopR T3SS-effector is essential for Xoo to suppress PCD, primarily to support the in planta colonization of Xoo during blight pathogenesis., Competing Interests: Conflict of interestOn behalf of all authors, the corresponding author states that there is no conflict of interest.

Xanthomonas oryzae pv. oryzae (Xoo) causing bacterial blight of rice is a global problem in rice production. Phytopathogenic Xanthomonads overpower PAMP-triggered immunity (PTI) through secreting effectors via type III secretion system (TTSS). We previously screened the TTSS effector repository of an Indian strain of Xoo (race 4), a predominant strain from north-west India that contains 21 Xop and 18 TALE effectors. Here, we demonstrate that Xoo race 4 employs XopR for in planta colonisation, virulence and for the suppression of cell wall-associated immune responses in its natural host. XopR null mutant (Xoo ΔxopR) produced 2.6-fold less-severe lesion as compared with Xoo wild type. Xoo ΔxopR showed 1.58-fold reduced colonisation compared with wild indicating that XopR is required for maximum colonisation in rice. Xoo ΔxopR produced 3.8-fold more callose deposits compared with wild. Xoo ΔxopR caused significantly higher production of ROS in rice. RT-qPCR expression analysis of immune responsive genes of rice indicated 10- to 43-fold upregulation upon challenged inoculation with Xoo ΔxopR over wild. Altogether, our study revealed that XopR of Indian Xoo strain supports its in planta growth and contributes immensely for successful blight development through suppressing defence related events like reactive oxygen species production, callose deposition and transcript abundance of immune responsive genes during rice::Xoo interaction.

Xanthomonas axonopodis pv. punicae (Xap) causing bacterial blight is an important pathogen that incurs significant losses to the exportability of pomegranate. Xap uses the Xop TTSS-effector, via the type three secretion system, to suppress pomegranate immunity. Here, we investigate the role of XopL during blight pathogenesis. We observed that XopL is essential for its in planta growth and full virulence. Leaves inoculated with Xap ΔxopL produced restricted water-soaked lesions compared to those inoculated with wild-type Xap. XopL supports Xap for its sustained multiplication in pomegranate by suppressing the plant cell death (PCD) event. We further demonstrated that XopL suppresses immune responses, such as callose deposition and production of reactive oxygen species (ROS). RT-qPCR analysis revealed that immune responsive genes were upregulated when challenged with Xap ΔxopL, whereas upregulation of such genes was compromised in the complemented strain containing the xopL gene. The transiently expressed XopL::EYFP fusion protein was localized to the plasma membrane, indicating the possible site of its action. Altogether, this study highlights that XopL is an important TTSS-effector of Xap that suppresses plant immune responses, including PCD, presumably to support the multiplication of Xap for a sufficient time-period during blight disease development., (© 2017 Institute of Botany, Chinese Academy of Sciences.)

Bacterial blight caused by Xanthomonas axonopodis pv. punicae (Xap) is a major disease of pomegranate. Xap secretes effector proteins via type III secretion system (T3SS) to suppress pathogen-associated molecular pattern (PAMP)-triggered plant immunity (PTI). Previously we reported that XopN, a conserved effector of Xap, modulate in planta bacterial growth, and blight disease. In continuation to that here we report the deletion of XopN from Xap caused higher accumulation of reactive oxygen species (ROS) including H 2 O 2 and O 2 - . We quantitatively assessed the higher accumulation of H 2 O 2 in pomegranate leaves infiltrated with Xap ΔxopN compared to Xap wild-type. We analysed that 1.5 to 3.3 fold increase in transcript expression of ROS and flg22-inducible genes, namely FRK1, GST1, WRKY29, PR1, PR2 and PR5 in Arabidopsis when challenged with Xap ΔxopN; contrary, the up-regulation of all the genes were compromised when challenged with either Xap wild-type or Xap ΔxopN+xopN. Further, we demonstrated the plasma-membrane based localization of XopN protein both in its natural and experimental hosts. All together, the present study suggested that XopN-T3SS effector of Xap gets localized in the plasma membrane and suppresses ROS-mediated early defense responses during blight pathogenesis in pomegranate., (Copyright © 2016 Elsevier GmbH. All rights reserved.)

Basmati rice is preferred internationally because of its appealing taste, mouth feel and aroma. Pusa Basmati 1121 (PB1121) is a widely grown variety known for its excellent grain and cooking quality in the international and domestic market. It contributes approximately USD 3 billion to India's forex earning annually by being the most traded variety. However, PB1121 is highly susceptible to bacterial blight (BB) disease. A novel BB resistance gene Xa38 was incorporated in PB1121 from donor parent PR114-Xa38 using a modified marker-assisted backcross breeding (MABB) scheme. Phenotypic selection prior to background selection was instrumental in identifying the novel recombinants with maximum recovery of recurrent parent phenome. The strategy was effective in delimiting the linkage drag to <0.5 mb upstream and <1.9 mb downstream of Xa38 with recurrent parent genome recovery upto 96.9% in the developed NILs. The NILs of PB1121 carrying Xa38 were compared with PB1121 NILs carrying xa13 + Xa21 (developed earlier in our lab) for their resistance to BB. Both NILs showed resistance against the Xoo races 1, 2, 3 and 6. Additionally, Xa38 also resisted Xoo race 5 to which xa13 + Xa21 was susceptible. The PB1121 NILs carrying Xa38 gene will provide effective control of BB in the Basmati growing region.

Marker assisted backcross breeding was employed to incorporate the blast resistance genes, Pi2 and Pi54 and bacterial blight (BB) resistance genes xa13 and Xa21 into the genetic background of Pusa Basmati 1121 (PB1121) and Pusa Basmati 6. Foreground selection for target gene(s) was followed by arduous phenotypic and background selection which fast-tracked the recovery of recurrent parent genome (RPG) to an extent of 95.8% in one of the near-isogenic lines (NILs) namely, Pusa 1728-23-33-31-56, which also showed high degree of resemblance to recurrent parent, PB6 in phenotype. The phenotypic selection prior to background selection provided an additional opportunity for identifying the novel recombinants viz., Pusa 1884-9-12-14 and Pusa 1884-3-9-175, superior to parental lines in terms of early maturity, higher yield and improved quality parameters. There was no significant difference between the RPG recovery estimated based on SSR or SNP markers, however, the panel of SNPs markers was considered as the better choice for background selection as it provided better genome coverage and included SNPs in the genic regions. Multi-location evaluation of NILs depicted their stable and high mean performance in comparison to the respective recurrent parents. The Pi2+Pi54 carrying NILs were effective in combating a pan-India panel of Magnaporthe oryzae isolates with high level of field resistance in northern, eastern and southern parts of India. Alongside, the PB1121-NILs and PB6-NILs carrying BB resistance genes xa13+Xa21 were resistant against Xanthomonas oryzae pv. oryzae races of north-western, southern and eastern parts of the country. Three of NILs developed in this study, have been promoted to final stage of testing during the ​Kharif 2015 in the Indian National Basmati Trial., (Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.)

Aims: This study compared the effectiveness of prophylactic administration of topical flurbiprofen 0.03% and nepafenac 0.1% in maintaining mydriasis during small incision cataract surgery (SICS)., Materials and Methods: This study was a prospective, randomized, double-blind comparative study in adult cataract patients given topical flurbiprofen or nepafenac prior to SICS and capsular bag intraocular lens (IOL) implantation at a tertiary care hospital. Horizontal and vertical diameters of pupil were measured at the beginning and end of surgery, and the mean values were compared across the two groups. Unpaired t-test and Fisher's exact test were used to analyse the results., Results: A total of 70 eyes of cataract surgery patients, 33 males and 37 females, with a mean age of 58.5 ± 11.24 years, were included in the study. The mean horizontal and vertical diameters of the two groups were similar at the start of surgery. Significant differences were seen after IOL implantation, with the nepafenac group having the larger mean diameters in both horizontal (P = 0.03) and vertical (P = 0.04) pupillary measurements., Conclusions: Topical nepafenac has been shown to be a more effective inhibitor of meiosis during SICS and provides a more stable mydriatic effect compared to topical flurbiprofen.

Objectives: To determine the aqueous and plasma concentrations of moxifloxacin administered topically alone and with flurbiprofen in patients undergoing cataract surgery., Materials and Methods: A total of 50 subjects scheduled for routine cataract surgery were randomly allocated to two groups (n = 25 each). Group-1 patients were treated with topical moxifloxacin alone: One drop 6 times/day for 3 days before surgery and one drop 4 times on the day of surgery: Group-2 patients were treated with topical moxifloxacin as in Group-1 and with topical flurbiprofen: One drop 4 times/day for 3 days before and on the day of surgery. The interval between two drugs was 30 min for last 3 days and 15 min on the day of surgery. Last dose was administered 1 h before aqueous humor and blood sampling for both the groups. The antibiotic concentration in aqueous humor and plasma were determined by using high performance liquid chromatography., Results: The mean concentration of moxifloxacin in aqueous humor was 1.71 ± 0.82 mg/ml in Group-1 and 2.39 ± 1.34 mg/ml in Group-2. Concentrations of moxifloxacin in aqueous humor were significantly higher in Group-2 than that of Group-1., Conclusion: Flurbiprofen may increase the concentration of moxifloxacin in aqueous humor.

Scopulariopsis brevicaulis is a saprophytic fungus, found in soil. It causes human nail infection. Corneal ulcer with this organism is unusual. Here a case of a 36-year-old farmer is reported who developed a paracentral corneal ulcer in the right eye. The ulcer was caused by mixed infection with Staphylococcus aureus and Scopulariopsis brevicaulis. It was treated with topical natamycin 5% and moxifloxacin 0.5% drops. This is a unique case of corneal ulcer with mixed infection of Staphylococcus aureus and Scopulariopsis brevicaulis without any history of trauma, which was treated successfully, resulting in a minimal corneal opacity.

Purpose: To evaluate whether transformation of the naso-lacrimal passage as happens after dacryocystorhinostomy (DCR) operation has any effect on the systemic adverse effects of topically administered timolol maleate., Materials and Methods: Fifty otherwise healthy adult patients without any prior history of cardiac or pulmonary problems scheduled for elective DCR surgery received a drop of timolol maleate 0.5% on the healthy eye. This eye served as a control. Six weeks after successful DCR surgery, the operated eye received the same medication. Parameters compared included intraocular pressure (IOP), pulse rate, blood pressure and forced expiratory volume in the first second (FEV1) findings., Observations: Post DCR patients showed an increased incidence of reduced pulse rate and FEV1., Conclusion: Timolol maleate ophthalmic preparation should be used with caution in post-DCR patients.

Introduction: Corneal ulcers are the second most-common cause of preventable blindness after cataract in tropical developing countries. Fungal corneal ulcers constitute 30 to 62 % of the total microbial culture-positive corneal ulcers., Objective: To study the epidemiological characteristics, risk factors and laboratory diagnosis of fungal corneal ulcer in the Sundarban Region, West Bengal, eastern India., Materials and Methods: A retrospective review of 399 culture-positive, fungal corneal ulcers out of a total 928 corneal ulcer patients attending a tertiary care hospital in Kolkata,eastern India, over a period of four years from February 2007 to January 2011., Results: Males (246; 61.65 %) were more commonly affected than females (P less than .0001).The affected people were mostly (342; 85.71 %) residing in the rural areas (P less than .0001). 196 patients (49.12 %) were involved in agricultural activities (P less than .0001). The younger people of, 21 - 50 years of age, were particularly prone to this disease (269; 67.41 %). Corneal trauma (354; 88.72 %) was the commonest risk factor (P less than .0001) and 261 patients (61.41 %) had a history of trauma with vegetative matter (P less than .0001). The use of topical corticosteroids was implicated in 65 (16.29 %) cases. The incidence of the disease was highest in the monsoon season, between June to September (192; 48.12 %). The aspergillus spp was the most common fungal growth (151; 37.84 %), followed by an Fusarium spp (81; 20.3 %)., Conclusion: The fungal corneal ulcers are an important cause of ocular morbidity in people residing in the Sundarban Region. The identification of the etiology and the predisposing factors of corneal ulcers in this region are important for the prevention and early treatment of the disease., (© NEPjOPH.)

Fruit rot disease (FRD), an emerging problem of tinda (Praecitrullus fistulosus) in India. FRD epidemics begin during rainy and warm weather and often spoil marketable produce. Symptoms appear as numerous, pale brown-to-dark brown, deeply penetrating circular soft rot lesions on fleshy fruit tissues. Noneffervescent bacterial exudates occasionally form on lesions. Repeated isolations from FRD-affected tinda fruits consistently yielded the same bacterial species. Inoculation of the isolated bacterium into asymptomatic tinda fruits produced identical soft rot symptoms. Fruits were inoculated with the isolate ITCC B0030 (0.1 OD) by removing a 2.0-cm deep tissue plug with a sterile cork borer (5 mm in diameter) and injecting the inoculum with a syringe in the cylindrical cavity. After inoculation, the plug (upper 5 mm) was reinserted, sealed with sterile paraffin, and covered with a small piece of wet absorbent cotton to prevent dehydration. High humidity (>90%) and 30 to 33°C temperature was maintained after inoculation in a glasshouse. After 4 to 10 days, fruits showed FRD symptoms. The reisolated bacterium from artificially inoculated symptomatic fruits was identical with the original inoculated bacterium. Identity of the bacterial pathogen for FRD was confirmed by phenotypic and genotypic methods. The causal bacterium was a gram-negative, non-sporing motile rod with a single polar flagellum. The bacterium produced yellowish green and blue-green diffusible pigments on King's B (KB) medium. On yeast dextrose calcium carbonate agar at 30°C, the colonies produced abundant, blue, diffusible pigment within 48 h. The bacterium grew at temperatures up to 42°C but not at 4°C. Excellent growth occurred on Salmonella-Shigella agar and MaConkey's medium, as reported also for Pseudomonas aeruginosa strain P8. The bacterium produced ammonia, hydrogen sulfide, arginine dihydrolase, urease, lipase, catalase, gelatinase, and casinase but not amylase, indole, or acetyl methyl carbinol. The bacterium was identified as P. aeruginosa using Biolog based Bacterial Identification System version 4.2 (Biolog Inc., Hayward, CA). The bacterium did not utilize cellobiose, dulcitol, maltose, sorbitol, sucrose, arabinose, and starch. Upon infiltration on tobacco leaves (Nicotiana tabacum cv. Xanthi) at 10 7 or more cells ml -1 , the bacterium gave a strong hypersensitive reaction within 24 h. Transmission electron micrographs (TEM, KYKY 1000B, Japan) of the causal bacterium revealed a single, polar flagellum. Identity was further confirmed as P. aeruginosa based on 16S rRNA sequence (1,491 nt) analysis with universal primers F1 (5'-GAGTTTGATCCTGGCTCAG-3') and R13 (5'-AGAAAGGAGGTGATCCAGCC-3'). A blastN search of GenBank revealed a >99% nt identity with P. aeruginosa strain TAUC 7 (HQ914782). The 16S rRNA gene sequence (1,491 nt) was deposited in Bankit GenBank (JF797204). To our knowledge, this is the first report of fruit rot of tinda caused by P. aeruginosa in India (ITCC B0030) and a new record of bacterial rot of Praecitrullus fistulosus induced by a fluorescent and blue-green pigment producing P. aeruginosa. To date, P. syringae pv. lachrymans and a nonfluorescent P. pseudoalcaligenes subsp. citrulli were reported to infect Citrullus lanata (1) and Praecitrullus fistulosus (2), respectively. References: (1) D. L. Hopkins and N. C. Schenck. Phytopathology 62:542, 1972. (2) N. W. Schaad et al. Int. J. Syst. Bacteriol. 28:117, 1978.

In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 μm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5'AGAGTTTGATCATGGCTCAG3' and 5'AAGGAGGTGATCCAACCGCA3') of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 10 8 CFU ml -1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 10 8 CFU ml -1 ). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.

Prescription audit is a powerful tool for rational prescription. To evaluate pharmaco-epidemiology of drugs utilised for cataract surgery, a retrospective study was conducted in the department of pharmacology, RG Kar Medical College, Kolkata. Data from bed head tickets of one year, available in medical record section, were collected in case report forms and analysed. Utilisation pattern of drugs like dosage form, dose, route and frequency of administration and duration of therapy were audited. Drug prescription versus therapeutic indication was also evaluated. Price of the prescribed drugs was evaluated for rationality towards cost-effective prescription. For 848 cases of cataract surgery, drugs were prescribed pre-, per- and post-operatively. Different fluoroquinolone antibiotics, anti-inflammatory and mydriatic-cycloplegic agents were prescribed. High or low cost drugs were prescribed both in generic (52%) and brand (48%) names. Few Latin abbreviations were used in directions. Different parameters and study results were discussed from various aspects to explore their social impacts. Though prescription pattern was almost rational, some parts need improvement. Healthcare provider should be aware of cost-effectiveness of the prescribed drugs for the benefit of patients to provide a rational prescription.

Cortical blindness is defined as visual failure with preserved pupillary reflexes in structurally intact eyes due to bilateral lesions affecting occipital cortex. Bilateral oedema and infarction of the posterior and middle cerebral arterial territory, trauma, glioma and meningioma of the occipital cortex are the main causes of cortical blindness. Posterior reversible encephalopathy syndrome (PRES) refers to the reversible subtype of cortical blindness and is usually associated with hypertension, diabetes, immunosuppression, puerperium with or without eclampsia. Here, 3 cases of PRES with complete or partial visual recovery following treatment in 6-month follow-up are reported.

Indiscriminate use of organophosphorus compounds (OPC) increases the potential threat of self-poisoning and death. To make a conclusive diagnosis on academic interest a retrospective record-based study was undertaken. Postautopsy studies were carried out on 100 victims of OPC poisoning by collecting data from following 3 sources: Medicolegal autopsy reports, inquest reports, and inpatient case sheets. Mode of ingestion of OPC was to commit suicide. Incidence was more in 20 to 30 years age group, in females and in urban area. Diagnosis was confirmed by history of poison exposure, clinically well-defined cholinergic effects, and characteristic autopsy findings. Early and correct identification of the cause of poisoning enables specific treatment. Restrictions on access of very toxic pesticides through national policies and enforcement, public education on storage and safe use, early recognition of poisoning, and appropriate medical management may reduce the incidence of poisoning and death.

Bacterial blight caused by Xanthomonas campestris pv. punicae (Xcp) has emerged as a potential threat in pomegranate (Punica granatum) cultivation in India. Here, we report the genomic fingerprints and their correlation with virulence pattern of Xcp isolates from Maharashtra and Delhi. The genomic fingerprints of Xcp isolates were generated using enterobacterial repetitive intergenic consensus (ERIC) sequence-based primers, and virulence level was based on their reaction upon infiltration to susceptible pomegranate cultivar. Maharashtra isolate PGM1 showed only 50% similarity with Delhi isolate PGD8 forming a distinct genotype, whereas the Delhi isolates PGD5 and PGD6 form a cluster with Maharashtra isolates PGM2 and PGM4. The isolates PGM2, PGM4, PGD5, and PGD6 showing mean disease score of 7.47 were marked as group A or highly virulent. The moderately virulent or group B isolates PGM3 and PGD7 produced mean disease score of 4.19, whereas less virulent or group C isolates PGD8 and PGM1 gave mean disease intensity of 1.91. A correlation between genotypic groups based on ERIC fingerprints and pathogenicity of the isolates was established. The highly virulent isolates PGM2, PGM4, PGD5, and PGD6 formed a single cluster. A unique 900 bp amplicon present in all highly virulent isolates has been identified that can be used as genetic marker to screen isolates for virulence. The less virulent isolates PGD8 and PGM1 formed single cluster at 50% similarity coefficient. This seems to be the first report to establish a correlation between ERIC-PCR fingerprints and their corresponding virulence pattern of the pomegranate bacterial blight pathogen.

A randomised study was carried out to evaluate the efficacy of four topical medications individually and in combination to treat grade I acne vulgaris which is characterised by mild lesions (< 10 in one side of face) consisting of predominantly comedones with occasional pustules in oily skin. Maintaining the inclusion and exclusion criteria 100 patients were selected and divided into 5 groups to receive different topical drugs at random basis in the dermatology OPD. Topical medication given to them is mentioned below against each group: Group I--retinonic acid, group II--benzoyl peroxide, group III--clindamycin, group IV--cleanser and group V--all the four medications. The patients were observed for reduction in number of comedones, suppression of papulopustules with healing rate, effects on facial skin, and rate of recurrence. Results were observed according to the groups. In group I old acne was reduced in size and gradually cleared off (80%). Recurrence was few with appearance of new microcomedones which were cleared off within short time. Skin became smoother and fresh. Texture became lighter in colour. In group II whiteheads were reduced at about 70% in number. Rate of recurrence was normal. Skin became rough and dry. In group III pustular acne healed better and faster. In group IV acne of oily skin healed better and faster. Rate of recurrence was normal. Skin became fresh and oil-free. In group V reduction of lesions was very much significant (90%) with quick healing rate of the comedones. Recurrence was normal but delayed. Skin became smoother, finer and fresher. So, combination therapy is better. Cleanser is always helpful even without medications.

Anterior chamber aspirate cultures were done in 57 patients who underwent uncomplicated manual small incision cataract surgery with posterior chamber intra-ocular lens implantation. The aspirates were collected at the time of wound closures. The specimens were immediately inoculated into blood agar, chocolate agar and thioglycolate broth. The cultures were incubated at 37 degrees C with 5% CO2 and held for 5 days. Out of 57 patients 8 (14%) had culture positive anterior chamber aspirates. Coagulase negative staphylococcus was the commonest (62%). No anaerobic organism was detected. None of the eyes developed endophthalmitis. The study concluded that the strict aseptic measures, the antimicrobial property of the aqueous humour or small inoculum size could be the possible factors to prevent fulminating infection.

In India, so far not much efforts have been made to use coal ash as backfill material in underground/ open cast mines and to predict its subsequent effect on ground water quality. One of the main problems in disposing of big quantities of coal ash is the possible leaching of different pollutants, including manganese. A thorough investigation regarding leaching of manganese from different fly ashes is required to know the impact of manganese due to its leaching from fly ash to ground water as well as surface water. In the present study, short term and long term leaching studies have been carried out on fly ash, bottom ash, pond ash and weathered ash of Chandrapura thermal power plant, Bokaro, Jharkhand and Ramagundam thermal power plant, Ramagundam, Andhra Pradesh. The amount of manganese released in different experiments has been evaluated. The leachate of Chandrapura fly ash has more manganese concentration (0.2001 mg/L) than the leachate of bottom ash, pond ash and weathered ash. A field investigation at Damoda abandoned open cast mine, filled with pond ash of Chandrapura thermal power plant revealed that concentration of manganese in ground water beneath the ash filled mine has been found very high (maximum up to 6.0 mg/L). But its migration to a long distance has not been seen. Remedial measures for coal ash disposal have also been formulated.

Fly ash is an industrial waste generated from thermal power plants. Fly ash constitutes 80-85% of the total ash produced. A small part of fly ash is utilised in some sectors such as construction materials, building engineering, road, back fill, agriculture, selective engineering and processing useful materials. A large part of fly ash produced is disposed of with very high environmental risk. In the present paper, laboratory leaching test has been used to determine the potential mobility of Pb, Cd, Cr, Cu, Zn, Fe, Mn and Ni in fly ash samples, collected from Chandrapura Thermal Power Plant, Jharkhand and Ramagundam Super Thermal Power Plant, Andhra Pradesh, in order to assess their leachability when these wastes are disposed of. A cascade-leaching test was used at liquid-to-solid ratio (L/S) ranging between 20 and 100. Both fly ash samples exhibited neutral reactions, as indicated by pH values <11.75 and >7.0 at L/S=10 and contact time of 10 minutes. The percentage of leached amounts found to follow the trend Zn>Fe>Mn>Cr>Pb>Cu>Ni>Cd for fly ash from Chandrapura and Fe>Zn>Cu>Mn>Cr>Ni>Pb>Cd for fly ash from Ramagundam. Effect of pH on metals released from ash surface in aqueous solution followed a predictable pattern of decreasing release with increasing pH.

Conjunctival intra-epithelial neoplasia is a disease of the elderly but recently this ocular surface tumour has been observed in younger age group specially who are serologically human immunodeficiency virus (HIV)-positive. Here a case of conjunctival intra-epithelial neoplasia of a 38-year-old male who was HIV-positive from Kolkata is reported. The patient presented with a growth at limbus in his left eye. Excision of the mass under local anaesthesia was done. Biopsy report confirmed conjunctival intra-epithelial neoplasia. The serological tests for HIV were found positive.

Brassica juncea is an important oilseed crop of the Indian sub-continent. Yield loss due to fungal disease alternaria leaf spot caused by Alternaria brassicae is a serious problem in cultivation of this crop. Nonavailability of resistance genes within crossable germplasms of Brassica necessitates use of genetic engineering strategies to develop genetic resistance against this pathogen. The pathogenesis related (PR) proteins are group of plant proteins that are toxic to invading fungal pathogens, but are present in plant in trace amount. Thus, overexpression of PR proteins leads to increased resistance to pathogenic fungi in several crops. The PR protein glucanase hydrolyzes a major cell-wall component, glucan, of pathogenic fungi and acts as a plant defense barrier. We report the expression of a class I basic glucanase gene, under the control of CaMV 35S promoter, in Indian mustard and its genetic resistance against alternaria leaf spot. Southern and Northern hybridization confirmed stable integration and expression of the glucanase gene in mustard transgenics. Several independent transgenics were screened in vitro and under poly house conditions for their resistance against Alternaria brassicae. In an in vitro antifungal assay, transgenics arrested hyphal growth of Alternaria brassicae by 15-54%. Under pathogen-challenged conditions in poly house, the transgenics showed restricted number, size and spread of lesions caused by Alternaria brassicae. Also, the onset of disease was delayed in transgenics compared to untransformed parent plants. The results demonstrate potentiality of a PR protein from a heterologous source in developing alternaria leaf spot resistance in Indian mustard.

Leprosy, a chronic infectious disease caused by Mycobacterium leprae, affects peripheral nerves and skin. Eye is also frequently affected, partial or total loss of vision is especially tragic in leprosy. But ocular leprosy is still neglected by the leprosy workers due to lack of knowledge, and is also often overlooked even by the ophthalmologists. Here, an update review of ocular leprosy has been attempted regarding its epidemiology, clinical features, pathology, management and prevention under one umbrella.

Chitinase, capable of degrading the cell walls of invading phytopathogenic fungi, plays an important role in plant defense response, particularly when this enzyme is overexpressed through genetic engineering. In the present study, Brassica plant (Brassica juncea L.) was transformed with chitinase gene tagged with an overexpressing promoter 35 S CaMV. The putative transgenics were assayed for their inhibitory activity against Alternaria brassicae, the inducer of Alternaria leaf spot of Brassica both in vitro and under polyhouse conditions. In in vitro fungal growth inhibition assays, chitinase inhibited the fungal colony size by 12-56% over the non-trangenic control. The bioassay under artificial epiphytotic conditions revealed the delay in the onset of disease as well as reduced lesion number and size in 35S-chitinase Brassica as compared to the untransformed control plants.

In the temperate regions of India, buckwheat (Fagopyrum esculentum Moench and F. tataricum Gaertn.) is produced extensively. During the first week of June in 2001 and 2002, a severe incidence of root rot (35% seedling mortality) was observed in the Sangla Valley of Himachal Pradesh when the crop was at the seedling stage. The disease was more severe on F. tataricum, resulting in a poor crop stand. The disease appeared as water-soaked areas on the upper portion of the root, which turned brown. The brown patches gradually proceeded downward covering the whole root system. The above ground foliage wilted and died. The disease spread rapidly with cloudy, humid weather and day temperatures ranging from 15 to 20°C. Mycelium of the causal fungus was inter- and intracellular type with hyaline, branched, and septate hyphae. Sclerotia were pink but later turned black, measuring 3.0 to 3.5 mm in diameter. The pathogenicity of the causal fungus was proved following Koch's postulates. The pathogen was identified as Sclerotinia sclerotiorum (Lib.) de Bary (2). In Japan, the association of S. libertiana on buckwheat has been reported (1). To our knowledge, this is the first report of Sclerotinia root rot on buckwheat from India. References: (1) H. Singh and T. A. Thomas. Indian Counc. Agric. Res. New Delhi, India, 1978. (2) H. J. Willets and J. A. L. Wong, Bot. Rev. 46:101,1980.

A retrospective study was done at the Leprosy Control Unit (LCU) in Durgapur of Burdwan district, West Bengal, to determine the relapse rate following multidrug therapy (MDT). A total of 1581 patients (1276 PB and 305 MB) completed MDT regimens during a period of 5 years as per WHO recommendations and National Leprosy Eradication Programme (NLEP) guidelines. The treated patients were kept under surveillance as per NLEP guidelines and searched for relapses. The results of MDT were compared with those of pre-MDT (monotherapy) era at the same centre (total: 405 patients; PB-373, MB-32) and also with those of the Leprosy Clinic in Gopalpur (only dapsone was given to a total of 189 patients, PB-167, MB-22). Following monotherapy, the relapse rate was 10.06% at the Gopalpur Leprosy Clinic and 12.4% at the Durgapur LCU during the 2 years (PB) and 5 years (MB) of surveillance, whereas following MDT no relapse case was encountered both in PB and MB cases during the surveillance periods recommended by WHO. The results of this study are comparable with those of other studies. Though a few studies showed relapses during long-term surveillance beyond the periods recommended by WHO, it is once again established that MDT can prevent relapse in leprosy.

The linear and nonlinear propagation of dust-acoustic waves in a dusty plasma bounded in finite geometry has been theoretically investigated. It is found that the finite geometry of the bounded plasma makes a significant contribution to the instability of the wave. Moreover, the pseudopotential has a positive and inverted profile that prevents the trapping of particles and does not favor solitary waves in bounded dusty plasma.

Four major phenolics were demonstrated to be produced by Pseudomonas fluorescens strain CRb-26, a cotton rhizobacterium antagonistic to Xanthomonas camprestris pv. malvacearum (Xcm), the inducer of bacterial blight of cotton. Of these, compounds II (nonfluorescent) and IV(fluorescent) completely inhibited the growth of Xcm in vitro. Among these, compound IV was produced maximally (39% of the four phenolics), and it protected cotton leaves from blight infection better than compound II under glass-house conditions. Compound IV, identified as 2,4-diacetylphloroglucinol, was, therefore, concluded to be a key metabolite involved in disease suppression by strain CRb-26 of P. fluorescens, which could be used as an ecofriendly potential input in the integrated management of bacterial blight of cotton.