Search

We conducted a single-arm, open-label, single-center phase I study (Clinicaltrials.gov NCT03984968) to assess the safety and efficacy of multicycle-sequential anti-CD19 CAR T-cell therapy in combination with autologous CD19+ feeding T cells (FTCs) and TKI as consolidation therapy in patients under the age of 65 years with de novo Ph-positive CD19+ B-ALL who are not eligible for allo-HSCT. Participants were given induction chemotherapy as well as systemic chemotherapy with TKI. Afterward, they received a single cycle of CD19 CAR T-cell infusion and another three cycles of CD19 CAR T-cell and CD19+ FTC infusions, followed by TKI as consolidation therapy. CD19+ FTCs were given at three different doses: (2×106/kg, 3.25×106/kg, and 5×106/kg). The phase I results of the first 15 patients, including 2 withdrawals, are presented. Phase II research is still ongoing. The most common adverse events were cytopenia (13/13) and hypogammaglobinemia (12/13). There were no CRS above grade 2 or ICANS, or grade 4 nonhematologic toxicities. All 13 patients achieved CR, including 12 patients with CMR at the data cutoff on Mar 31, 2022. The RFS was 84% (95% CI, 66%-100%), and the OS was 83% (95% CI, 58%-100%) with a median follow-up of 27 months (7-57 months). The total number of CD19-expressing cells decreased with an increasing CMR rate. CD19 CAR T cells survived for up to 40 months, whereas CD19+ FTCs vanished in 8 patients 3 months after the last infusion. These findings merit further evaluation and could form the basis for the development of an allo-HSCT-free consolidation paradigm.

The aggregation of islet amyloid polypeptide (IAPP) is associated with beta-cell dysfunction in type 2 diabetes (T2D) in humans. One possible mechanism of toxicity is the interaction of IAPP oligomers with lipid membranes to disrupt bilayer integrity and/or homeostasis of the cell. Amino acid sequence variations of IAPP between species can greatly decrease their propensity for aggregation. For example, human IAPP is toxic to beta-cells, but rat and pig IAPP are not. However, it is not clear how these differences affect membrane association. Using native mass spectrometry with lipid nanodiscs, we explored the differences in the association of human, rat, and pig IAPP with lipid bilayers. We discovered that human and rat IAPP bound nanodiscs with anionic dipalmitoyl-phosphatidylglycerol (DPPG) lipids, but pig IAPP did not. Furthermore, human and rat IAPP interacted differently with the membrane. Human IAPP shows potential tetramer complexes, but rat IAPP associated with the membrane sequentially. Thus, overall IAPP-bilayer interactions are not necessarily related to disease, but differences in oligomeric behavior at the membrane may instead play a role.

Human islet amyloid polypeptide (hIAPP) plays a role in glucose regulation but forms pancreatic amyloid deposits in type 2 diabetes, and that process contributes to β-cell dysfunction. Not all species develop diabetes, and not all secrete an IAPP that is amyloidogenic

Rationale: Accumulated evidence indicates that environmental plasticizers are a threat to human and animal fertility. Di (2-ethylhexyl) phthalate (DEHP), a plasticizer to which humans are exposed daily, can trigger reproductive toxicity by acting as an endocrine-disrupting chemical. In mammals, the female primordial follicle pool forms the lifetime available ovarian reserve, which does not undergo regeneration once it is established during the fetal and neonatal period. It is therefore critical to examine the toxicity of DEHP regarding the establishment of the ovarian reserve as it has not been well investigated. Methods: The ovarian cells of postnatal pups, following maternal DEHP exposure, were prepared for single cell-RNA sequencing, and the effects of DEHP on primordial follicle formation were revealed using gene differential expression analysis and single-cell developmental trajectory. In addition, further biochemical experiments, including immunohistochemical staining, apoptosis detection, and Western blotting, were performed to verify the dataset results. Results: Using single-cell RNA sequencing, we revealed the gene expression dynamics of female germ cells and granulosa cells following exposure to DEHP in mice. Regarding germ cells: DEHP impeded the progression of follicle assembly and interfered with their developmental status, while key genes such as Lhx8, Figla, and others, strongly evidenced the reduction. As for granulosa cells: DEHP likely inhibited their proliferative activity, and activated the regulation of cell death. Furthermore, the interaction between ovarian cells mediated by transforming growth factor-beta signaling, was disrupted by DEHP exposure, since the expression of GDF9, BMPR1A, and SMAD3 was affected. In addition, DNA damage and apoptosis were elevated in germ cells and/or somatic cells. Conclusion: These findings offer substantial novel insights into the reproductive toxicity of DEHP exposure during murine germ cell cyst breakdown and primordial follicle formation. These results may enhance the understanding of DEHP exposure on reproductive health.

With the simulation calibration for negative capacitor considering Landau model and multi-domain (MD) effect, MD MFIS negative capacitance field-effect transistor (NCFET) was thoroughly established for performing the simultaneous analysis of multi-variables (ferroelectric layer thickness ( ${T} _{\mathrm{ FE}}$ ), oxide layer thickness ( ${T} _{\mathrm{ OX}}$ ) and gate length ( ${L} _{\mathrm{ g}}$ )) effect on the device performance. In this study, subthreshold swing (SS) and hysteresis properties of MD-MFIS-NCFET were demonstrated by employing TCAD simulation tool. Compared with the previous reported study on single variable effect based on single-domain (SD) NCFET, the simultaneous analysis of multi-variables effect on MD-NCFET enabled to obtain better device performance and generate more comprehensive results. Convincing models were established based on the experimental data by calibration. Demonstration on the basic simulated results including the lowering SS mechanism and the multi-variables effect on MD-NCFET performance was completely presented based on the capacitance matching theory and short channel effect. With the optimal ${T} _{\mathrm{ FE}}$ and ${T} _{\mathrm{ OX}}$ , a trade-off mechanism between the SS and ${L} _{\mathrm{ g}}$ was shown with the consideration of ${L} _{\mathrm{ g}}$ scaling. Noticeable in-depth study in association with the simultaneous analysis of the multi-variables effect was carried out, indicating that the hysteresis-free SS obtained by simultaneous analysis of multi-variables was lower than that obtained by single-variable analysis. Final validation results demonstrate that the optimization proposed in this work by considering the multi-variable effect shows high compatibility with other NCFET devices, providing an instructive strategy for the high-performance NCFET optimization.

Previous works have shown that zearalenone (ZEA), as an estrogenic pollutant, has adverse effects on mammalian folliculogenesis. In the present study, we found that prolonged exposure of female mice to ZEA around the end of pregnancy, caused severe impairment of primordial follicle formation in the ovaries of newborn mice and altered the expression of many genes in oocytes as revealed by scRNA-seq. These changes were associated with morphological and molecular alterations of mitochondria, increased autophagic markers in oocytes, and epigenetic changes in the ovaries of newborn mice from ZEA exposed mothers. The latter increased expression of HDAC2 deacetylases was leading to decreased levels of H3K9ac and H4K12ac. Most of these modifications were relieved when the expression of HDAC2 in newborn ovaries was reduced by RNA interference during in vitro culture in the presence of ZEA. Such changes were also alleviated in offspring ovaries from mothers treated with both ZEA and the ubiquinone coenzyme Q10 (CoQ10), which is known to be able to restore mitochondrial activities. We concluded that impaired mitochondrial activities in oocytes caused by ZEA are at the origin of metabolic alterations that modify the expression of genes controlling autophagy and primordial follicle assembly through changes in epigenetic histones.

We report the temperature effects on the performance of ferroelectric field-effect transistor (FeFET)-based non-volatile memory (NVM) considering random grain phase variation in the ferroelectric layer through simulation. Based on the FE temperature effect model that accounts for both the transistor and ferroelectric degradation, we demonstrate that: (1) at a certain temperature, the memory window (MW) decreases with pronounced effect on low threshold voltage shift and its variation increases as the FE phase decreases; (2) with the temperature increases, the MW decreases with pronounced effect on high threshold voltage shift. The random grain phase variation further exacerbates the MW distribution, thus degrading the sensing margin. These results may provide insights for device design of high-performance FeFET-based NVMs.

In this study, the impact of interfacial charges including fixed charges and acceptor-type traps between the dielectric and the channel in negative capacitance ferroelectric FETs (FeFETs) is investigated by simulation based on the Landau–Khalatnikov model. The results reveal the separate impact of the fixed charges and acceptor-type traps on device performance degradation, respectively, including the subthreshold swing (SS), switching current (I on and I off) and threshold voltage (V T). On this basis, the combined impact of interfacial charges with the fixed charges and acceptor-type traps co-existing equally is further explored. Our findings indicate that the fixed charges play a key role in the V T and I off, while the acceptor-type traps predominate in the SS and I on. This study helps to understand the degradation mechanism of FeFETs and extend the device end-of-lifetime.

The therapeutic effect of CAR-T is often accompanied by sCRS, which is the main obstacle to the promotion of CAR-T therapy. The JAK1/2 inhibitor ruxolitinib has recently been confirmed as clinically effective in maintaining control over sCRS, however, its mechanism remains unclear. In this study, we firstly revealed that ruxolitinib significantly inhibited the proliferation of CAR-T cells without damaging viability, and induced an efficacy-favored differentiation phenotype. Second, ruxolitinib reduced the level of cytokine release not only from CAR-T cells, but also from other cells in the immune system. Third, the cytolytic activity of CAR-T cells was restored once the ruxolitinib was removed; however, the cytokines released from the CAR-T cells maintained an inhibited state to some degree. Finally, ruxolitinib significantly reduced the proliferation rate of CAR-T cells in vivo without affecting the therapeutic efficacy after withdrawal at the appropriate dose. We demonstrated pre-clinically that ruxolitinib interferes with both CAR-T cells and the other immune cells that play an important role in triggering sCRS reactions. This work provides useful and important scientific data for clinicians on the question of whether ruxolitinib has an effect on CAR-T cell function loss causing CAR-T treatment failure when applied in the treatment of sCRS, the answer to which is of great clinical significance.

Due to the complex loads on a bionic robotic fish operating underwater, the reliability of its working mechanism has an important effect on its overall performance. By establishing a virtual prototype model for the rigid–flexible coupling of a bionic robotic fish, we obtained the instantaneous load on the caudal fin of the robotic fish based on the flapping-wing propulsion theory with MATLAB. A rigid–flexible coupled virtual prototype model for the caudal fin drive as a flexible member of the bionic robotic fish was established, and dynamic simulations were conducted on the model. The simulations revealed the weak links in the drive shaft and established a damage level indicator and fatigue reliability analysis method based on damage theory. The behavior of fatigue reliability for different stress cycles was established, and a dynamic reliability design method with great engineering application value was proposed for virtual prototypes of rigid–flexible coupled underwater bionic robots by combining the virtual prototype technology of rigid–flexible coupling with the theory of flapping wing propulsion and the theory of random load fatigue reliability.

Di (2-ethylhexyl) phthalate (DEHP) is a widely used plastics additive that growing evidence indicates as endocrine disruptor able to negatively affect various reproductive processes both in female and male animals, including humans. However, the precise molecular mechanism of such actions is not completely understood. In the present study, scRNA-seq was performed on the ovaries of offspring from mothers exposed to DEHP from 16.5 days post coitum to 3 days post-partum, when the primordial follicle (PF) stockpile is established. While the histological observations of the offspring ovaries from DEHP exposed mothers confirmed previous data about a distinct reduction of oocytes enclosed in PFs. Focusing on oocytes, scRNA-seq analyses showed that the genes that mostly changed by DEHP were enriched GO terms related to histone H3-K4 methylation. Moreover, we observed H3K4me3 level, an epigenetics modification of H3 that is crucial for chromatin transcription, decreased by 40.28% (P 0.01) in DEHP-treated group compared with control. When the newborn ovaries were cultured in vitro, the DEHP effects were abolished by tamoxifen (an estrogen receptor antagonist) or overexpression of Smyd3 (one specific methyltransferase of H3K4me3), in particular, the percentage of oocyte enclosed in PF was increased by 15.39% in DEHP plus Smyd3 overexpression group than of DEHP group (P 0.01), which was accompanied by the upregulation of H3K4me3. Collectively, the present results discover Smyd3-H3K4me3 as a novel target of the deleterious ER-mediated effect of DEHP on PF formation during early folliculogenesis in the mouse and highlight epigenetics changes as prominent targets of endocrine disruptors like DEHP.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification. National Research Foundation (NRF) Published version Academia Sinica [AS-102-TPA07]; Ministry of Science and Technology of the Republic of China [MOST-106- 2119-M-001-030-MY3 to T.C.C.]; Singapore National Research Foundation Investigatorship [NRF-NRFI2017-09 to A.T.P.]. Funding for open access charge: Academia Sinica [AS-102-TPA07].

Bone marrow (BM) niche responds to chemotherapy-induced cytokines secreted from acute lymphoblastic leukemia (ALL) cells and protects the residual cells from chemotherapeutics in vivo. However, the underlying molecular mechanisms for the induction of cytokines by chemotherapy remain unknown. Here, we found that chemotherapeutic drugs (e.g., Ara-C, DNR, 6-MP) induced the expression of niche-protecting cytokines (GDF15, CCL3 and CCL4) in both ALL cell lines and primary cells in vitro. The ATM and NF-κB pathways were activated after chemotherapy treatment, and the pharmacological or genetic inhibition of these pathways significantly reversed the cytokine upregulation. Besides, chemotherapy-induced NF-κB activation was dependent on ATM-TRAF6 signaling, and NF-κB transcription factor p65 directly regulated the cytokines expression. Furthermore, we found that both pharmacological and genetic perturbation of ATM and p65 significantly decreased the residual ALL cells after Ara-C treatment in ALL xenograft mouse models. Together, these results demonstrated that ATM-dependent NF-κB activation mediated the cytokines induction by chemotherapy and ALL resistance to chemotherapeutics. Inhibition of ATM-dependent NF-κB pathway can sensitize ALL to chemotherapeutics, providing a new strategy to eradicate residual chemo-resistant ALL cells.

Arabidopsis thaliana copper-zinc superoxide dismutase 1 (AtSOD1) is a typical metalloenzyme conferring cellular protection against the excessive accumulation of toxic reactive oxygen species, and is therefore considered as a critical protein. However, the structure and function of the vital amino acids around the active site of AtSOD1 remain poorly understood. Herein, the coordinated geometry of the catalytic center in AtSOD1 was reconstructed by electron paramagnetic resonance (EPR) technique, and it was found to be composed of copper and four histidine (H) residues using site-directed mutagenesis. Analysis of the mutants showed that H45 and H62 play essential roles in the catalytic reaction, and H119 plays an accessary role in facilitating substrate or proton transfer. The results indicated that the redox change of the Cu ion and the overall enzymatic activity of the protein were sustained by the H45-Cu-H62 core structure. In contrast, the residue H47 showed nearly no effect on the SOD catalytic activity. These data should contribute to a deeper understanding of the catalytic mechanism of the enzyme, and provide a new approach for the effective molecular modification of copper/zinc SODs to facilitate further research in this field.

The fluorescent dye 1,6-diphenyl-1,3,5-hexatriene (DPH) is widely used as a probe of membrane order. We show that DPH also interacts with amyloid fibrils formed by human amylin (also known as islet amyloid polypeptide) in solution and this results in a 100-fold increase in DPH fluorescence for a sample of 20μM human amylin and 0.25 μM DPH. No increase in DPH fluorescence is observed with the non-amyloidogenic rat amylin or with freshly dissolved, non-fibrillar human amylin. The time course of amyloid formation by amylin was followed by monitoring the fluorescence of added DPH as a function of time and was similar to that monitored by the standard fluorescent probe thioflavin-T. The inclusion of DPH in the buffer did not perturb the time course of amyloid formation under the conditions examined and the time course was independent of the range of DPH concentrations tested (0.25 to 5 μM). Maximum final fluorescence intensity is observed at substoichiometric ratios of DPH to amylin. No significant increase in fluorescence was observed during the lag phase of amyloid formation, and the implications for the structure of amylin pre-fibril oligomers are discussed. Human amylin contains three aromatic residues. A triple aromatic to leucine mutant forms amyloid and DPH binds to the resulting fibrils, indicating that interactions with aromatic side chains are not required for DPH amylin amyloid interactions. DPH may be especially useful for studies on mutant amylins and other polypeptides in which changes in charged residues might complicate interpretation of thioflavin-T fluorescence.

The identification and validation of a small molecule’s targets is a major bottleneck in the discovery process for tuberculosis antibiotics. Activity-based protein profiling (ABPP) is an efficient tool for determining a small molecule’s targets within complex proteomes. However, how target inhibition relates to biological activity is often left unexplored. Here we studied the effects of 1,2,3-triazole ureas on Mycobacterium tuberculosis (Mtb). After screening ~200 compounds, we focused on two inhibitors active against both exponentially replicating and hypoxia-induced drug-tolerant Mtb that form part of a four-compound structure-activity series. The compound with negligible activity revealed potential false positive targets not addressed in other ABPP studies. Biochemistry, computational docking, and morphological analysis confirmed that active compounds preferentially inhibit serine hydrolases with cell wall and lipid metabolism functions and that disruption of the cell wall underlies biological activity. Our findings showed that ABPP identifies the targets most likely relevant to a compound’s antibacterial activity.

The natural asymmetry of cellular membranes influences their properties. In recent years, methodologies for preparing asymmetric vesicles have been developed that rely on cyclodextrin-catalyzed exchange of lipids between donor lipid multilamellar vesicles and acceptor lipid unilamellar vesicles, and the subsequent separation of the, now asymmetric, acceptor vesicles from the donors. Isolation is often accomplished by pre-loading acceptor vesicles with a high concentration of sucrose, typically 25% (w/w), and separating from donor and cyclodextrin by sucrose gradient centrifugation. We found that when the asymmetric vesicles prepared using methyl-α-cyclodextrin exchange were dispersed under hypotonic conditions using physiological salt solutions, there was enhanced leakage of an entrapped probe, 6-carboxyfluorescein. Studies with symmetric vesicles showed this was due to osmotic pressure and was specific to hypotonic solutions. Inclusion of cholesterol partly reduced leakage but did not completely eliminate it. To avoid having to use hypotonic conditions or to suspend vesicles at non-physiological solute concentrations to minimize leakage, a method for preparing asymmetric vesicles using acceptor vesicle-entrapped CsCl at a physiological ion concentration (100 mM) was developed. Asymmetric vesicles prepared with the entrapped CsCl protocol were highly resistant to 6-carboxyfluorescein leakage out of the vesicles.

Zearalenone (ZEN) is a secondary metabolite, which is mainly produced by Fusarium fungi and exists in various feeds and agricultural products. Recently, an increasing amount of data has shown that ZEN, as an estrogen-like hormone, can have harmful effects on the female reproductive system, especially on oogenesis and folliculogenesis. Breast milk is considered to be the ideal form of nutrition for infants; however, there are some records of contaminants in food, such as mycotoxins, which may be transferred from maternal blood to milk. In this study, we investigated the toxic effects of breast milk on folliculogenesis in offspring following maternal ZEN exposure. Our results showed that maternal ZEN exposure significantly inhibited the process of primordial follicle (PF) assembly and reduced the number of PFs in suckled offspring's ovaries. In addition, RNA-seq analysis showed that RIG-I-like receptor (RLRs) signaling pathways were activated after exposed to ZEN, which increased the expression levels of DNA damage (γ-H2AX, RAD51, and PARP1) and apoptosis related protein (BAX/BCL2 and Caspase-3). Finally, ZEN exposure interfered with follicular development, as evidenced by the reduced percentages of oocyte maturation and embryonic development when the offspring grew to adolescence. It is worth noting that maternal ZEN exposure disrupted the tri-methylation levels of H3K4, H3K9, and H3K27 in the offspring's oocytes. Our results indicated that maternal ZEN exposure affected ovarian development in offspring through the breast milk, which may be detrimental to their reproductive capability in adult life.

Chromium contamination has been an increasing threat to the environment and to human health. Cr(VI) and Cr(III) are the most common states of chromium. However, compared with Cr(III), Cr(VI) is more toxic and more easily absorbed, therefore, it is more harmful to human beings. Thus, the conversion of toxic Cr(VI) into Cr(III) is an accepted strategy for chromium detoxification. Here, we isolated two Bacillus cereus strains with a high chromium tolerance and reduction ability, named B. cereus D and 332, respectively. Both strains demonstrated a strong pH and temperature adaptability and survival under 8 mM Cr(VI). B. cereus D achieved 87.8% Cr(VI) removal in 24 h with an initial 2 mM Cr(VI). Cu(II) was found to increase the removal rate of Cr(VI) significantly. With the addition of 0.4 mM Cu(II), 99.9% of Cr(VI) in the culture was removed by B. cereus 332 in 24 h. This is the highest removal efficiency in the literature that we have seen to date. The immobilization experiments found that sodium alginate with diatomite was the better method for immobilization and B. cereus 332 was more efficient in immobilized cells. Our research provided valuable information and new, highly effective strains for the bioremediation of chromium pollution.

Background Considerable efforts have been devoted toward the uncovering of the molecular mechanisms underlying the maintenance of hematopoietic stem cells (HSCs) by the normal bone marrow (BM) niche. Previously, we demonstrated that a chemotherapy-induced niche, which is mainly composed of mesenchymal stem cells (MSCs), protects the residual B-cell acute lymphoblastic leukemia (B-ALL) cells from the insult of chemotherapeutic drugs. However, the roles of chemotherapy-induced niche on HSCs functions in B-ALL remain unclear. Methods We established an oncogenic N-MYC-driven B-ALL mouse model, which were subsequently treated with common chemotherapy drug cytarabine (Ara-C) and daunorubicin (DNR). After treatment, the structures of the BM niche were imaged by immunofluorescence staining. Then, the self-renewal and differentiation capability of the MSCs in the BM after Ara-C and DNR treatment were studied by ex vivo culture and gene expression analysis with RNA-seq and qRT-PCR. The effects of chemotherapy-induced niche on the hematopoietic reconstitution of HSCs were determined with series transplantation assay. Furthermore, the cell cycle, ROS level, mitochondrial membrane potential and cell apoptosis of HSCs were detected by flow cytometry. Results The MSCs, which is the main component of chemotherapy-induced BM niche, have decreased self-renewal capability and are prone to differentiate into adipocytes and chondrocytes. The results of gene expression analysis with RNA-seq showed that the MSCs have reduced levels of cytokines, including SCF, CXCL12, ANGPT1, VCAM1, and IL7. Furthermore, the chemotherapy-induced niche perturbed the hematopoietic reconstitution of HSCs in our N-MYC-driven B-ALL mouse model by promoting HSCs to enter cell cycle and increasing intracellular ROS levels and mitochondrial membrane potential of HSCs, which lead to the cell apoptosis of HSCs. Conclusions Chemotherapy-induced BM niche perturbs the hematopoietic reconstitution of HSCs by increasing intracellular ROS level and inducing cell apoptosis. Electronic supplementary material The online version of this article (10.1186/s13046-018-0859-3) contains supplementary material, which is available to authorized users.

With the use of fuzzy analytic hierarchical process (FAHP) and fuzzy transformation matrix (FTM), this research takes the policies related to intelligent green building promoted in Taiwan during 1999–2015 as subjects, so as to extract the collective intelligence of senior domain experts to evaluate the contribution weight ranking of each policy measures to achieve policy goals; in addition, with the implementation of policy measures of green building label, intelligent building label and green building material label in each year during this period, the growth and decline in evaluation cases are analyzed to testify the feasibility of policy evaluation method proposed. The results show that: 1.Use of FAHP and FTM to extract the collective intelligence from senior experts can establish policy evaluation method with reference value; 2.The additional building bulk incentive for private building, mandatory control for public building, mandatory incorporation of green public purchase into green building material are the most effective policy measures in Taiwan; 3.Implementation of control measures in the stage of design and planning for new buildings is superior to the control in the stage of operation and management in effectiveness.

UDP-glucosyltransferases (UGTs) contribute to Fusarium head blight (FHB) resistance of wheat and barley by glycosylating the deoxynivalenol (DON), which is produced by Fusarium fungus. In this study, seven alleles of barley HvUGT14077 (GenBank No.GU170356.1) were cloned using RT-PCR. Among them, HvUGT-10W1, which was isolated from a FHB resistant barley variety 10W1, was significantly up-regulated in young spikes after F. graminearum (F.g) inoculation. HvUGT-10W1::GFP was subcellularly located in the plasma membrane and cytoplasm of the wheat protoplasts. In vitro antifungal activity assay showed that the HvUGT-10W1 protein exerted obvious inhibition against the growth of F.g. The silencing of the HvUGT-10W1 by virus-induced gene silencing (VIGS) resulted in compromised FHB resistance of 10W1, which was shown by the increased infected colonies on the leaves. These indicated that the barley HvUGT-10W1 may also contribute to F.g resistance in barley and provided a potential candidate gene to develop transgenic barley with enhanced FHB resistance.