Search

Vaxign is the first web-based vaccine design system that predicts vaccine targets based on genome sequences using the strategy of reverse vaccinology. Predicted features in the Vaxign pipeline include protein subcellular location, transmembrane helices, adhesin probability, conservation to human and/or mouse proteins, sequence exclusion from genome(s) of nonpathogenic strain(s), and epitope binding to MHC class I and class II. The precomputed Vaxign database contains prediction of vaccine targets for >70 genomes. Vaxign also performs dynamic vaccine target prediction based on input sequences. To demonstrate the utility of this program, the vaccine candidates against uropathogenic Escherichia coli (UPEC) were predicted using Vaxign and compared with various experimental studies. Our results indicate that Vaxign is an accurate and efficient vaccine design program. [ABSTRACT FROM AUTHOR]

Urinary tract infection (UTI) is the second most common infection in humans, making it a global health priority. Nearly half of all women will experience a symptomatic UTI, with uropathogenic Escherichia coli (UPEC) being the major causative agent of the infection. Although there has been extensive research on UPEC virulence determinants, the importance of host-specific metabolism remains understudied. We report here that UPEC upregulates the expression of ethanolamine utilization genes during uncomplicated UTIs in humans. We further show that UPEC ethanolamine metabolism is required for effective bladder colonization in the mouse model of ascending UTI and is dispensable for bladder colonization in an immunocompromised mouse model of UTI. We demonstrate that although ethanolamine metabolism mutants do not show increased susceptibility to antimicrobial responses of neutrophils, this metabolic pathway is important for surviving the innate immune system during UTI. This study reveals a novel aspect of UPEC metabolism in the host and provides evidence for an underappreciated link between bacterial metabolism and the host immune response., (Copyright © 2018 American Society for Microbiology.)

Background: Tn-Seq is a high throughput technique for analysis of transposon mutant libraries to determine conditional essentiality of a gene under an experimental condition. A special feature of the Tn-seq data is that multiple mutants in a gene provides independent evidence to prioritize that gene as being essential. The existing methods do not account for this feature or rely on a high-density transposon library. Moreover, these methods are unable to accommodate complex designs., Results: The method proposed here is specifically designed for the analysis of Tn-Seq data. It utilizes two steps to estimate the conditional essentiality for each gene in the genome. First, it collects evidence of conditional essentiality for each insertion by comparing read counts of that insertion between conditions. Second, it combines insertion-level evidence for the corresponding gene. It deals with data from both low- and high-density transposon libraries and accommodates complex designs. Moreover, it is very fast to implement. The performance of the proposed method was tested on simulated data and experimental Tn-Seq data from Serratia marcescens transposon mutant library used to identify genes that contribute to fitness in a murine model of infection., Conclusion: We describe a new, efficient method for identifying conditionally essential genes in Tn-Seq experiments with high detection sensitivity and specificity. It is implemented as TnseqDiff function in R package Tnseq and can be installed from the Comprehensive R Archive Network, CRAN.

Objectives: To determine the relationship between clinically diagnosed catheter-associated urinary tract infection (CAUTI) and standardized criteria and to assess microorganism-level differences in symptom burden in a cohort of catheterized nursing home (NH) residents., Design: Post hoc analysis of a prospective longitudinal study., Setting: Twelve NHs in southeast Michigan., Participants: NH residents with indwelling urinary catheters (n = 233; 90% white, 52% male, mean age 73.7)., Measurements: Clinical and demographic data, including CAUTI epidemiology and symptoms, were obtained at study enrollment, 14 days, and monthly thereafter for up to 1 year., Results: One hundred twenty participants with an indwelling catheter (51%) were prescribed systemic antibiotics for 182 clinically diagnosed CAUTIs. Common signs and symptoms were acute change in mental status (28%), fever (21%), and leukocytosis (13%). Forty percent of clinically diagnosed CAUTIs met Loeb's minimum criteria, 32% met National Health Safety Network (NHSN) criteria, and 50% met Loeb's minimum or NHSN criteria. CAUTIs involving Staphylococcus aureus and Enterococcus spp. were least likely to meet criteria. CAUTIs involving Klebsiella pneumoniae were most likely to meet Loeb's minimum criteria (odds ratio (OR) = 9.7, 95% confidence interval (CI) = 2.3-40.3), possibly because of an association with acute change in mental status (OR = 5.9, 95% CI = 1.8-19.4)., Conclusion: Fifty percent of clinically diagnosed CAUTIs met standardized criteria, which represents an improvement in antibiotic prescribing practices. At the microorganism level, exploratory data indicate that symptom burden may differ between microorganisms. Exploration of CAUTI signs and symptoms associated with specific microorganisms may yield beneficial information to refine existing tools to guide appropriate antibiotic treatment., (© 2016, Copyright the Authors Journal compilation © 2016, The American Geriatrics Society.)

Uropathogenic Escherichia coli (UPEC) is the primary cause of uncomplicated urinary tract infections (UTIs). Whereas most infections are isolated cases, 1 in 40 women experience recurrent UTIs. The rise in antibiotic resistance has complicated the management of chronic UTIs and necessitates new preventative strategies. Currently, no UTI vaccines are approved for use in the United States, and the development of a highly effective vaccine remains elusive. Here, we have pursued a strategy for eliciting protective immunity by vaccinating with small molecules required for pathogenesis, rather than proteins or peptides. Small iron-chelating molecules called siderophores were selected as antigens to vaccinate against UTI for this vaccine strategy. These pathogen-associated stealth siderophores evade host immune defenses and enhance bacterial virulence. Previous animal studies revealed that vaccination with siderophore receptor proteins protects against UTI. The poor solubility of these integral outer-membrane proteins in aqueous solutions limits their practical utility. Because their cognate siderophores are water soluble, we hypothesized that these bacterial-derived small molecules are prime vaccine candidates. To test this hypothesis, we immunized mice with siderophores conjugated to an immunogenic carrier protein. The siderophore-protein conjugates elicited an adaptive immune response that targeted bacterial stealth siderophores and protected against UTI. Our study has identified additional antigens suitable for a multicomponent UTI vaccine and highlights the potential use of bacterial-derived small molecules as antigens in vaccine therapies., Competing Interests: The authors declare no conflict of interest.

Extraintestinal Escherichia coli (E. coli) evolved by acquisition of pathogenicity islands, phage, plasmids, and DNA segments by horizontal gene transfer. Strains are heterogeneous but virulent uropathogenic isolates more often have specific fimbriae, toxins, and iron receptors than commensal strains. One may ask whether it is the virulence factors alone that are required to establish infection. While these virulence factors clearly contribute strongly to pathogenesis, bacteria must survive by metabolizing nutrients available to them. By constructing mutants in all major metabolic pathways and co-challenging mice transurethrally with each mutant and the wild type strain, we identified which major metabolic pathways are required to infect the urinary tract. We must also ask what else is E. coli doing in vivo? To answer this question, we examined the transcriptome of E. coli CFT073 in the murine model of urinary tract infection (UTI) as well as for E. coli strains collected and analyzed directly from the urine of patients attending either a urology clinic or a university health clinic for symptoms of UTI. Using microarrays and RNA-seq, we measured in vivo gene expression for these uropathogenic E. coli strains, identifying genes upregulated during murine and human UTI. Our findings allow us to propose a new definition of bacterial virulence.

Urinary tract infections (UTIs) are a major burden to human health. The overwhelming majority of UTIs are caused by uropathogenic Escherichia coli (UPEC) strains. Unlike some pathogens, UPEC strains do not have a fixed core set of virulence and fitness factors but do have a variety of adhesins and regulatory pathways. One such UPEC adhesin is the nonfimbrial adhesin TosA, which mediates adherence to the epithelium of the upper urinary tract. The tos operon is AT rich, resides on pathogenicity island aspV, and is not expressed under laboratory conditions. Because of this, we hypothesized that tosA expression is silenced by H-NS. Lrp, based on its prominent function in the regulation of other adhesins, is also hypothesized to contribute to tos operon regulation. Using a variety of in vitro techniques, we mapped both the tos operon promoter and TosR binding sites. We have now identified TosR as a dual regulator of the tos operon, which could control the tos operon in association with H-NS and Lrp. H-NS is a negative regulator of the tos operon, and Lrp positively regulates the tos operon. Exogenous leucine also inhibits Lrp-mediated tos operon positive regulation. In addition, TosR binds to the pap operon, which encodes another important UPEC adhesin, P fimbria. Induction of TosR synthesis reduces production of P fimbria. These studies advance our knowledge of regulation of adhesin expression associated with uropathogen colonization of a host., (Copyright © 2016, American Society for Microbiology. All Rights Reserved.)

Urinary tract infection (UTI) is the second most common infection in humans after those involving the respiratory tract. This results not only in huge annual economic costs, but in decreased workforce productivity and high patient morbidity. Most infections are caused by uropathogenic Escherichia coli (UPEC). Antibiotic treatment is generally effective for eradication of the infecting strain; however, documentation of increasing antibiotic resistance, allergic reaction to certain pharmaceuticals, alteration of normal gut flora, and failure to prevent recurrent infections represent significant barriers to treatment. As a result, approaches to prevent UTI such as vaccination represent a gap that must be addressed. Our laboratory has made progress toward development of a preventive vaccine against UPEC. The long-term research goal is to prevent UTIs in women with recurrent UTIs. Our objective has been to identify the optimal combination of protective antigens for inclusion in an effective UTI vaccine, optimal adjuvant, optimal dose, and optimal route of delivery. We hypothesized that a multi-subunit vaccine elicits antibody that protects against experimental challenge with UPEC strains. We have systematically identified four antigens that can individually protect experimentally infected mice from colonization of the bladder and/or kidneys by UPEC when administered intranasally with cholera toxin (CT) as an adjuvant. To advance the vaccine for utility in humans, we will group the individual antigens, all associated with iron acquisition (IreA, Hma, IutA, FyuA), into an effective combination to establish a multi-subunit vaccine. We demonstrated for all four vaccine antigens that antigen-specific serum IgG represents a strong correlate of protection in vaccinated mice. High antibody titers correlate with low colony forming units (CFUs) of UPEC following transurethral challenge of vaccinated mice. However, the contribution of cell-mediated immunity cannot be ruled out and must be investigated experimentally. We have demonstrated that antibodies bind to the surface of UPEC expressing the antigens. Sera from women with and without histories of UTI have been tested for antibody levels to vaccine antigens. Our results validate iron acquisition as a target for vaccination against UTI.

Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance is becoming more common among strains of A. baumannii, there is an urgent need to develop novel tools to treat infections caused by this dangerous pathogen. To develop knowledge-guided treatment approaches for A. baumannii, a thorough understanding of the mechanism by which this pathogen causes bloodstream infection is required. Here, using a mouse model of infection, we report the identification of A. baumannii genes that are critical for the ability of this pathogen to cause bloodstream infections. This study lays the foundation for future research on A. baumannii genes that can be targeted to develop novel therapeutics against this emerging human pathogen.

Unlabelled: Klebsiella pneumoniae is an urgent public health threat because of resistance to carbapenems, antibiotics of last resort against Gram-negative bacterial infections. Despite the fact that K. pneumoniae is a leading cause of pneumonia in hospitalized patients, the bacterial factors required to cause disease are poorly understood. Insertion site sequencing combines transposon mutagenesis with high-throughput sequencing to simultaneously screen thousands of insertion mutants for fitness defects during infection. Using the recently sequenced K. pneumoniae strain KPPR1 in a well-established mouse model of pneumonia, insertion site sequencing was performed on a pool of >25,000 transposon mutants. The relative fitness requirement of each gene was ranked based on the ratio of lung to inoculum read counts and concordance between insertions in the same gene. This analysis revealed over 300 mutants with at least a 2-fold fitness defect and 69 with defects ranging from 10- to >2,000-fold. Construction of 6 isogenic mutants for use in competitive infections with the wild type confirmed their requirement for lung fitness. Critical fitness genes included those for the synthesis of branched-chain and aromatic amino acids that are essential in mice and humans, the transcriptional elongation factor RfaH, and the copper efflux pump CopA. The majority of fitness genes were conserved among reference strains representative of diverse pathotypes. These results indicate that regulation of outer membrane components and synthesis of amino acids that are essential to its host are critical for K. pneumoniae fitness in the lung., Importance: Klebsiella pneumoniae is a bacterium that commonly causes pneumonia in patients after they are admitted to the hospital. K. pneumoniae is becoming resistant to all available antibiotics, and when these infections spread to the bloodstream, over half of patients die. Since currently available antibiotics are failing, we must discover new ways to treat these infections. In this study, we asked what genes the bacterium needs to cause an infection, since the proteins encoded by these genes could be targets for new antibiotics. We identified over 300 genes that K. pneumoniae requires to grow in a mouse model of pneumonia. Many of the genes that we identified are found in K. pneumoniae isolates from throughout the world, including antibiotic-resistant forms. If new antibiotics could be made against the proteins that these genes encode, they may be broadly effective against K. pneumoniae., (Copyright © 2015 Bachman et al.)

Background.  Extraintestinal Escherichia coli infections are common, costly, and potentially serious. A better understanding of their pathogenesis is needed. Methods.  Sixty-seven E coli bloodstream isolates from adults with urosepsis (Seattle, WA; 1980s) underwent extensive molecular characterization and virulence assessment in 2 infection models (murine subcutaneous sepsis and moth larval lethality). Statistical comparisons were made among host characteristics, bacterial traits, and experimental virulence. Results.  The 67 source patients were diverse for age, sex, and underlying medical and urological conditions. The corresponding E coli isolates exhibited diverse phylogenetic backgrounds and virulence profiles. Despite the E coli isolates' common bloodstream origin, they exhibited a broad range of experimental virulence in mice and moth larvae, in patterns that (for the murine model only) corresponded significantly with host characteristics and bacterial traits. The most highly mouse-lethal strains were enriched with classic "urovirulence" traits and typically were from younger women with anatomically and functionally normal urinary tracts. The 2 animal models corresponded poorly with one another. Conclusions.  Host compromise, including older age and urinary tract abnormalities, allows comparatively low-virulence E coli strains to cause urosepsis. Multiple E coli traits predict both experimental and epidemiological virulence. The larval lethality model cannot be a substitute for the murine sepsis model.

Escherichia coli is the leading cause of urinary tract infections (UTIs), one of the most common infections in humans. P fimbria was arguably the first proposed virulence factor for uropathogenic E. coli, based on the capacity of E. coli isolated from UTIs to adhere to exfoliated epithelial cells in higher numbers than fecal strains of E. coli. Overwhelming epidemiologic evidence has been presented for involvement of P fimbriae in colonization. It has been difficult, however, to demonstrate this requirement for uropathogenic strains in animal models of infections or in humans. In this study, a signature-tagged mutagenesis screen identified a P-fimbrial gene (papC) and 18 other genes as being among those required for full fitness of cystitis isolate E. coli F11. A P-fimbrial mutant was outcompeted by the wild-type strain in cochallenge in the murine model of ascending UTI, and this colonization defect could be complemented with the cloned pap operon. To our knowledge, this study is the first to fulfill molecular Koch's postulates in which a pathogenic strain was attenuated by mutation of pap genes and then complemented to restore fitness, confirming P fimbria as a virulence factor in a pathogenic clinical isolate., (© FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Urinary tract infection (UTI) represents one of the most common bacterial infections in humans and uropathogenic E. coli (UPEC) is the major causative agent of UTI in people. Research on UPEC and other bacterial pathogens causing UTI has now identified the critical role of metal transport systems in the pathogenesis of UTI. Here we review the major effectors of metal transport in bacteria and host proteins that impair metal acquisition by bacterial pathogens. In particular, we describe the studies that identified iron, zinc and nickel import and copper export as key virulence and fitness determinants during UTI. Various metal transport systems and mechanisms that govern the expression of metal transport systems are also presented here. Specific examples from UPEC and other uropathogens, when available, are presented to depict the battle for metals at the host-pathogen interface during UTI.

The microbiota stimulates inflammation, but the signaling pathways and the members of the microbiota involved remain poorly understood. We found that the microbiota induces interleukin-1β (IL-1β) release upon intestinal injury and that this is mediated via the NLRP3 inflammasome. Enterobacteriaceae and in particular the pathobiont Proteus mirabilis, induced robust IL-1β release that was comparable to that induced by the pathogen Salmonella. Upon epithelial injury, production of IL-1β in the intestine was largely mediated by intestinal Ly6C(high) monocytes, required chemokine receptor CCR2 and was abolished by deletion of IL-1β in CCR2(+) blood monocytes. Furthermore, colonization with P. mirabilis promoted intestinal inflammation upon intestinal injury via the production of hemolysin, which required NLRP3 and IL-1 receptor signaling in vivo. Thus, upon intestinal injury, selective members of the microbiota stimulate newly recruited monocytes to induce NLRP3-dependent IL-1β release, which promotes inflammation in the intestine., (Copyright © 2015 Elsevier Inc. All rights reserved.)

The emergence and spread of extended-spectrum beta-lactamases and carbapenemases among common bacterial pathogens are threatening our ability to treat routine hospital- and community-acquired infections. With the pipeline for new antibiotics virtually empty, there is an urgent need to develop novel therapeutics. Bacteria require iron to establish infection, and specialized pathogen-associated iron acquisition systems like yersiniabactin, common among pathogenic species in the family Enterobacteriaceae, including multidrug-resistant Klebsiella pneumoniae and pathogenic Escherichia coli, represent potentially novel therapeutic targets. Although the yersiniabactin system was recently identified as a vaccine target for uropathogenic E. coli (UPEC)-mediated urinary tract infection (UTI), its contribution to UPEC pathogenesis is unknown. Using an E. coli mutant (strain 536ΔfyuA) unable to acquire yersiniabactin during infection, we established the yersiniabactin receptor as a UPEC virulence factor during cystitis and pyelonephritis, a fitness factor during bacteremia, and a surface-accessible target of the experimental FyuA vaccine. In addition, we determined through transcriptome sequencing (RNA-seq) analyses of RNA from E. coli causing cystitis in women that iron acquisition systems, including the yersiniabactin system, are highly expressed by bacteria during natural uncomplicated UTI. Given that yersiniabactin contributes to the virulence of several pathogenic species in the family Enterobacteriaceae, including UPEC, and is frequently associated with multidrug-resistant strains, it represents a promising novel target to combat antibiotic-resistant infections., (Copyright © 2015, American Society for Microbiology. All Rights Reserved.)

The human genitourinary tract is a common anatomical niche for polymicrobial infection and a leading site for the development of bacteremia and sepsis. Most uncomplicated, community-acquired urinary tract infections (UTI) are caused by Escherichia coli, while another bacterium, Proteus mirabilis, is more often associated with complicated UTI. Here, we report that uropathogenic E. coli and P. mirabilis have divergent requirements for specific central pathways in vivo despite colonizing and occupying the same host environment. Using mutants of specific central metabolism enzymes, we determined glycolysis mutants lacking pgi, tpiA, pfkA, or pykA all have fitness defects in vivo for P. mirabilis but do not affect colonization of E. coli during UTI. Similarly, the oxidative pentose phosphate pathway is required only for P. mirabilis in vivo. In contrast, gluconeogenesis is required only for E. coli fitness in vivo. The remarkable difference in central pathway utilization between E. coli and P. mirabilis during experimental UTI was also observed for TCA cycle mutants in sdhB, fumC, and frdA. The distinct in vivo requirements between these pathogens suggest E. coli and P. mirabilis are not direct competitors within host urinary tract nutritional niche. In support of this, we found that co-infection with E. coli and P. mirabilis wild-type strains enhanced bacterial colonization and persistence of both pathogens during UTI. Our results reveal that complementary utilization of central carbon metabolism facilitates polymicrobial disease and suggests microbial activity in vivo alters the host urinary tract nutritional niche.

Uropathogenic Escherichia coli (UPEC) is the predominant etiological agent of uncomplicated urinary tract infection (UTI), manifested by inflammation of the urinary bladder, in humans and is a major global public health concern. Molecular pathogenesis of UPEC has been primarily examined using murine models of UTI. Translational research to develop novel therapeutics against this major pathogen, which is becoming increasingly antibiotic resistant, requires a thorough understanding of mechanisms involved in pathogenesis during human UTIs. Total RNA-sequencing (RNA-seq) and comparative transcriptional analysis of UTI samples to the UPEC isolates cultured in human urine and laboratory medium were used to identify novel fitness genes that were specifically expressed during human infection. Evidence for UPEC genes involved in ion transport, including copper efflux, nickel and potassium import systems, as key fitness factors in uropathogenesis were generated using an experimental model of UTI. Translational application of this study was investigated by targeting Cus, a bacterial copper efflux system. Copper supplementation in drinking water reduces E. coli colonization in the urinary bladder of mice. Additionally, our results suggest that anaerobic processes in UPEC are involved in promoting fitness during UTI in humans. In summary, RNA-seq was used to establish the transcriptional signature in UPEC during naturally occurring, community acquired UTI in women and multiple novel fitness genes used by UPEC during human infection were identified. The repertoire of UPEC genes involved in UTI presented here will facilitate further translational studies to develop innovative strategies against UTI caused by UPEC.

Competition for iron is a critical component of successful bacterial infections, but the underlying in vivo mechanisms are poorly understood. We have previously demonstrated that lipocalin 2 (LCN2) is an innate immunity protein that binds to bacterial siderophores and starves them for iron, thus representing a novel host defense mechanism to infection. In the present study we show that LCN2 is secreted by the urinary tract mucosa and protects against urinary tract infection (UTI). We found that LCN2 was expressed in the bladder, ureters, and kidneys of mice subject to UTI. LCN2 was protective with higher bacterial numbers retrieved from bladders of Lcn2-deficient mice than from wild-type mice infected with the LCN2-sensitive Escherichia coli strain H9049. Uropathogenic E. coli mutants in siderophore receptors for salmochelin, aerobactin, or yersiniabactin displayed reduced fitness in wild-type mice, but not in mice deficient of LCN2, demonstrating that LCN2 imparts a selective pressure on bacterial growth in the bladder. In a human cohort of women with recurrent E. coli UTIs, urine LCN2 levels were associated with UTI episodes and with levels of bacteriuria. The number of siderophore systems was associated with increasing bacteriuria during cystitis. Our data demonstrate that LCN2 is secreted by the urinary tract mucosa in response to uropathogenic E. coli challenge and acts in innate immune defenses as a colonization barrier that pathogens must overcome to establish infection., (Copyright © 2014 by The American Association of Immunologists, Inc.)

The metV genomic island in the chromosome of uropathogenic Escherichia coli (UPEC) encodes a putative transcription factor and a sugar permease of the phosphotransferase system (PTS), which are predicted to compose a Bgl-like sensory system. The presence of these two genes, hereby termed pafR and pafP, respectively, has been previously shown to correlate with isolates causing clinical syndromes. We show here that deletion of both genes impairs the ability of the resulting mutant to infect the CBA/J mouse model of ascending urinary tract infection compared to that of the parent strain, CFT073. Expressing the two genes in trans in the two-gene knockout mutant complemented full virulence. Deletion of either gene individually generated the same phenotype as the double knockout, indicating that both pafR and pafP are important to pathogenesis. We screened numerous environmental conditions but failed to detect expression from the promoter that precedes the paf genes in vitro, suggesting that they are in vivo induced (ivi). Although PafR is shown here to be capable of functioning as a transcriptional antiterminator, its targets in the UPEC genome are not known. Using microarray analysis, we have shown that expression of PafR from a heterologous promoter in CFT073 affects expression of genes related to bacterial virulence, biofilm formation, and metabolism. Expression of PafR also inhibits biofilm formation and motility. Taken together, our results suggest that the paf genes are implicated in pathogenesis and that PafR controls virulence genes, in particular biofilm formation genes., (Copyright © 2014, American Society for Microbiology. All Rights Reserved.)

Swarming contributes to Proteus mirabilis pathogenicity by facilitating access to the catheterized urinary tract. We previously demonstrated that 0.1-20 mmol/L arginine promotes swarming on normally nonpermissive media and that putrescine biosynthesis is required for arginine-induced swarming. We also previously determined that arginine-induced swarming is pH dependent, indicating that the external proton concentration is critical for arginine-dependent effects on swarming. In this study, we utilized survival at pH 5 and motility as surrogates for measuring changes in the proton gradient (ΔpH) and proton motive force (μH(+) ) in response to arginine. We determined that arginine primarily contributes to ΔpH (and therefore μH(+) ) through the action of arginine decarboxylase (speA), independent of the role of this enzyme in putrescine biosynthesis. In addition to being required for motility, speA also contributed to fitness during infection. In conclusion, consumption of intracellular protons via arginine decarboxylase is one mechanism used by P. mirabilis to conserve ΔpH and μH(+) for motility., (© 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.)

A heterogeneous subset of extraintestinal pathogenic Escherichia coli (ExPEC) strains, referred to as uropathogenic E. coli (UPEC), causes most uncomplicated urinary tract infections. However, no core set of virulence factors exists among UPEC strains. Instead, the focus of the analysis of urovirulence has shifted to studying broad classes of virulence factors and the interactions between them. For example, the RTX nonfimbrial adhesin TosA mediates adherence to host cells derived from the upper urinary tract. The associated tos operon is well expressed in vivo but poorly expressed in vitro and encodes TosCBD, a predicted type 1 secretion system. TosR and TosEF are PapB and LuxR family transcription factors, respectively; however, no role has been assigned to these potential regulators. Thus, the focus of this study was to determine how TosR and TosEF regulate tosA and affect the reciprocal expression of adhesins and flagella. Among a collection of sequenced UPEC strains, 32% (101/317) were found to encode TosA, and nearly all strains (91% [92/101]) simultaneously carried the putative regulatory genes. Deletion of tosR alleviates tosA repression. The tos promoter was localized upstream of tosR using transcriptional fusions of putative promoter regions with lacZ. TosR binds to this region, affecting a gel shift. A 100-bp fragment 220 to 319 bp upstream of tosR inhibits binding, suggesting localization of the TosR binding site. TosEF, on the other hand, downmodulate motility when overexpressed by preventing the expression of fliC, encoding flagellin. Deletion of tosEF increased motility. Thus, we present an additional example of the reciprocal control of adherence and motility., (Copyright © 2014, American Society for Microbiology. All Rights Reserved.)

Background: Catheter-associated urinary tract infections (CaUTIs) are the most common hospital-acquired infections worldwide and are frequently polymicrobial. The urease-positive species Proteus mirabilis and Providencia stuartii are two of the leading causes of CaUTIs and commonly co-colonize catheters. These species can also cause urolithiasis and bacteremia. However, the impact of coinfection on these complications has never been addressed experimentally., Methods: A mouse model of ascending UTI was utilized to determine the impact of coinfection on colonization, urolithiasis, and bacteremia. Mice were infected with P. mirabilis or a urease mutant, P. stuartii, or a combination of these organisms. In vitro experiments were conducted to assess growth dynamics and impact of co-culture on urease activity., Results: Coinfection resulted in a bacterial load similar to monospecies infection but with increased incidence of urolithiasis and bacteremia. These complications were urease-dependent as they were not observed during coinfection with a P. mirabilis urease mutant. Furthermore, total urease activity was increased during co-culture., Conclusions: We conclude that P. mirabilis and P. stuartii coinfection promotes urolithiasis and bacteremia in a urease-dependent manner, at least in part through synergistic induction of urease activity. These data provide a possible explanation for the high incidence of bacteremia resulting from polymicrobial CaUTI.

SslE, the Secreted and surface-associated lipoprotein from Escherichia coli, has recently been associated to the M60-like extracellular zinc-metalloprotease sub-family which is implicated in glycan recognition and processing. SslE can be divided into two main variants and we recently proposed it as a potential vaccine candidate. By applying a number of in vitro bioassays and comparing wild type, knockout mutant and complemented strains, we have now demonstrated that SslE specifically contributes to degradation of mucin substrates, typically present in the intestine and bladder. Mutation of the zinc metallopeptidase motif of SslE dramatically impaired E. coli mucinase activity, confirming the specificity of the phenotype observed. Moreover, antibodies raised against variant I SslE, cloned from strain IHE3034 (SslEIHE3034), are able to inhibit translocation of E. coli strains expressing different variants through a mucin-based matrix, suggesting that SslE induces cross-reactive functional antibodies that affect the metallopeptidase activity. To test this hypothesis, we used well-established animal models and demonstrated that immunization with SslEIHE3034 significantly reduced gut, kidney and spleen colonization by strains producing variant II SslE and belonging to different pathotypes. Taken together, these data strongly support the importance of SslE in E. coli colonization of mucosal surfaces and reinforce the use of this antigen as a component of a broadly protective vaccine against pathogenic E. coli species.

The urinary tract is one of the most common sites of infection in humans, and uropathogenic Escherichia coli (UPEC) is the main causative agent of urinary tract infections. Bacteria colonizing the urinary tract face extremely low iron availability. To counteract this, UPEC expresses a wide variety of iron acquisition systems. To exploit iron acquisition in UPEC as a global target for small-molecule inhibition, we developed and carried out a whole-cell growth-based high throughput screen of 149,243 compounds. Our primary assay was carried out under iron-limiting conditions. Hits in the primary screen were assayed using two counterscreens that ruled out iron chelators and compounds that inhibit growth by means other than inhibition of iron acquisition. We determined dose-response curves under two different iron conditions and purchased fresh compounds for selected hits. After retesting dose-response relationships, we identified 16 compounds that arrest growth of UPEC only under iron-limiting conditions. All compounds are bacteriostatic and do not inhibit proton motive force. A loss-of-target strategy was employed to identify the cellular target of these inhibitors. Two compounds lost inhibitory activity against a strain lacking TonB and were shown to inhibit irreversible adsorption of a TonB-dependent bacteriophage. Our results validate iron acquisition as a target for antibacterial strategies against UPEC and identify TonB as one of the cellular targets. IMPORTANCE Half of women will suffer at least one episode of urinary tract infection (UTI) during their lifetime. The current treatment for UTI involves antibiotic therapy. Resistance to currently used antibiotics has steadily increased over the last decade, generating a pressing need for the development of new therapeutic agents. Since iron is essential for colonization and scarce in the urinary tract, targeting iron acquisition would seem to be an attractive strategy. However, the multiplicity and redundancy of iron acquisition systems in uropathogenic Escherichia coli (UPEC) make it difficult to pinpoint a specific cellular target. Here, we identified 16 iron acquisition inhibitors through a whole-cell high-throughput screen, validating iron acquisition as a target for antibacterial strategies against UPEC. We also identified the cellular target of two of the inhibitors as the TonB system.

This study reports the release of draft genome sequences of five isolates of uropathogenic Escherichia coli (UPEC), isolated from patients suffering from uncomplicated cystitis in 2012 in Ann Arbor, Michigan. Phylogenetic analyses revealed that these strains belonged to E. coli phylogroups B2 and D and are closely related to known UPEC strains. Comparative genomic analysis revealed that more conserved proteins were shared between these recent isolates and UPEC strains causing cystitis than those causing pyelonephritis. Additional genomic comparisons identified that three isolates encode a type III secretion system (T3SS) and a putative T3SS effector gene cluster along with an invasin-like outer membrane protein. The presence of T3SS genes is a rare occurrence among UPEC strains. These genomes further substantiate the heterogeneity of the gene pool of UPEC and provide a foundation for comparative genomic studies using recent clinical isolates., (© 2013 Federation of European Microbiological Societies.)

Urinary tract infections (UTI) are common and represent a substantial economic and public health burden. Roughly 80% of these infections are caused by a heterogeneous group of uropathogenic Escherichia coli (UPEC) strains. Antibiotics are standard therapy for UTI, but a rise in antibiotic resistance has complicated treatment, making the development of a UTI vaccine more urgent. Iron receptors are a promising new class of vaccine targets for UTI, as UPEC require iron to colonize the iron-limited host urinary tract and genes encoding iron acquisition systems are highly expressed during infection. Previously, three of six UPEC siderophore and heme receptors were identified as vaccine candidates by intranasal immunization in a murine model of ascending UTI. To complete the assessment of iron receptors as vaccine candidates, an additional six UPEC iron receptors were evaluated. Of the six vaccine candidates tested in this study (FyuA, FitA, IroN, the gene product of the CFT073 locus c0294, and two truncated derivatives of ChuA), only FyuA provided significant protection (P = 0.0018) against UPEC colonization. Intranasal immunization induced a robust and long-lived humoral immune response. In addition, the levels of FyuA-specific serum IgG correlated with bacterial loads in the kidneys [Spearman's rank correlation coefficient ρ(14) = -0.72, P = 0.0018], providing a surrogate of protection. FyuA is the fourth UPEC iron receptor to be identified from our screens, in addition to IutA, Hma, and IreA, which were previously demonstrated to elicit protection against UPEC challenge. Together, these iron receptor antigens will facilitate the development of a broadly protective, multivalent UTI vaccine to effectively target diverse strains of UPEC.

YdiV, a degenerate EAL domain protein, represses motility by interacting with FlhD to abolish FlhDC interaction with DNA. Here, we demonstrate that deletion of ydiV dysregulates coordinate control of motility and adherence by increasing adherence of Escherichia coli CFT073 to a bladder epithelial cell line by specifically increasing production of P fimbriae. Interestingly, only one of the two P fimbrial operons, pap_2, present in the genome of E. coli CFT073 was upregulated. This derepression of the pap_2 operon is abolished following deletion of either cya or crp, demonstrating cyclic AMP (cAMP)-dependent activation of the P fimbrial operon. However, the absence of YdiV does not affect the gene expression of cya and crp, and loss of SdiA in the ydiV mutant does not affect the derepression of the pap_2 operon, suggesting that YdiV control of adherence acts in response to cAMP levels. Deletion of ydiV increases motility by increasing expression of fliA, suggesting that in E. coli CFT073, YdiV regulates motility by the same mechanism as that described previously for commensal E. coli strains. Furthermore, analysis of site-directed mutations found two putative Mg(2+)-binding residues of four conserved YdiV residues (E29 and Q219) that were involved in regulation of motility and FliC production, while two conserved c-di-GMP-binding residues (D156 and D165) only affected motility. None of the four conserved YdiV residues appeared to affect regulation of adherence. Therefore, we propose a model in which a degenerate EAL, YdiV, utilizes different domains to regulate motility through interaction with FlhD and adherence to epithelial cells through cAMP-dependent effects on the pap_2 promoter.

Proteus mirabilis, a leading cause of catheter-associated urinary tract infection (CaUTI), differentiates into swarm cells that migrate across catheter surfaces and medium solidified with 1.5% agar. While many genes and nutrient requirements involved in the swarming process have been identified, few studies have addressed the signals that promote initiation of swarming following initial contact with a surface. In this study, we show that P. mirabilis CaUTI isolates initiate swarming in response to specific nutrients and environmental cues. Thirty-three compounds, including amino acids, polyamines, fatty acids, and tricarboxylic acid (TCA) cycle intermediates, were tested for the ability to promote swarming when added to normally nonpermissive media. L-Arginine, L-glutamine, DL-histidine, malate, and DL-ornithine promoted swarming on several types of media without enhancing swimming motility or growth rate. Testing of isogenic mutants revealed that swarming in response to the cues required putrescine biosynthesis and pathways involved in amino acid metabolism. Furthermore, excess glutamine was found to be a strict requirement for swarming on normal swarm agar in addition to being a swarming cue under normally nonpermissive conditions. We thus conclude that initiation of swarming occurs in response to specific cues and that manipulating concentrations of key nutrient cues can signal whether or not a particular environment is permissive for swarming.

In bacteria, laterally acquired genes are often concentrated within chromosomal regions known as genomic islands. Using a recently developed zebrafish infection model, we set out to identify unique factors encoded within genomic islands that contribute to the fitness and virulence of a reference urosepsis isolate-extraintestinal pathogenic Escherichia coli strain CFT073. By screening a series of deletion mutants, we discovered a previously uncharacterized gene, neaT, that is conditionally required by the pathogen during systemic infections. In vitro assays indicate that neaT can limit bacterial interactions with host phagocytes and alter the aggregative properties of CFT073. The neaT gene is localized within an integrated P2-like bacteriophage in CFT073, but was rarely found within other proteobacterial genomes. Sequence-based analyses revealed that neaT homologues are present, but discordantly conserved, within a phyletically diverse set of bacterial species. In CFT073, neaT appears to be unameliorated, having an exceptionally A+T-rich composition along with a notably altered codon bias. These data suggest that neaT was recently brought into the proteobacterial pan-genome from an extra-phyletic source. Interestingly, even in G+C-poor genomes, as found within the Firmicutes lineage, neaT-like genes are often unameliorated. Sequence-level features of neaT homologues challenge the common supposition that the A+T-rich nature of many recently acquired genes reflects the nucleotide composition of their genomes of origin. In total, these findings highlight the complexity of the evolutionary forces that can affect the acquisition, utilization, and assimilation of rare genes that promote the niche-dependent fitness and virulence of a bacterial pathogen.

Uropathogenic Escherichia coli (UPEC) is a leading etiological agent of bacteremia in humans. Virulence mechanisms of UPEC in the context of urinary tract infections have been subjected to extensive research. However, understanding of the fitness mechanisms used by UPEC during bacteremia and systemic infection is limited. A forward genetic screen was utilized to detect transposon insertion mutants with fitness defects during colonization of mouse spleens. An inoculum comprised of 360,000 transposon mutants in the UPEC strain CFT073, cultured from the blood of a patient with pyelonephritis, was used to inoculate mice intravenously. Transposon insertion sites in the inoculum (input) and bacteria colonizing the spleen (output) were identified using high-throughput sequencing of transposon-chromosome junctions. Using frequencies of representation of each insertion mutant in the input and output samples, 242 candidate fitness genes were identified. Co-infection experiments with each of 11 defined mutants and the wild-type strain demonstrated that 82% (9 of 11) of the tested candidate fitness genes were required for optimal fitness in a mouse model of systemic infection. Genes involved in biosynthesis of poly-N-acetyl glucosamine (pgaABCD), major and minor pilin of a type IV pilus (c2394 and c2395), oligopeptide uptake periplasmic-binding protein (oppA), sensitive to antimicrobial peptides (sapABCDF), putative outer membrane receptor (yddB), zinc metallopeptidase (pqqL), a shikimate pathway gene (c1220) and autotransporter serine proteases (pic and vat) were further characterized. Here, we report the first genome-wide identification of genes that contribute to fitness in UPEC during systemic infection in a mammalian host. These fitness factors may represent targets for developing novel therapeutics against UPEC.

The Type VI Secretion System (T6SS) functions in bacteria as a contractile nanomachine that punctures and delivers lethal effectors to a target cell. Virtually nothing is known about the lifestyle or physiology that dictates when bacteria normally produce their T6SS, which prevents a clear understanding of how bacteria benefit from its action in their natural habitat. Proteus mirabilis undergoes a characteristic developmental process to coordinate a multicellular swarming behavior and will discriminate itself from another Proteus isolate during swarming, resulting in a visible boundary termed a Dienes line. Using transposon mutagenesis, we discovered that this recognition phenomenon requires the lethal action of the T6SS. All mutants identified in the genetic screen had insertions within a single 33.5-kb region that encodes a T6SS and cognate Hcp-VrgG-linked effectors. The identified T6SS and primary effector operons were characterized by killing assays, by construction of additional mutants, by complementation, and by examining the activity of the type VI secretion system in real-time using live-cell microscopy on opposing swarms. We show that lethal T6SS-dependent activity occurs when a dominant strain infiltrates deeply beyond the boundary of the two swarms. Using this multicellular model, we found that social recognition in bacteria, underlying killing, and immunity to killing all require cell-cell contact, can be assigned to specific genes, and are dependent on the T6SS. The ability to survive a lethal T6SS attack equates to "recognition". In contrast to the current model of T6SS being an offensive or defensive weapon our findings support a preemptive mechanism by which an entire population indiscriminately uses the T6SS for contact-dependent delivery of effectors during its cooperative mode of growth.

Extraintestinal Escherichia coli (ExPEC), a heterogeneous group of pathogens, encompasses avian, neonatal meningitis, and uropathogenic E. coli strains. While several virulence factors are associated with ExPEC, there is no core set of virulence factors that can be used to definitively differentiate these pathotypes. Here we describe a multiplex of four virulence factor-encoding genes, yfcV, vat, fyuA, and chuA, highly associated with uropathogenic E. coli strains that can distinguish three groups of E. coli: diarrheagenic and animal-associated E. coli strains, human commensal and avian pathogenic E. coli strains, and uropathogenic and neonatal meningitis E. coli strains. Furthermore, human intestinal isolates that encode all four predictor genes express them during exponential growth in human urine and colonize the bladder in the mouse model of ascending urinary tract infection in higher numbers than human commensal strains that do not encode the four predictor genes (P = 0.02), suggesting that the presence of the predictors correlates with uropathogenic potential.

Proteus mirabilis, named for the Greek god who changed shape to avoid capture, has fascinated microbiologists for more than a century with its unique swarming differentiation, Dienes line formation and potent urease activity. Transcriptome profiling during both host infection and swarming motility, coupled with the availability of the complete genome sequence for P. mirabilis, has revealed the occurrence of interbacterial competition and killing through a type VI secretion system, and the reciprocal regulation of adhesion and motility, as well as the intimate connections between metabolism, swarming and virulence. This Review addresses some of the unique and recently described aspects of P. mirabilis biology and pathogenesis, and emphasizes the potential role of this bacterium in single-species and polymicrobial urinary tract infections.

Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. Bacterial locomotion and the existence of microbes were the first scientific observations that followed the invention of the microscope. A bacterium can swim through a fluid environment or coordinate motion with a group of bacteria and swarm across a surface. The flagellar motor, which propels the bacterium, is fueled by proton motive force. In contrast to the physiology that governs swimming motility, much less is known about the energy sources required for multicellular swarming on surfaces. In this study, we used Proteus mirabilis as a model organism to study vigorous swarming behavior and genetic and biochemical approaches to define energy pathways and central metabolism that contribute to multicellular motility. We found that swarming bacteria use a complete aerobic tricarboxylic acid (TCA) cycle but do not respire oxygen as the terminal electron acceptor, suggesting that multicellular cooperation during swarming reduces the amount of energy required by individual bacteria to achieve rapid motility.

Intracellular concentration of cyclic diguanylate monophosphate (c-di-GMP), a second messenger molecule, is regulated in bacteria by diguanylate cyclases (DGCs) (synthesizing c-di-GMP) and phosphodiesterases (PDEs) (degrading c-di-GMP). c-di-GMP concentration ([c-di-GMP]) affects motility and sessility in a reciprocal fashion; high [c-di-GMP] typically inhibits motility and promotes sessility. A c-di-GMP sensor domain, PilZ, also regulates motility and sessility. Uropathogenic Escherichia coli regulates these processes during infection; motility is necessary for ascending the urinary tract, while sessility is essential for colonization of anatomical sites. Here, we constructed and screened 32 mutants containing deletions of genes encoding each PDE (n = 11), DGC (n = 13), PilZ (n = 2), and both PDE and DGC (n = 6) domains for defects in motility, biofilm formation, and adherence for the prototypical pyelonephritis isolate E. coli CFT073. Three of 32 mutations affected motility, all of which were in genes encoding enzymatically inactive PDEs. Four PDEs, eight DGCs, four PDE/DGCs, and one PilZ regulated biofilm formation in a medium-specific manner. Adherence to bladder epithelial cells was regulated by [c-di-GMP]. Four PDEs, one DGC, and three PDE/DGCs repress adherence and four DGCs and one PDE/DGC stimulate adherence. Thus, specific effectors of [c-di-GMP] and catalytically inactive DGCs and PDEs regulate adherence and motility in uropathogenic E. coli. IMPORTANCE Uropathogenic Escherichia coli (UPEC) contains several genes annotated as encoding enzymes that increase or decrease the abundance of the second messenger molecule, c-di-GMP. While this class of enzymes has been studied in an E. coli K-12 lab strain, these proteins have not been comprehensively examined in UPEC. UPEC utilizes both swimming motility and adherence to colonize and ascend the urinary tract; both of these processes are hypothesized to be regulated by the concentration of c-di-GMP. Here, for the first time, in a uropathogenic strain, E. coli CFT073, we have characterized mutants lacking each protein and demonstrated that the uropathogen has diverged from E. coli K-12 to utilize these enzymes to regulate adherence and motility by distinct mechanisms.

Type 1 fimbriae and flagella, two surface organelles critical for colonization of the urinary tract by uropathogenic Escherichia coli (UPEC), mediate opposing virulence objectives. Type 1 fimbriae facilitate adhesion to mucosal cells and promote bacterial persistence in the urinary tract, while flagella propel bacteria through urine and along mucous layers during ascension to the upper urinary tract. Using a transposon screen of the E. coli CFT073 fim locked-ON (L-ON) mutant, a construct that constitutively expresses type 1 fimbriae and represses motility, we identified six mutants that exhibited a partial restoration of motility. Among these six mutated genes was mutS, which encodes a component of the methyl-directed mismatch repair (MMR) system. When complemented with mutS in trans, motility was again repressed. To determine whether the MMR system, in general, is involved in this reciprocal control, we characterized the effects of gene deletions of other MMR components on UPEC motility. Isogenic deletions of mutS, mutH, and mutL were constructed in both wild-type CFT073 and fim L-ON backgrounds. All MMR mutants showed an increase in motility in the wild-type background, and ΔmutH and ΔmutS mutations increased motility in the fim L-ON background. Cochallenge of the wild-type strain with an MMR-defective strain showed a subtle but significant competitive advantage in the bladder and spleen for the MMR mutant using the murine model of ascending urinary tract infection after 48 h. Our findings demonstrate that the MMR system generally affects the reciprocal regulation of motility and adherence and thus could contribute to UPEC pathogenesis during urinary tract infections.

Uncomplicated urinary tract infections (UTIs) are common, with nearly half of all women experiencing at least one UTI in their lifetime. This high frequency of infection results in huge annual economic costs, decreased workforce productivity and high patient morbidity. At least 80% of these infections are caused by uropathogenic Escherichia coli (UPEC). UPEC can reside side by side with commensal strains in the gastrointestinal tract and gain access to the bladder via colonization of the urethra. Antibiotics represent the current standard treatment for UTI; however, even after treatment, patients frequently suffer from recurrent infection with the same or different strains. In addition, successful long-term treatment has been complicated by a rise in both the number of antibiotic-resistant strains and the prevalence of antibiotic-resistance mechanisms. As a result, preventative approaches to UTI, such as vaccination, have been sought. This review summarizes recent advances in UPEC vaccine development and outlines future directions for the field.

Unlabelled: The increasing antibiotic resistance of pathogenic Escherichia coli species and the absence of a pan-protective vaccine pose major health concerns. We recently identified, by subtractive reverse vaccinology, nine Escherichia coli antigens that protect mice from sepsis. In this study, we characterized one of them, ECOK1_0290, named FdeC (factor adherence E. coli) for its ability to mediate E. coli adhesion to mammalian cells and extracellular matrix. This adhesive propensity was consistent with the X-ray structure of one of the FdeC domains that shows a striking structural homology to Yersinia pseudotuberculosis invasin and enteropathogenic E. coli intimin. Confocal imaging analysis revealed that expression of FdeC on the bacterial surface is triggered by interaction of E. coli with host cells. This phenotype was also observed in bladder tissue sections derived from mice infected with an extraintestinal strain. Indeed, we observed that FdeC contributes to colonization of the bladder and kidney, with the wild-type strain outcompeting the fdeC mutant in cochallenge experiments. Finally, intranasal mucosal immunization with recombinant FdeC significantly reduced kidney colonization in mice challenged transurethrally with uropathogenic E. coli, supporting a role for FdeC in urinary tract infections., Importance: Pathogenic Escherichia coli strains are involved in a diverse spectrum of diseases, including intestinal and extraintestinal infections (urinary tract infections and sepsis). The absence of a broadly protective vaccine against all these E. coli strains is a major problem for modern society due to high costs to health care systems. Here, we describe the structural and functional properties of a recently reported protective antigen, named FdeC, and elucidated its putative role during extraintestinal pathogenic E. coli infection by using both in vitro and in vivo infection models. The conservation of FdeC among strains of different E. coli pathotypes highlights its potential as a component of a broadly protective vaccine against extraintestinal and intestinal E. coli infections.

Unlabelled: The urinary tract is one of the most frequent sites of bacterial infection in humans. Uropathogenic Escherichia coli (UPEC) strains are the leading cause of urinary tract infections (UTIs) and are responsible for greater than 80% of uncomplicated cases in adults. Infection of the urinary tract occurs in an ascending manner, with colonization of the bladder leading to possible kidney infection and bacteremia. The goal of this study was to examine the population dynamics of UPEC in vivo using a murine model of ascending UTI. To track individual UPEC lineages within a host, we constructed 10 isogenic clones of UPEC strain CFT073 by inserting unique signature tag sequences between the pstS and glmS genes at the attTn7 chromosomal site. Mice were transurethrally inoculated with a mixture containing equal numbers of unique clones. After 4 and 48 h, the tags present in the bladders, kidneys, and spleens of infected mice were enumerated using tag-specific primers and quantitative real-time PCR. The results indicated that kidney infection and bacteremia associated with UTI are most likely the result of multiple rounds of ascension and dissemination from motile UPEC subpopulations, with a distinct bottleneck existing between the kidney and bloodstream. The abundance of tagged lineages became more variable as infection progressed, especially after bacterial ascension to the upper urinary tract. Analysis of the population kinetics of UPEC during UTI revealed metapopulation dynamics, with lineages that constantly increased and decreased in abundance as they migrated from one organ to another., Importance: Urinary tract infections are some of the most common infections affecting humans, and Escherichia coli is the primary cause in most uncomplicated cases. These infections occur in an ascending manner, with bacteria traveling from the bladder to the kidneys and potentially the bloodstream. Little is known about the spatiotemporal population dynamics of uropathogenic E. coli within a host. Here we describe a novel approach for tracking lineages of isogenic tagged E. coli strains within a murine host by the use of quantitative real-time PCR. Understanding the in vivo population dynamics and the factors that shape the bacterial population may prove to be of significant value in the development of novel vaccines and drug therapies.

Uropathogenic Escherichia coli (UPEC) is responsible for the majority of uncomplicated urinary tract infections (UTI) and represents the most common bacterial infection in adults. UPEC utilizes a wide range of virulence factors to colonize the host, including the novel repeat-in-toxin (RTX) protein TosA, which is specifically expressed in the host urinary tract and contributes significantly to the virulence and survival of UPEC. tosA, found in strains within the B2 phylogenetic subgroup of E. coli, serves as a marker for strains that also contain a large number of well-characterized UPEC virulence factors. The presence of tosA in an E. coli isolate predicts successful colonization of the murine model of ascending UTI, regardless of the source of the isolate. Here, a detailed analysis of the function of tosA revealed that this gene is transcriptionally linked to genes encoding a conserved type 1 secretion system similar to other RTX family members. TosA localized to the cell surface and was found to mediate (i) adherence to host cells derived from the upper urinary tract and (ii) survival in disseminated infections and (iii) to enhance lethality during sepsis (as assessed in two different animal models of infection). An experimental vaccine, using purified TosA, protected vaccinated animals against urosepsis. From this work, it was concluded that TosA belongs to a novel group of RTX proteins that mediate adherence and host damage during UTI and urosepsis and could be a novel target for the development of therapeutics to treat ascending UTIs.

Bacterial growth in the host is required for pathogenesis. To successfully grow in vivo, pathogens have adapted their metabolism to replicate in specific host microenvironments. These adaptations reflect the nutritional composition of their host niches, inter-bacterial competition for carbon and energy sources, and survival in the face of bactericidal defense mechanisms. A subgroup of Escherichia coli, which cause urinary tract infection, bacteremia, sepsis, and meningitis, have adapted to grow as a harmless commensal in the nutrient-replete, carbon-rich human intestine but rapidly transition to pathogenic lifestyle in the nutritionally poorer, nitrogen-rich urinary tract. We discuss bacterial adaptations that allow extraintestinal pathogenic E. coli to establish both commensal associations and virulence as the bacterium transits between disparate microenvironments within the same individual., (Copyright © 2011 Elsevier Ltd. All rights reserved.)

Background: In previous work, we designed a modified aptamer-free SELEX-seq protocol (afSELEX-seq) for the discovery of transcription factor binding sites. Here, we present original software, TFAST, designed to analyze afSELEX-seq data, validated against our previously generated afSELEX-seq dataset and a model dataset. TFAST is designed with a simple graphical interface (Java) so that it can be installed and executed without extensive expertise in bioinformatics. TFAST completes analysis within minutes on most personal computers., Methodology: Once afSELEX-seq data are aligned to a target genome, TFAST identifies peaks and, uniquely, compares peak characteristics between cycles. TFAST generates a hierarchical report of graded peaks, their associated genomic sequences, binding site length predictions, and dummy sequences., Principal Findings: Including additional cycles of afSELEX-seq improved TFAST's ability to selectively identify peaks, leading to 7,274, 4,255, and 2,628 peaks identified in two-, three-, and four-cycle afSELEX-seq. Inter-round analysis by TFAST identified 457 peaks as the strongest candidates for true binding sites. Separating peaks by TFAST into classes of worst, second-best and best candidate peaks revealed a trend of increasing significance (e-values 4.5 × 10(12), 2.9 × 10(-46), and 1.2 × 10(-73)) and informational content (11.0, 11.9, and 12.5 bits over 15 bp) of discovered motifs within each respective class. TFAST also predicted a binding site length (28 bp) consistent with non-computational experimentally derived results for the transcription factor PapX (22 to 29 bp)., Conclusions/significance: TFAST offers a novel and intuitive approach for determining DNA binding sites of proteins subjected to afSELEX-seq. Here, we demonstrate that TFAST, using afSELEX-seq data, rapidly and accurately predicted sequence length and motif for a putative transcription factor's binding site.

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Escherichia coli, a cause of ∼90% of urinary tract infections (UTI), utilizes fimbrial adhesins to colonize the uroepithelium. Pyelonephritis isolate E. coli CFT073 carries 12 fimbrial operons, 5 of which have never been studied. Using multiplex PCR, the prevalence of these 12 and 3 additional fimbrial types was determined for a collection of 303 E. coli isolates (57 human commensal, 32 animal commensal, 54 asymptomatic bacteriuria, 45 complicated UTI, 38 uncomplicated cystitis, and 77 pyelonephritis). The number of fimbrial types per E. coli isolate was distributed bimodally: those with low (3.2 ± 1.1) and those with high (8.3 ± 1.3) numbers of fimbrial types (means ± standard errors of the means). The fimbrial genes ygiL, yadN, yfcV, and c2395 were significantly more prevalent among urine isolates than human commensal isolates. The effect of deletion of Ygi and Yad fimbrial operons on growth, motility, biofilm formation, adherence to immortalized human epithelial cells, and pathogenesis in the mouse model of UTI was examined. Yad fimbriae were necessary for wild-type levels of adherence to a bladder epithelial cell line and for biofilm formation. Deletion of these fimbrial genes increased motility. Ygi fimbriae were necessary for wild-type levels of adherence to a human embryonic kidney cell line, biofilm formation, and in vivo fitness in the urine and kidneys. Complementation of each fimbrial mutant restored wild-type levels of motility, biofilm formation, adherence and, for ygi, in vivo fitness. A double deletion strain, Δygi Δyad, was attenuated in the urine, bladder, and kidneys in the mouse model, demonstrating that these fimbriae contribute to uropathogenesis.

Background: Methicillin-resistant Staphylococcus aureus (MRSA) remains sensitive to vancomycin; when vancomycin-resistant S. aureus (VRSA) emerges, treatment becomes more complex. VRSA emergence is attributed to conjugative transfer of the vancomycin-resistance gene cluster from vancomycin-resistant enterococci (VRE) to MRSA. Because cocolonization with MRSA and VRE precedes VRSA development, this study investigates the epidemiology of cocolonization in skilled nursing facility (SNF) residents at high risk for MRSA or VRE colonization., Methods: A prospective observational study conducted at 15 SNFs in southeast Michigan. Overall, 178 residents (90 with indwelling urinary catheters and/or feeding tubes and 88 device-free) were cultured monthly for MRSA and VRE, and clinical data were recorded., Results: The incidence of MRSA/VRE cocolonization among residents with indwelling devices was 6.5 per 100 resident-months; 5.2 (95% confidence interval [CI]: 1.49-18.1) times that among those without devices. MRSA/VRE cocolonization in the device group occurred most frequently in wounds (4.1 per 100 resident-months). In a logistic regression analysis limited to residents with devices, functional disability (rate ratio [RR], 1.3; 95% CI: 1.1-1.4) and wound presence (RR, 3.4; 95% CI: 1.4-8.6) were independent risk factors of cocolonization., Conclusions: In a population of SNF residents, individuals with indwelling devices who also had functional disability or wounds were at greatest risk of MRSA/VRE cocolonization. These individuals should be routinely monitored for the presence of VRSA colonization.

PhoP is considered a virulence regulator despite being conserved in both pathogenic and non-pathogenic Enterobacteriaceae. While Escherichia coli strains represent non-pathogenic commensal isolates and numerous virulent pathotypes, the PhoP virulence regulator has only been studied in commensal E. coli. To better understand how conserved transcription factors contribute to virulence, we characterized PhoP in pathogenic E. coli. Deletion of phoP significantly attenuated E. coli during extraintestinal infection. This was not surprising since we demonstrated that PhoP differentially regulated the transcription of > 600 genes. In addition to survival at acidic pH and resistance to polymyxin, PhoP was required for repression of motility and oxygen-independent changes in the expression of primary dehydrogenase and terminal reductase respiratory chain components. All phenotypes have in common a reliance on an energized membrane. Thus, we hypothesized that PhoP mediates these effects by regulating genes encoding proteins that generate proton motive force. Indeed, bacteria lacking PhoP exhibited a hyperpolarized membrane and dissipation of the transmembrane electrochemical gradient increased susceptibility of the phoP mutant to acidic pH, while inhibiting respiratory generation of the proton gradient restored resistance to antimicrobial peptides independent of lipopolysaccharide modification. These findings demonstrate a connection between PhoP, virulence and the energized state of the membrane., (© 2011 Blackwell Publishing Ltd.)