Search

Polyploidisation is an important feature of species evolution in plant, animal and fungal kingdoms. Many researches proved polyploid organisms outperform their diploid relatives in several aspects. Thus, many plant breeders in the last century practised induced and/or used natural polyploids to obtain improved plant cultivars. Fresh samples of A. malaccensis tetraploid contain higher amount of important agarwood sesquiterpenes compared with diploid counterparts. In this study, an investigation on the presence of important agarwood sesuiterpenes in hydrosol and residual water in diploid and tetraploid A. malaccensis was carried out. Three controls were used, namely, diploid seedlings grown in soil, diploid seedlings grown under control conditions (in vitro) and tissue culture-derived shoots of diploid for comparison with tetraploid A. malaccensis. Results showed that hydrosol water from tetraploid leaf and root samples contained the highest amount of important agarwood sesquiterpenes, i.e. 30.92 and 36.83% respectively. In residual water, the tetraploid A. malaccensis contained the highest amount of important agarwood sesquiterpenes in root sample (49.1%). This article showed that polyploidy can be used as a tool to enhance the presence of important agarwood sesquiterpenes in A. malaccensis.

Excised cotyledons of tomato (Lycopersicon esculentum Mill cv. MT11) were cultured on selective medium containing kanamycin at various concentrations (50, 100, 200, 300 mg/L). Significant toxic effects were observed when the cotyledon explants were grown on MS medium supplemented with 5mg/L kinetin and 100 mg/L kanamycin. The regeneration of callus was decreased as the concentration of kanamycin increased from 200 to 300 mg/L. Explants grown on MS medium supplemented with 5mg/L kinetin and 50 mg/L kanamycin showed the least toxic effects (mean survival rate 48.0% ± 0.19) compared to the rest of the concentrations tested. Even though 100 mg/L of kanamycin allows the non-transformed explants to grow on the medium, the shoot primordia would not develop further.The result suggests that 100 mg/L of kanamycin can be used effectively to differentiate between non-transformed and transformed MT11 tomato explants with a death rate of more than 82% of non-transformed explants, after 4 weeks of incubation on selection medium. Therefore, 100 mg/L kanamycin is suitable for minimal inhibition concentration for MT11 and true transformants can be selected at this concentration for the transformation system.

Paphiopedilum rothschildianum is an endangered orchid species endemic to Mount Kinabalu, Sabah, and Malaysia. The vegetative propagation of this plant has always been restricted due to its slow growth and maturation rates. Thus, an in vitro tissue culture technique was explored in order to overcome this limitation. In this study, clonal propagation of P. rothschildianum was achieved through in vitro formation of multiple shoots from stem nodal and single shoot explants cultured onto halfstrength Murashige and Skoog medium. The responses of the explants to the presence of different types of organic nitrogen additives viz. casein hydrolysate, peptone and tryptone-peptone (in amount of 0.5, 1.0 and 2.0 g/l) in the culture medium were also evaluated. The addition of these organic nitrogen additives into the basal medium slightly enhanced the number of multiple shoots formed on both types of explants when compared to additive-free MS medium. After 16 weeks of culture, an average of 2.9 shoots per stem nodal explant and 2.8 shoots per single shoot explant were obtained on half-strength MS medium supplemented with 1.0 g/l peptone and 2.0 g/l tryptone-peptone, respectively. All the newly-formed shoots were divided into single plantlets and subcultured onto similar respective medium. After an additional 12 weeks of culture on the same medium, plantlets with 3 - 4 roots were acclimatized and transferred to a glass house where they showed 90% survival rate. Thus, the method presented in this study had provided a promising strategy for the production of large numbers of phenotypically stable P. rothschildianum.

Hairy roots of Solenostemon scutellarioides were induced by inoculation of leaf explants with Agrobacterium rhizogenes strains TR 105, LBA 9402, 8196 and ATCC 15834. These strains showed different abilities to induce hairy root formation on the leaf explants. Assessment of the plant’s susceptibility to the different strains of A. rhizogenes showed that strains ATCC 15834, TR 105, LBA 9402, and 8196 produced 56.3, 25.5, 21.5 and 13.8% transformation efficiencies, respectively. Acetosyringone was found to be useful for the enhancement of hairy roots formation in S. scutellarioides.

The Kedah Kelantan, which is a Bos indicus breed, is the indigenous cattle of Malaysia. Mitochondrial DNA displacement loop (D-loop) region is often used to analyze the phylogeny of closely related breeds within species. Variations that occur in this region can be used as genetic markers for mtDNA. The objective of this study was to evaluate the genetic variability in the mitochondrial D-loop region in the Kedah Kelantan cattle. DNA was extracted from the blood of 30 Kedah Kelantan cattle. The D-loop region was amplified using polymerase chain reaction (PCR) and the primers 5’ CCCAAAGCTGAAGTTCTATT 3’ (forward) and 5’ TTGGGTTAAGCTACATCAAC 3’ (reverse). The size of the amplified PCR product was 964 bp. The PCR product was then digested with six restriction endonucleases (RE): ApaI, BstXI, TaqI, BamHI, DdeI and HinfI. Three fragments were detected using Dde I and the rest of the RE produced two fragments each. No polymorphism was revealed for all six RE. The results indicated no variation in the D-loop region of the Kedah Kelantan cattle as far as these six RE were concerned.

Teak Inflorescence Shoot Stage 4 (TIS4) shoots bearing the floral meristems were used to construct a cDNA librariy with insert size range of 1500 - 5000 bp. The titer of the library was 7.5 x 105 pfu/ml (primary) and 4.5 x 109 pfu/ml (amplified). EST generation and analysis were performed using the cDNA library where a total of 1384 plaques were randomly picked and their inserts PCR-amplified using T3 and T7 universal primers. Only 1125 plaques generated single amplified fragments, each which were purified and sequenced using the SK universal primer. The generated raw 5’ ESTs were filtered and clustered. A total of 674 nonredundants (69 consensus sequences and 605 singletons) were generated and their identities searched through BLASTX. Of the 674 nonredundants, 107 of them (15.9%) showed no hits or no identity. All the 567 nonredundants identified through BLASTX were categorized into their functional categories and were further analysed using InterProScan to detect their protein signatures and to assign their GO numbers. From all the sequences analysed, only 186 (32.8%) sequences were given the GO numbers and grouped into the three GO main categories namely biological process, cellular component and molecular function. Several important ESTs were highlighted based on their functional categories. There were five sequences found to be related to flowering and light induction.

Expression of an isolated gene in a system that directly translates it into a protein is an important step to study the protein encoded by the gene. The isolated gene can be expressed in vivo by a heterologous system. In this study, a bacteria system was used to translate the Tectona grandis Late Elongated Hypocotyl (Tg-LHY) gene, which was isolated from flowering tissues of teak (Tectona grandis). The gene was cloned into the pET 14b vector (Novagen) and transformed into BL 21(DE3)/pLysS and Rosetta 2 expression host cells (Novagen). Rosetta 2 host cell has been found to be a good candidate to express the Tg-LHY protein from plant origin, as it recognizes the codon that was found in plant but rarely used in bacteria. The expressed protein was about an expected size, which was 90 kD. Western blot analysis using antibody against His-tag, which was fused to the Tg-LHY protein, proved that the expressed protein was Tg-LHY protein.

Floral initiation of teak through molecular biology approach is being studied for better understanding of teak flower development. Through PCR subtractive hybridization method, LHY homolog gene has been isolated from teak flowering tissues. The full-length cDNA of the gene was 2948 base pair (bp) and potentially encoded for 768 amino acids. It was named Tectona grandis LHY (Tg-LHY), as the gene was similar to the LHY gene of some species. Amino acid sequence alignment revealed that Tg-LHY was similar to LHY of Castanea sativa, LHY ofPhaseolus vulgaris and LHY of Arabidopsis thaliana. The highly conserved region found in Tg-LHY was the MYB protein, which is the DNA-binding protein responsible in negative feedback loop reaction of central oscillator in plant circadian clock system. The level of gene expression was found to be high four hours after dawn in flowering shoots and flower. This paper reported the isolation and characterization of the gene.

Identification of Bifidobacterium species are a difficult task because of phenotypic and genetic heterogeneities. Various DNA-based techniques to rapidly characterise Bifidobacterium species and to support the conventional biochemical and morphological classification methods have been described. Sequencing of the 16S rRNA gene and 16S to 23S internally transcribed spacer region and comparing with the sequences data present in GenBank are the most popular techniques in identifying Bifidobacterium species. Conserved sequences other than the 16S rRNA gene such as ldh, recA and hsp60 genes have become worthy tools for the elucidation of various taxonomic features such as genera, species and strains of Bifidobacterium. However, as an alternative to sequencing which is both time consuming and technically demanding, genus- or species-specific primers or probes were successfully designed to rapidly identify Bifidobacterium species. In this review, amplified ribosomal DNA restriction analysis (ARDRA) method derived from the 16S rRNA gene is also discussed because of it rapid, reproducible and easy to handle characteristics. Furthermore, randomly amplified polymorphic DNA (RAPD), Pulsed-Field Gel Electrophoresis (PFGE) and repetitive elements fingerprinting (Rep) were the popular methods to study the genetic diversity among Bifidobacterium species due to its versatility.

The present invention related to a process for production bacteriocin from Lactobacillus plantarum. Further, it is also relates to a method for inhibiting bacteria using bacteriocin derived from Lb. plantarum according to the present invention. The bacteriocin according to the present invention can tolerate a wide range of pH from pH 2-5 and pH 7-8. Besides, bacteriocin according to the present invention is highly antagonise against Pediococcus acidilactici, Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes ect.