Search

Background: Amyotrophic lateral sclerosis (ALS) is a degenerative disease of the nervous system that primarily affects motor neurons. ALS type 8 (ALS8) is a familiar form with predominant involvement of lower motor neurons, tremor, and slow progression. Objective: The aim of this study was to describe sensory involvement in a cohort of ALS8 patients and compare it with the characteristics of sporadic ALS (sALS) patients and controls. Methods: We compared data from 40 ALS8 and 10 sALS patients assessed by neurological evaluation and electrophysiological study. Skin biopsies were performed in these patients and 12 controls for analysis of intraepidermal nerve fiber (IENF) density by protein gene product 9.5 (PGP 9.5) immunohistochemistry. Results: The ALS8 group was younger than the sALS group at the onset of symptoms (p < 0.05) and had a longer disease evolution (p < 0.01). Sensory abnormalities were evident in 35% of the ALS8 and 30% of the sALS patients by neurological examination, and all ALS patients presented normal sensory nerve action potentials. Despite being similar in the ALS8 and sALS groups, IENF density in the ALS8 group was lower than that in the controls (p < 0.0005). In the ALS8 group, IENF density was significantly lower in patients with impairment of vibratory sensation than in those without this finding (p < 0.05) and in females than in males (p < 0.05). Conclusion: Sensory impairment and decreased IENF density are present in ALS8 patients at a frequency and intensity similar to that in the sALS group.

Several Mendelian disorders follow an autosomal recessive inheritance pattern. Epidemiological information on many inherited disorders may be useful to guide health policies for rare diseases, but it is often inadequate, particularly in developing countries. We aimed to calculate the carrier frequencies of rare autosomal recessive Mendelian diseases in a cohort of Brazilian patients using whole exome sequencing (WES). We reviewed the molecular findings of WES from 320 symptomatic patients who had carrier status for recessive diseases. Using the Hardy-Weinberg equation, we estimated recessive disease frequencies (q2 ) considering the respective carrier frequencies (2pq) observed in our study. We calculated the sensitivity of carrier screening tests based on lists of genes from five different clinical laboratories that offer them in Brazil. A total of 425 occurrences of 351 rare variants were reported in 278 different genes from 230 patients (71.9%). Almost half (48.8%) were carriers of at least one heterozygous pathogenic/likely pathogenic variant for rare metabolic disorders, while 25.9% of epilepsy, 18.1% of intellectual disabilities, 15.6% of skeletal disorders, 10.9% immune disorders, and 9.1% of hearing loss. We estimated that an average of 67% of the variants would not have been detected by carrier screening panels. The combined frequencies of autosomal recessive diseases were estimated to be 26.39/10,000 (or ~0.26%). This study shows the potential research utility of WES to determine carrier status, which may be a possible strategy to evaluate the clinical and social burden of recessive diseases at the population level and guide the optimization of carrier screening panels.

Amyotrophic lateral sclerosis type 8 (ALS8) is an autosomal dominant form of ALS, which is caused by pathogenic variants in the VAPB gene. Here we investigated five ALS8 patients, classified as ‘severe’ and ‘mild’ from a gigantic Brazilian kindred, carrying the same VAPB mutation but displaying different clinical courses. Copy number variation and whole exome sequencing analyses in such individuals ruled out previously described genetic modifiers of pathogenicity. After deriving induced pluripotent stem cells (iPSCs) for each patient (N = 5) and controls (N = 3), motor neurons were differentiated, and high-throughput RNA-Seq gene expression measurements were performed. Functional cell death and oxidative metabolism assays were also carried out in patients’ iPSC-derived motor neurons. The degree of cell death and mitochondrial oxidative metabolism were similar in iPSC-derived motor neurons from mild patients and controls and were distinct from those of severe patients. Similar findings were obtained when RNA-Seq from such cells was performed. Overall, 43 genes were upregulated and 66 downregulated in the two mild ALS8 patients when compared with severe ALS8 individuals and controls. Interestingly, significantly enriched pathways found among differentially expressed genes, such as protein translation and protein targeting to the endoplasmic reticulum (ER), are known to be associated with neurodegenerative processes. Taken together, the mitigating mechanisms here presented appear to maintain motor neuron survival by keeping translational activity and protein targeting to the ER in such cells. As ALS8 physiopathology has been associated with proteostasis mechanisms in ER–mitochondria contact sites, such differentially expressed genes appear to relate to the bypass of VAPB deficiency.

The Covid-19 pandemic has changed the paradigms for disease surveillance and rapid deployment of scientific-based evidence for understanding disease biology, susceptibility, and treatment. We have organized a large-scale genome-wide association study in Sars-Cov-2 infected individuals in Sao Paulo, Brazil, one of the most affected areas of the pandemic in the country, itself one of the most affected in the world. Here we present the results of the initial analysis in the first 5,233 participants of the BRACOVID study.We have conducted a GWAS for Covid-19 hospitalization enrolling 3533 cases (hospitalized Covid-19 participants) and 1700 controls (non-hospitalized Covid-19 participants). Models were adjusted by age, sex and the 4 first principal components. A meta-analysis was also conducted merging BRACOVID hospitalization data with the Human Genetic Initiative (HGI) Consortia results.BRACOVID results validated most loci previously identified in the HGI meta-analysis. In addition, no significant heterogeneity according to ancestral group within the Brazilian population was observed for the two most important Covid-19 severity associated loci: 3p21.31 and Chr21 near IFNAR2. Using only data provided by BRACOVID a new genome-wide significant locus was identified on Chr1 near the genes DSTYK and RBBP5. The associated haplotype has also been previously associated with a number of blood cell related traits and might play a role in modulating the immune response in Covid-19 cases.

The coronavirus disease 2019 (COVID-19) pandemic has changed the paradigms for disease surveillance and rapid deployment of scientific-based evidence for understanding disease biology, susceptibility and treatment. We have organized a large-scale genome-wide association study (GWAS) in severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infected individuals in Sao Paulo, Brazil, one of the most affected areas of the pandemic in the country, itself one of the most affected in the world. Here, we present the results of the initial analysis in the first 5233 participants of the BRACOVID study. We have conducted a GWAS for COVID-19 hospitalization enrolling 3533 cases (hospitalized COVID-19 participants) and 1700 controls (non-hospitalized COVID-19 participants). Models were adjusted by age, sex and the 4 first principal components. A meta-analysis was also conducted merging BRACOVID hospitalization data with the Human Genetic Initiative (HGI) Consortia results. BRACOVID results validated most loci previously identified in the HGI meta-analysis. In addition, no significant heterogeneity according to ancestral group within the Brazilian population was observed for the two most important COVID-19 severity associated loci: 3p21.31 and Chr21 near IFNAR2. Using only data provided by BRACOVID, a new genome-wide significant locus was identified on Chr1 near the genes DSTYK and RBBP5. The associated haplotype has also been previously associated with a number of blood cell related traits and might play a role in modulating the immune response in COVID-19 cases.

Next-generation sequencing (NGS) has altered clinical genetic testing by widening the access to molecular diagnosis of genetically determined rare diseases. However, physicians may face difficulties selecting the best diagnostic approach. Our goal is to estimate the rate of possible molecular diagnoses missed by different targeted gene panels using data from a cohort of patients with rare genetic diseases diagnosed with exome sequencing (ES). For this purpose, we simulated a comparison between different targeted gene panels and ES: the list of genes harboring clinically relevant variants from 158 patients was used to estimate the theoretical rate of diagnoses missed by NGS panels from 53 different NGS panels from eight different laboratories. Panels presented a mean rate of missed diagnoses of 64% (range 14%-100%) compared to ES, representing an average predicted sensitivity of 36%. Metabolic abnormalities represented the group with highest mean of missed diagnoses (86%), while seizure represented the group with lowest mean (46%). Focused gene panels are restricted in covering select sets of genes implicated in specific diseases and they may miss molecular diagnoses of rare diseases compared to ES. However, their role in genetic diagnosis remains important especially for well-known genetic diseases with established genetic locus heterogeneity.

Made available in DSpace on 2022-04-29T08:46:00Z (GMT). No. of bitstreams: 0 Previous issue date: 2021-09-28 Center for Information Technology Center for Scientific Review National Institutes of Health Office of Extramural Research, National Institutes of Health Office of Research Infrastructure Programs, National Institutes of Health Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Despite the high number of individuals infected by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) who develop coronavirus disease 2019 (COVID-19) symptoms worldwide, many exposed individuals remain asymptomatic and/or uninfected and seronegative. This could be explained by a combination of environmental (exposure), immunological (previous infection), epigenetic, and genetic factors. Aiming to identify genetic factors involved in immune response in symptomatic COVID-19 as compared to asymptomatic exposed individuals, we analyzed 83 Brazilian couples where one individual was infected and symptomatic while the partner remained asymptomatic and serum-negative for at least 6 months despite sharing the same bedroom during the infection. We refer to these as “discordant couples”. We performed whole-exome sequencing followed by a state-of-the-art method to call genotypes and haplotypes across the highly polymorphic major histocompatibility complex (MHC) region. The discordant partners had comparable ages and genetic ancestry, but women were overrepresented (65%) in the asymptomatic group. In the antigen-presentation pathway, we observed an association between HLA-DRB1 alleles encoding Lys at residue 71 (mostly DRB1*03:01 and DRB1*04:01) and DOB*01:02 with symptomatic infections and HLA-A alleles encoding 144Q/151R with asymptomatic seronegative women. Among the genes related to immune modulation, we detected variants in MICA and MICB associated with symptomatic infections. These variants are related to higher expression of soluble MICA and low expression of MICB. Thus, quantitative differences in these molecules that modulate natural killer (NK) activity could contribute to susceptibility to COVID-19 by downregulating NK cell cytotoxic activity in infected individuals but not in the asymptomatic partners. Department of Pathology School of Medicine São Paulo State University (UNESP) Molecular Genetics and Bioinformatics Laboratory–Experimental Research Unit School of Medicine São Paulo State University (UNESP) Human Genome and Stem Cell Research Center University of São Paulo Department of Genetics and Evolutionary Biology Biosciences Institute University of São Paulo Centro Universitário Sudoeste Paulista Departamento de Química Faculdade de Filosofa Ciências e Letras de Ribeirão Preto Universidade de São Paulo Department of Clinical and Toxicological Analyses School of Pharmaceutical Sciences University of São Paulo Departamento de Clínica Médica Disciplina de Alergia e Imunologia Clínica Faculdade de Medicina da Universidade de São Paulo Laboratório de Imunologia Instituto do Coração (InCor) LIM19 Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (HCFMUSP) Instituto de Investigação em Imunologia - Instituto Nacional de Ciências e Tecnologia-iii-INCT Department of Pathology School of Medicine São Paulo State University (UNESP) Molecular Genetics and Bioinformatics Laboratory–Experimental Research Unit School of Medicine São Paulo State University (UNESP) CAPES: 001 FAPESP: 2013/08028-1 FAPESP: 2013/17084-0 FAPESP: 2014/50931-3 FAPESP: 2017/19223-0 FAPESP: 2019/19998-8 FAPESP: 2020/09702-1 CNPq: 465355/2014-5

Amyotrophic lateral sclerosis (ALS) is a complex disease that leads to motor neuron death. Despite heritability estimates of 52%, genome-wide association studies (GWASs) have discovered relatively few loci. We developed a machine learning approach called RefMap, which integrates functional genomics with GWAS summary statistics for gene discovery. With transcriptomic and epigenetic profiling of motor neurons derived from induced pluripotent stem cells (iPSCs), RefMap identified 690 ALS-associated genes that represent a 5-fold increase in recovered heritability. Extensive conservation, transcriptome, network, and rare variant analyses demonstrated the functional significance of candidate genes in healthy and diseased motor neurons and brain tissues. Genetic convergence between common and rare variation highlighted KANK1 as a new ALS gene. Reproducing KANK1 patient mutations in human neurons led to neurotoxicity and demonstrated that TDP-43 mislocalization, a hallmark pathology of ALS, is downstream of axonal dysfunction. RefMap can be readily applied to other complex diseases., peer-reviewed

BackgroundDespite the high number of individuals infected by SARS-CoV-2 who develop COVID-19 symptoms worldwide, many exposed individuals remain asymptomatic and/or stay uninfected. This could be explained by a combination of environmental (exposure, previous infection), epigenetic, and genetic factors. Aiming to identify genetic variants involved in SARS-CoV-2 resistance, we analyzed 86 discordant Brazilian couples where one was infected and symptomatic while the partner remained asymptomatic and seronegative despite sharing the same bedroom during the infection. The discordant partners had comparable ages, and genetic ancestry proportions.MethodsWhole-exome sequencing followed by a state-of-the-art method to call genotypes and haplotypes across the highly polymorphic MHC and LRC.ResultsWe observed a minor impact in antigen-presentation genes and KIR genes associated with resistance. Interestingly, genes related to immune modulation, mainly involved in NK cell killing activation/inhibition harbor variants potentially contributing to infection resistance. We hypothesize that individuals prone to produce higher amounts of MICA (possibly soluble), LILRB1, LILRB2, and low amounts of MICB, would be more susceptible to infection.ConclusionAccording to this hypothesis, quantitative differences in these NK activity-related molecules could contribute to resistance to COVID-19 down regulating NK cell cytotoxic activity in infected individuals but not in resistant partners.

BackgroundClinical recurrence of COVID-19 in convalescent patients has been reported, which immune mechanisms have not been thoroughly investigated. Presence of neutralizing antibodies suggests other types of immune response are involved.MethodsWe assessed the innate type I/III IFN response, T cell responses to SARS-CoV-2 with IFNγ ELISPOT, binding and neutralizing antibody assays, in two monozygotic twin pairs with one COVID-19 recurrence case.ResultsIn pair 1, four months after a first mild episode of infection for both siblings, one displayed severe clinical recurrence of COVID-19. Twin pair 2 of siblings underwent non-recurring asymptomatic infection. All fours individuals presented similar overall responses, except for remarkably difference found in specific cellular responses. Recurring sibling presented a reduced number of recognized T cell epitopes as compared to the other three including her non-recurring sibling.ConclusionsOur results suggest that an effective SARS-CoV-2-specific T cell immune response is key for complete viral control and avoidance of clinical recurrence of COVID-19. Besides, adaptive immunity can be distinct in MZ twins. Given the rising concern about SARS-CoV-2 variants that evade neutralizing antibodies elicited by vaccination or infection, our study stresses the importance of T cell responses in protection against recurrence/reinfection.Key pointsImmune parameters leading to COVID-19 recurrence/reinfection are incompletely understood. A COVID-19 recurrence case in a monozygotic twin pair is described with an intact antibody and innate type I/III Interferon response and drastically reduced number of recognized SARS-CoV-2 T cell epitopes.

Rare diseases comprise a diverse group of conditions, most of which involve genetic causes. We describe the variable spectrum of findings and clinical impacts of exome sequencing (ES) in a cohort of 500 patients with rare diseases. In total, 164 primary findings were reported in 158 patients, representing an overall diagnostic yield of 31.6%. Most of the findings (61.6%) corresponded to autosomal dominant conditions, followed by autosomal recessive (25.6%) and X-linked (12.8%) conditions. These patients harbored 195 variants, among which 43.6% are novel in the literature. The rate of molecular diagnosis was considerably higher for prenatal samples (67%; 4/6), younger children (44%; 24/55), consanguinity (50%; 3/6), gastrointestinal/liver disease (44%; 16/36) and syndromic/malformative conditions (41%; 72/175). For 15.6% of the cohort patients, we observed a direct potential for the redirection of care with targeted therapy, tumor screening, medication adjustment and monitoring for disease-specific complications. Secondary findings were reported in 37 patients (7.4%). Based on cost-effectiveness studies in the literature, we speculate that the reports of secondary findings may influence an increase of 123.2 years in the life expectancy for our cohort, or 0.246 years/cohort patient. ES is a powerful method to identify the molecular bases of monogenic disorders and redirect clinical care.

Karyotype (KT) aberrations are important prognostic factors for acute myeloid leukemia (AML); however, around 50% of cases present normal results. Single nucleotide polymorphism array can detect chromosomal gains, losses or uniparental disomy that are invisible to KT, thus improving patients’ risk assessment. However, when both tests are normal, important driver mutations can be detected by the use of next-generation sequencing (NGS). Fourteen adult patients with AML with normal cytogenetics were investigated by NGS for 19 AML-related genes. Every patient presented at least one mutation: DNMT3A in nine patients; IDH2 in six; IDH1 in three; NRAS and NPM1 in two; and TET2, ASXL1, PTPN11, and RUNX1 in one patient. No mutations were found in FLT3, KIT, JAK2, CEBPA, GATA2, TP53, BRAF, CBL, KRAS, and WT1 genes. Twelve patients (86%) had at least one mutation in genes related with DNA methylation ( DNMT3A, IDH1, IDH2, and TET2), which is involved in regulation of gene expression and genomic stability. All patients could be reclassified based on genomic status and nine had their prognosis modified. In summary, NGS offers insights into the molecular pathogenesis and biology of cytogenetically normal AML in Brazilian patients, indicating that the prognosis could be further stratified by different mutation combinations. This study shows a different frequency of mutations in Brazilian population that should be confirmed.

Context Thyroid dysgenesis (TD) is the leading cause of congenital hypothyroidism (CH). The etiology of TD remains unknown in ∼90% of cases, the most common form being thyroid ectopia (TE) (48% to 61%). Objective To search for candidate genes in hypothyroid children with TE. Design, Setting, and Participants We followed a cohort of 268 children with TD and performed whole-exome sequencing (WES) in three children with CH with TE (CHTE) and compared them with 18 thyroid-healthy controls. We then screened an additional 41 children with CHTE by Sanger sequencing and correlated the WES and Sanger molecular findings with in vitro functional analysis. Main Outcome Measures Genotyping, mutation prediction analysis, and in vitro functional analysis. Results We identified seven variants in the DUOX2 gene, namely G201E, L264CfsX57, P609S, M650T, E810X, M822V, and E1017G, and eight known variations. All children carrying DUOX2 variations had high thyroid-stimulating hormone levels at neonatal diagnosis. All mutations were localized in the N-terminal segment, and three of them led to effects on cell surface targeting and reactive oxygen species generation. The DUOX2 mutants also altered the interaction with the maturation factor DUOXA2 and the formation of a stable DUOX2/DUOXA2 complex at the cell surface, thereby impairing functional enzymatic activity. We observed no mutations in the classic genes related to TD or in the DUOX1 gene. Conclusion Our findings suggest that, in addition to thyroid hormonogenesis, the DUOX2 N-terminal domain may play a role in thyroid development.

Background Breast cancer is the most common among women worldwide, and ovarian cancer is the most difficult gynecological tumor to diagnose and with the lowest chance of cure. Mutations in BRCA1 and BRCA2 genes increase the risk of ovarian cancer by 60% and breast cancer by up to 80% in women. Molecular tests allow a better orientation for patients carrying these mutations, affecting prophylaxis, treatment, and genetic counseling. Results Here, we evaluated the performance of a panel for BRCA1 and BRCA2, using the Ion Torrent PGM (Life Technologies) platform in a customized workflow and multiplex ligation-dependent probe amplification for detection of mutations, insertions, and deletions in these genes. We validated the panel with 26 samples previously analyzed by Myriad Genetics Laboratory, and our workflow showed 95.6% sensitivity and 100% agreement with Myriad reports, with 85% sensitivity on the positive control sample from NIST. We also screened 68 clinical samples and found 22 distinct mutations. Conclusions The selection of a robust methodology for sample preparation and sequencing, together with bioinformatics tools optimized for the data analysis, enabled the development of a very sensitive test with high reproducibility. We also highlight the need to explore the limitations of the NGS technique and the strategies to overcome them in a clinically confident manner. Electronic supplementary material The online version of this article (doi:10.1186/s40246-017-0110-x) contains supplementary material, which is available to authorized users.

JAK2 mutations are rare in de novo acute myeloid leukemia (AML), and JAK2-mutated acute myeloid leukemia (AML) patients usually have a previous history of myeloproliferative neoplasms (MPNs). Current advances in laboratory techniques, such as single nucleotide polymorphism array (SNPa) and next-generation sequencing (NGS), have facilitated new insight into the molecular basis of hematologic diseases. Herein, we present two cases of JAK2-mutated AML in which both SNPa and NGS methods added valuable information. Both cases had leukemogenic collaboration, namely, copy-neutral loss of heterozygosity (CN-LOH), detected on chromosome 9. One of the cases exhibited both JAK2 and IDH2 mutations, most likely having originated as an MPN with leukemic transformation, while the other case was classified as a de novo AML with JAK2, CEBPA, and FLT3 mutations.

Amyotrophic lateral sclerosis (ALS) is a rapidly progressive fatal neurodegenerative disease affecting 1 in 350 people. The aim of Project MinE is to elucidate the pathophysiology of ALS through whole-genome sequencing at least 15,000 ALS patients and 7,500 controls at 30X coverage. Here, we present the Project MinE data browser (databrowser.projectmine.com). a unique and intuitive one-stop, open-access server that provides detailed information on genetic variation analyzed in a new and still growing set of 4,366 ALS cases and 1,832 matched controls. Through its visual components and interactive design, the browser specifically aims to be a resource to those without a biostatistics background and allow clinicians and preclinical researchers to integrate Project MinE data into their own research. The browser allows users to query a transcript and immediately access a unique combination of detailed (meta)data, annotations and association statistics that would otherwise require analytic expertise and visits to scattered resources.

© 2018 Elsevier Inc., To identify novel genes associated with ALS, we undertook two lines of investigation. We carried out a genome-wide association study comparing 20,806 ALS cases and 59,804 controls. Independently, we performed a rare variant burden analysis comparing 1,138 index familial ALS cases and 19,494 controls. Through both approaches, we identified kinesin family member 5A (KIF5A) as a novel gene associated with ALS. Interestingly, mutations predominantly in the N-terminal motor domain of KIF5A are causative for two neurodegenerative diseases: hereditary spastic paraplegia (SPG10) and Charcot-Marie-Tooth type 2 (CMT2). In contrast, ALS-associated mutations are primarily located at the C-terminal cargo-binding tail domain and patients harboring loss-of-function mutations displayed an extended survival relative to typical ALS cases. Taken together, these results broaden the phenotype spectrum resulting from mutations in KIF5A and strengthen the role of cytoskeletal defects in the pathogenesis of ALS.

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease whose pathophysiology is poorly understood. Aiming to better understand the cause of motor neuron death, the use of experimental cell-based models increased significantly over the past years. In this scenario, much knowledge has been generated from the study of motor neurons derived from embryonic stem cells and induced pluripotent stem cells. These methods, however, have advantages and disadvantages, which must be balanced on experimental design. Preclinical studies provide valuable information, making it possible to combine diverse methods to build an expanded knowledge of ALS pathophysiology. In addition to using stem cells as experimental models for understanding disease mechanism, these cells had been quoted for therapy in ALS. Despite ethical issues involved in its use, cell therapy with neural stem cells stands out. A phase I clinical trial was recently completed and a phase II is on its way, attesting the method's safety. In another approach, mesenchymal stromal cells capable of releasing neuroregulatory and anti-inflammatory factors have also been listed as candidates for cell therapy for ALS, and have been admitted as safe in a phase I trial. Despite recent advances, application of stem cells as an actual therapy for ALS patients is still in debate. Here, we discuss how stem cells have been useful in modeling ALS and address critical topics concerning their therapeutic use, such as administration protocols, injection site, cell type to be administered, type of transplantation (autologous vs. allogeneic) among other issues with particular implications for ALS therapy.

e13148 Background: Tumor mutation profiling has become a key component for orienteering the treatment of oncologic patients. A crucial step for this is the correct identification and classification of pathogenic and actionable variants. In the present work we aimed at the development and validation of a tumor mutation profiling panel, based on NGS, which uses artificial intelligence for variant annotation. Methods: We designed a hybrid capture panel, containing 366 genes to evaluate somatic SNVs, INDELs and CNVs, and to calculate TMB, using a customized bioinformatics pipeline. MSI status was determined by fragment analysis using capillary electrophoresis. Analytical performance was determined using reference cell lines. FFPE samples from 70 tumors were accessed and 53 were sequenced. Variant annotation was performed by IBM Watson for Genomics (WfG) platform. Assay performance on clinical samples was defined based on orthogonal assays using Agilent CGH+SNParray 400K (for CNVs only) and Foundation One test (Foundation Medicine) (F1). Results: Breast, colon and lung were the most common tumor origins. Fifty-three samples were successfully sequenced, while 41 of them could also be analyzed by F1 test. A summary of the assay performance is presented in Table 1. Our pipeline detected 1219 variants and 290 (23%) were classified as Pathogenic, Likely Pathogenic or Actionable, according to WfG. Thirty-five samples (66%) presented a variant that could drive the treatment, with 37.7% of samples being sensitive to targeted therapies, while 22.6% were resistant; additionally, 86% had an indication for a clinical trial. Conclusions: The developed assay presented a good overall sensitivity and allele frequency correlation, with TMB and MSI having the best rates. Comparisons with F1 had reduced values of concordance; however, SNVs and INDELs presented a similar frequency. Differences on CNVs identification may rely on distinct thresholds established by the different groups. The high percentage of samples that could benefit from mutational profiling highlights the importance of such approach in the clinical routine. Additionally, the high number of variants features the need for updated information for annotation. [Table: see text]

Duchenne muscular dystrophy (DMD) is a lethal X-linked disorder caused by null mutations in the dystrophin gene. Although the primary defect is the deficiency of muscle dystrophin, secondary events, including chronic inflammation, fibrosis, and muscle regeneration failure are thought to actively contribute to disease progression. Despite several advances, there is still no effective therapy for DMD. Therefore, the potential regenerative capacities, and immune-privileged properties of mesenchymal stromal cells (MSCs), have been the focus of intense investigation in different animal models aiming the treatment of these disorders. However, these studies have shown different outcomes according to the sources from which MSCs were obtained, which raise the question whether stem cells from distinct sources have comparable clinical effects. Here, we analyzed the protein content of the secretome of MSCs, isolated from three different sources (adipose tissue, skeletal muscle, and uterine tubes), obtained from five donors and evaluated their in vitro properties when cocultured with DMD myoblasts. All MSC lineages showed pathways enrichment related to protein metabolic process, oxidation-reduction process, cell proliferation, and regulation of apoptosis. We found that MSCs secretome proteins and their effect in vitro vary significantly according to the tissue and donors, including opposite effects in apoptosis assay, indicating the importance of characterizing MSC secretome profile before its use in animal and clinical trials. Despite the individual differences a pool of conditioned media from all MSCs lineages was able to delay apoptosis and enhance migration when in contact with DMD myoblasts.

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) Instituto Nacional de celulas-tronco em doencas geneticas (INCT) Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Muscular Dystrophy Association Instituto Paulo Gontijo (IPG) Amyotrophic lateral sclerosis (ALS) is an incurable neuromuscular disease that leads to a profound loss of life quality and premature death. Around 10% of the cases are inherited and ALS8 is an autosomal dominant form of familial ALS caused by mutations in the vamp-associated protein B/C (VAPB) gene. the VAPB protein is involved in many cellular processes and it likely contributes to the pathogenesis of other forms of ALS besides ALS8. A number of successful drug tests in ALS animal models could not be translated to humans underscoring the need for novel approaches. the induced pluripotent stem cells (iPSC) technology brings new hope, since it can be used to model and investigate diseases in vitro. Here we present an additional tool to study ALS based on ALS8-iPSC. Fibroblasts from ALS8 patients and their non-carrier siblings were successfully reprogrammed to a pluripotent state and differentiated into motor neurons. We show for the first time that VAPB protein levels are reduced in ALS8-derived motor neurons but, in contrast to over-expression systems, cytoplasmic aggregates could not be identified. Our results suggest that optimal levels of VAPB may play a central role in the pathogenesis of ALS8, in agreement with the observed reduction of VAPB in sporadic ALS. Univ Calif San Diego, Rady Childrens Hosp San Diego, Dept Cellular & Mol Med, Sch Med,Dept Pediat,Stem Cell Program, La Jolla, CA 92093 USA Univ São Paulo, Human Genome Res Ctr, Dept Genet & Evolut Biol, BR-05508090 São Paulo, Brazil Universidade Federal de São Paulo, Paulista Sch Med, São Paulo, Brazil Salk Inst Biol Studies, Genet Lab, La Jolla, CA 92037 USA Scripps Res Inst, Dept Cell Biol, La Jolla, CA 92037 USA Baylor Coll Med, Dept Mol & Human Genet, Jan & Dan Duncan Neurol Res Inst, Houston, TX 77030 USA Baylor Coll Med, Program Dev Biol, Jan & Dan Duncan Neurol Res Inst, Houston, TX 77030 USA Universidade Federal de São Paulo, Paulista Sch Med, São Paulo, Brazil Muscular Dystrophy Association: MDA185410 Web of Science

Congenital hypogonadotrophic hypogonadism (CHH) is a challenging inherited endocrine disorder characterised by absent or incomplete pubertal development and infertility as a result of the low action/secretion of the hypothalamic gonadotrophin-releasing hormone (GnRH). Given a growing list of gene mutations accounting for CHH, the application of massively parallel sequencing comprises an excellent molecular diagnostic approach because it enables the simultaneous evaluation of many genes. The present study proposes the use of whole exome sequencing (WES) to identify causative and modifying mutations based on a phenotype-genotype CHH analysis using an in-house exome pipeline. Based on 44 known genes related to CHH in humans, we were able to identify a novel homozygous gonadotrophin-releasing hormone receptor (GNRHR) p.Thr269Met mutant, which segregates with the CHH kindred and was predicted to be deleterious by in silico analysis. A functional study measuring intracellular inositol phosphate (IP) when stimulated with GnRH on COS-7 cells confirmed that the p.Thr269Met GnRHR mutant performed greatly diminished IP accumulation relative to the transfected wild-type GnRHR. Additionally, the proband carries three heterozygous variants in CCDC141 and one homozygous in SEMA3A gene, although their effects with respect to modifying the phenotype are uncertain. Because they do not segregate with reproductive phenotype in family members, we advocate they do not contribute to CHH oligogenicity. WES proved to be useful for CHH molecular diagnosis and reinforced its benefit with respect to identifying heterogeneous genetic disorders. Our findings expand the GnRHR mutation spectrum and phenotype-genotype correlation in CHH.

Some myeloproliferative neoplasm (MPN) patients harbor JAK2(V617F) mutation, and CALR mutations were recently discovered in wild type (WT) JAK2(V617F). We evaluated the frequency and type of CALR mutations, and clinical and hematological characteristics in WT JAK2(V617F) and MPL(W515K/L) MPN patients. Sixty-five patients were included: 21 with primary myelofibrosis (PMF), 21 with myelofibrosis post-essential thrombocythemia (MPET) and 23 with essential thrombocythemia (ET). Screening for JAK2(V617F) and MPL(W515K/L) were performed using real-time PCR, while CALR mutations were analyzed by fragment analysis and Sanger sequencing. JAK2(V617F) was the most frequent mutation (54.5%) and one patient (1.5%) harbored MPL(W515L). CALR mutations were present in 38.1% of PMF, 12.5% of ET and 33.3% of MPET patients. Five types of CALR mutations were detected, among which type 1 (32.1%) and type 2 (21.4%) were found to be the most common. A novel CALR mutation in a PMF patient was found. Patients carrying CALR mutations had higher platelet count and less presence of splenomegaly than JAK2(V617F), while triple negatives had higher C-reactive protein levels than CALR mutant carriers. Screening for CALR mutations and its correlation with clinical features could be useful for the characterization of MPN patients and result in its incorporation into a new prognostic score.

Amyotrophic lateral sclerosis (ALS) is a fatal and incurable disease that affects 1–2 in 100,000 individuals. Despite of the extensive efforts in basic research and the use of different animal models in preclinical studies, most of the evaluated compounds and therapies tested in the last 30 years could not be translated to humans. The advent of induced pluripotent stem cells (iPSCs) technology allowed the generation of models that are more similar to the human disease scenario, turning the patient-in-a-dish into a reality. The present document aims to summarize some of the main aspects in the new field of modeling ALS using iPSC and their further application. The distinct genetic models, the challenges and advantages of iPSC for ALS studies, their application for cell autonomous and non-cell autonomous hypothesis, the search for new compounds, and the application of such technology for therapy are some the discussed aspects. The use of iPS cells for ALS research will certainly open new horizons and bring important data in order to find new therapies for this devastating disease.

e18511 Background: Acute myeloid leukemia (AML) is characterized by infiltration of blood and bone marrow by proliferative, clonal and abnormally differentiated hematopoietic cells, affecting 3 in 100.000 adults. CEBPA is a transcription factor and a biomarker for cytogenetically normal (CN) patients. Somatic CEBPA mutations occur in 10% of CN patients and recent studies have shown that a favorable outcome may only be obtained in those carrying CEBPA mutations in different alleles ( trans). The evaluation of double mutations and the definition of bi-allelic ( trans) versus mono-allelic ( cis) status applies long protocols, involving gene cloning and sequencing, which are challenging for the diagnostic routine and negatively impacts the turnaround time (TAT). The present study aimed the development of an alternate method for the identification of double mutations in CEBPA and its CIS- TRANScondition. Methods: A previously screened sample carrying double CEBPA mutations was selected and its DNA was extracted. This sample and a DNA control were quantified and diluted in order to obtain ½ DNA molecule per well for amplification, using digital PCR rationale. Samples were distributed in 40 wells of a 96 well plate. A pair of primers was used to amplify the entire CEBPA coding region in a Real-Time PCR using SYBR green-based detection in QuantStudio System. A subset of primers was used to amplify and to sequence the regions of interest. The entire process was repeated three times, in order to prove its reproducibility. Results: The above described dilution allowed an estimation that half of the wells had no DNA and half contained a single DNA molecule. An average of 18 wells presented amplification. Five of the positive wells were used as templates for a nested PCR followed by Sanger sequencing analysis. Since each mutation was identified as the result of distinct well amplification, we concluded that the mutations were in trans. Conclusions: Our results show that it is possible to determine the CIS- TRANS allelic configuration of CEBPA dual-mutation in a cost-effective process and with a short TAT, avoiding gene cloning systems. Additionally, the process is reproducible, can be easily implemented as a routine analysis and has a great impact for AML patients’ diagnosis.

Pseudomonas aeruginosa is an important cause of infection, especially in immunocompromised patients. In this regard, strains producing carbapenemases, mainly metallo-β-lactamases (MBLs), have become a significant public health concern. Here, we present the complete annotated genome sequence (65.7 kb) of an F8-related lytic myovirus ( Pbunalikevirus genus) that infects MBL-producing P. aeruginosa strains.

In inherited cardiomyopathies, genetic testing is recognized as an enriching procedure in the diagnostic closure of a cardiac condition. Many genetic mutations have been described as pathogenically related to cardiomyopathies, turning next-generation sequencing into an extremely reliable scenario. Here we describe the validation process of a pipeline constructed with a target panel of 74 cardiomyopathy-related genes sequenced using a next-generation sequencing system. Fifty-two samples from a hypertrophic cardiomyopathy casuistic with previous molecular diagnostics (Sanger-sequenced for MYH7, MYBCP3, and TNNT2; 19 positives and 33 negatives) were processed in parallel with a HapMap reference sample (NA12878) applied for a complete panel assessment. Sequencing coverage values were satisfactory, with a mean of 250× (95% CI, 226.03–273.91) and 95.2% of target bases with a coverage of ≥10×. With a total of 567 variants, variant call sensitivity was tested in five scenarios of coverage and variant allele frequency cutoffs. Maximum achieved sensitivity was 96.7% for single-nucleotide variants and 28.5% for indels, and positive predictive values remained above 0.959 during the whole process. Inter- and intra-assay reproducibility values were 89.5% and 87.3%, respectively. After a careful assessment of analytical performance, we infer that the assay presents potential feasibility for application in diagnostic routines, with minimal time requirements and a simple bioinformatics structure.

Polycythaemia vera (PV), essential thrombocythemia (ET) and idiopathic myelofibrosis (MF), are the most common myeloproliferative neoplasms (MPN) in patients without the BCR-ABL1 gene rearrangement. They are caused by clonal expansion of haematopoietic stem cells and share, as a diagnostic criterion, the identification of JAK2V617F mutation. Classically, when other clinical criteria are present, a JAK2V617F negative case requires the analysis of Exon12_JAK2 for the diagnosis of PV, and of MPL515K/L mutations for the diagnosis of ET and MF. Here, we evaluated 78 samples from Brazilian patients suspected to have MPN, without stratification for PV, ET or MF. We found that 28 (35.9%) are JAK2V617F carriers; from the 50 remaining samples, one (2%) showed an Exon12_JAK2 mutation, and another (2%) was positive for MPLW515L mutation. In summary, the investigation of JAK2V617F, Exon12_JAK2 and MPLW515K/L was relevant for the diagnosis of 38.4% of patients suspected to have BCR-ABL1-negative MPN, suggesting that molecular genetic tests are useful for a quick and unequivocal diagnosis of MPN.

Introduction: The detection of chromosomal abnormalities in myelodysplastic syndromes (MDS) supports the diagnosis, classification, prognostic stratification, therapy option, treatment monitoring and better understanding of the biology of disease. The main chromosomal abnormalities of MDS are losses and gains of genetic material, and these changes are among the most important prognostic parameters in IPSS-R. As a consequence, major advances have been achieved in the treatment and survival of patients. However, nearly half of the patients present a normal karyotype, which prevents their further characterization. Therefore, there is the desire to increase the abnormalities detection rate by other methods. Single nucleotide polymorphisms array (SNPa), also referred to as chromosomal microarray, is a sensitive technology used to perform high-resolution genome-wide DNA losses, gains and copy-neutral loss of heterozygosity (CN-LOH). The genomic DNA is hybridized to polymorphic probes which are SNP markers and non-polymorphic probes which are copy number markers, providing information about CN-LOH and copy number alteration (CNA), respectively. Previous studies have shown that the addition of the SNPa to karyotype (KT) increases by 28% the detection rate of cytogenetic abnormalities. Objective: To substantiate this idea we describe two cases of MDS to whom SNPa added valued information to karyotype. Methods: DNA was extracted from bone marrow cells for genomic clonal evaluation. The DNA was digested, amplified, fragmented, labeled and hybridized to the chip (Affymetrix - CytoScan HD®) containing the probes. The chip was scanned to detect the signals' intensity emitted by the hybridized probes which were further analyzed by a software (ChAS) that allows visualization of CNA and CN-LOH. CNA´s analysis relies on the comparison of the obtained signals to a reference diploid DNA signal, and the difference encountered is characterized as loss or gain. CN-LOH analysis is based on two possible nucleotide signals (A or B), which are evaluated to discriminate three genotypes: AA, AB and BB. CN-LOH occurs when one allele is lost and duplicate another, resulting in genotypes AA or BB. Results: Case 1, 64y-male-patient, classified as MDS-EB (WHO 2016), Bone marrow histology showed grade II fibrosis. KT: 46,XY,del(5)(q15q33),del(17)(p11.2)[16] / 46,XY[4]. SNPa: 3p21.31p21.2 CN-LOH; 5q21.1q35.3 loss (CN:1.00); -7; +8; 12p13.33p12.3, 12p12.1p11.22, 12q22q23.3 loss (CN:1.00); -16; 17p13.3p11.2 mosaic loss (CN: 1.50) and -Y. Case 2, 74y-male-patient, classified as MDS-EB (WHO 2016), Bone marrow histology showed grade II/lll fibrosis. KT: 46,XY[15]. SNPa: 21q21.1q22.3 CN-LOH. Discussion and Conclusion: The SNPa has the advantage of detecting genomic alterations regardless of the cell cycle, even when the cell is quiescent or growth is defective. It also enables the identification of CN-LOH (also known as uniparental disomy, UPD), submicroscopic amplifications and deletions that are not detected by KT. On the other hand, SNPa does not allow the identification of balanced translocations and polyploidy. In case 1, after SNPa analysis, some chromosomal abnormalities (−7, +8, −16 and −Y) were found in sporadic metaphases during the KT reanalysis, but had not initially been described because they did not meet the criterion to be considered as a cytogenetic clone. The risk-stratification (IPSS-R) for this patient was intermediate, but the addition of the SNPa results the risk-stratification could be changed to very poor. Seven months after diagnosis the patient developed acute myeloid leukemia and died. In case 2, CN-LOH detected by SNPa could be responsible for homozygosity of mutations in critical genes located in the 21p region, such as RUNX1 that encodes a protein, which is a transcription factor critical in hematopoiesis. Indeed, sequencing of candidate genes in CN-LOH regions should be considered a priority in the search of driver mutations of MDS. Twenty-four months after diagnosis the patient died due to other non-hematologic causes. In Summary, SNPa analysis may add value to KT non-informative results and occasionally reveal cryptic abnormalities not recognized by karyotyping. However, SNPa analysis should be viewed as a complimentary tool. Acknowledgment: The SNPa test was supported by Grupo Fleury Disclosures No relevant conflicts of interest to declare.

As doenças do neurônio motor (DNM) apresentam grande variabilidade clínica e genética. A Esclerose Lateral Amiotrófica (ELA) é a forma mais comum de DNM de início tardio. Sua manifestação devastadora e incurável leva a uma profunda perda da qualidade de vida do paciente. A ELA8 é uma forma autossômica dominante de ELA familial causada por mutações no gene VAPB. A proteína VAPB está envolvida com diversos processos celulares. Nossos dados sugerem que a mutação P56S na VAPB diminui a interação dela com outras duas outras proteínas: Tubulina e GAPDH. Por terem sido previamente relacionadas a outras formas de doenças neurodegenerativas, essas proteínas são potenciais pontos-chave para desvendar a patogênese da ELA8 e de outras formas de DNM. Um número significativo de drogas testadas com sucesso em modelos animais de ELA não pôde ser transferido para os pacientes, trazendo à tona a necessidade de novos sistemas de estudo da doença. A tecnologia das iPSC torna possível a reprogramação celular para um estágio de pluripotência, permitindo a modelagem de doenças in vitro. Apresentamos um novo modelo de ELA baseado em células iPSC derivadas de pacientes com ELA8. Este modelo apresenta uma redução dos níveis de VAPB quando comparado com os controles. Contudo, não identificamos os agregados intracitoplasmáticos, característicos dos modelos de super-expressão. Mostramos pela primeira vez que células-tronco embrionárias humanas normais expressam VAPB. Adicionalmente, nossos resultados sugerem que os pacientes com ELA8 teriam uma redução dos níveis de VAPB desde o início de suas vidas e revelam a importância de modelar a ELA num background humano. Dessa forma, sugerimos a hipótese de que quantidades específicas de VAPB sejam cruciais para a viabilidade dos neurônios motores. A busca por alterações no número de cópias levou à identificação do primeiro caso de uma duplicação multi-exônica (exon10_12dup) no gene SPG4, ampliando o espectro de mutações encontradas nesse gene. Esta mutação leva à formação de um códon de parada prematuro, sugerindo que a proteína produzida não é funcional. A análise de 30 indivíduos portadores desta mutação mostrou que os homens possuem, na média, idade de início antecipada e quadro clínico mais severo. Esses dados sugerem que certas doenças neuromusculares podem ser moduladas por fatores relacionados ao background individual e ao gênero. Em suma, apoiamos a idéia de que os microtúbulos estariam envolvidos na patogênese das doenças neuromusculares, visto que tanto a VAPB quanto a Espastina interagem com estes elementos do citoesqueleto. Ainda, apresentamos um novo modelo in vitro de análise da ELA e além de justificar os estudos num background humano. The motor neuron diseases (MND) show a huge clinical and genetic variability. Amyotrophic Lateral Sclerosis (ALS) is the most common late-onset form of MND. ALSs devastating and incurable manifestation leads to a profound loss of life quality. ALS8 is an autosomal dominant form of ALS caused by mutations in the VAPB gene. The VAPB protein is involved with many cellular processes and our data suggest that P56S mutation in this protein reduces its interaction with two other proteins: Tubulin and GAPDH. Since these proteins were previously related to other types of neurodegenerative diseases they potentially are key points to reveal the processes responsible for ALS8 and other MND. A substantial number of successful drug tests in ALS animal models could not be translated to humans, showing the need of novel ALS systems. iPSC technology made possible cellular reprogramming. The iPSC technology brings new hope in this area since it can be used to model diseases in vitro. Here we present a new ALS model based on ALS8-iPSC. Compared to control samples, this model shows a reduction of VAPB levels. However, we could not identify intracytoplasmic aggregates, which characterize overexpression models. We show for the first time that human embryonic stem cells express VAPB. Combined with results showing a VAPB reduction in ALS8 samples, it suggests that ALS8 patients present diminished protein levels since the beginning of their lives and reveal the importance of modeling ALS in a human background. The search for copy number variations has led to the identification of the first multiexonic duplication (exon10_12dup) in SPG4 gene, expanding the mutation spectrum in this gene. This mutation leads to a premature stop codon, which suggests that the expressed protein is not functional. The analysis of 30 individuals who carry the mutation showed that males have on average an earlier AAO and are more severely affected. These data suggest specific neuromuscular diseases can be modulated by factors related to individual background and gender. In sum, we support the idea that microtubules can be involved with neuromuscular disorders pathogenesis, since both VAPB and Spastin interact with these cytoskeleton components. Additionally, we present a new in vitro model to ALS analysis and we justify the studies in a human background.

Amyotrophic Lateral Sclerosis (ALS) is the most common adult-onset Motor Neuron Disease (MND), characterized by motor neurons death in the cortex, brainstem and spinal cord. Ten loci linked to Familial ALS have been mapped. ALS8 is caused by a substitution of a proline by a serine in the Vesicle-Associated Membrane Protein-Associated protein-B/C (VAP-B/C). VAP-B belongs to a highly conserved family of proteins implicated in Endoplasmic Reticulum-Golgi and intra-Golgi transport and microtubules stabilization. Previous studies demonstrated that the P56S mutation disrupts the subcellular localization of VAP-B and that this position would be essential for Unfolded Protein Response (UPR) induced by VAP-B. In the present work we expressed and purified recombinant wild-type and P56S mutant VAP-B-MSP domain for the analysis of its interactions with other cellular proteins. Our findings suggest that the P56S mutation may lead to a less stable interaction of this endoplasmic reticulum protein with at least two other proteins: tubulin and GAPDH. These two proteins have been previously related to other forms of neurodegenerative diseases and are potential key points to understand ALS8 pathogenesis and other forms of MND. Understanding the role of these protein interactions may help the treatment of this devastating disease in the future.

SPG4 mutations are the most frequent cause of autosomal-dominant hereditary spastic paraplegia (HSP). SPG4 HSP is characterized by large inter- and intrafamilial variability in age at onset (AAO) and disease severity. The broad spectrum of SPG4 mutations has recently been further extended by the finding of large genomic deletions in SPG4-linked pedigrees negative for 'small' mutations. We had previously reported a very large pedigree, linked to the SPG4 locus with many affected members, which showed gender difference in clinical manifestation. Screening for copy number aberrations revealed the first case of a multi-exonic duplication (exon10_12dup) in the SPG4 gene. The mutation leads to a premature stop codon, suggesting that the protein product is not functional. The analysis of 30 individuals who carry the mutation showed that males have on average an earlier AAO and are more severely affected. The present family suggests that this HSP pathogenesis may be modulated by factors related to individual background and gender as observed for other autosomal dominant conditions, such as facio-scapulohumeral muscular dystrophy or amyloidosis. Understanding why some individuals, particularly women, are 'partially protected' from the effects of this and other pathogenic mutations is of utmost importance.

Motor neuron diseases (MNDs) are a group of neurodegenerative disorders with involvement of upper and/or lower motor neurons, such as amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), progressive bulbar palsy, and primary lateral sclerosis. Recently, we have mapped a new locus for an atypical form of ALS/MND ( atypical amyotrophic lateral sclerosis [ALS8]) at 20q13.3 in a large white Brazilian family. Here, we report the finding of a novel missense mutation in the vesicle-associated membrane protein/synaptobrevin-associated membrane protein B (VAPB) gene in patients from this family. Subsequently, the same mutation was identified in patients from six additional kindreds but with different clinical courses, such as ALS8, late-onset SMA, and typical severe ALS with rapid progression. Although it was not possible to link all these families, haplotype analysis suggests a founder effect. Members of the vesicle-associated proteins are intracellular membrane proteins that can associate with microtubules and that have been shown to have a function in membrane transport. These data suggest that clinically variable MNDs may be caused by a dysfunction in intracellular membrane trafficking. Univ São Paulo, Inst Biociencias, Dept Biol, Human Genome Res Ctr, São Paulo, Brazil Universidade Federal de São Paulo, Sch Med, Anesthesiol Pain & Intens Care Dept, São Paulo, Brazil Univ São Paulo, Hosp Rehabil Craniofacial Anomalies, Genet Serv, Bauru, Brazil Univ Edinburgh, Dept Neurosci, Edinburgh, Midlothian, Scotland Univ Calif Los Angeles, Dept Energy, Inst Mol Biol, Inst Genom & Proteom, Los Angeles, CA USA Universidade Federal de São Paulo, Sch Med, Anesthesiol Pain & Intens Care Dept, São Paulo, Brazil Web of Science

Motor neurone disease includes a heterogeneous group of disorders with motor neurone involvement, such as amyotrophic lateral sclerosis, progressive muscular atrophy, progressive bulbar palsy, and primary lateral sclerosis. Amyotrophic lateral sclerosis is the most common adult onset form of motor neurone disease and involves the lower and upper motor neurones. It is characterised by progressive muscle weakness and atrophy, with fasciculations associated with hyperreflexia and spasticity. One of the proposed mechanisms for amyotrophic lateral sclerosis is degeneration of the motor neurone because of abnormal levels of toxic products that accumulate in the cell. Death usually occurs by respiratory failure about 2–3 years after the first symptoms.1 About 10% of cases are familial amyotrophic lateral sclerosis, and several loci have been associated with this disease. To date, the only two genes identified have been the zinc–copper superoxide dismutase 1 ( SOD1 ) gene, which is located on chromosome 21 (ALS1, MIM105400), and the Alsin gene, which is located at 2q33 (ALS2, MIM 205100).2–4 Autosomal dominant forms of amyotrophic lateral sclerosis also have been linked to 18q21 (ALS3, MIM 606640), 9q34 (ALS4, MIM 602433), and 15q15.1–q21.1 (ALS5, MIM 602099) and amyotrophic lateral sclerosis–frontotemporal dementia (MIM 105550) to 9q21-22.5–9 Moreover, mutations in Dynein are associated with motor neurone degeneration and defects in retrograde transport. This gene acts in the cellular division, trafficking, and transport of several proteins, such as SOD1 .10,11 More recently, two new loci have been associated with amyotrophic lateral sclerosis. One of them, reported by three independent groups, is on chromosome 16; the other is at 20p.12–14 We report a Caucasian Brazilian family with 26 members distributed in three generations affected by a late onset autosomal dominant motor neurone disease. Clinical and neurological examination of 11 living members was compatible with the diagnosis …

After the identification of the apolipoprotein E gene isoform (APOE-epsilon4) as a risk factor for late-onset Alzheimer's disease (LOAD), the search for other polymorphisms associated with AD has been undertaken by many groups of investigators around the world. These studies have shown controversial results in many populations. More recently, a single nucleotide polymorphism in the promoter region of the brain-derived neurotrophin factor (BDNF) was found to be a risk factor for AD in two independent population studies. Here we report the analysis of this polymorphism in a group of 188 LOAD Brazilian patients compared to matched normal controls. A strong association between the APOE-epsilon4 polymorphism and LOAD was observed, but there was no significant association between this BNDF polymorphism and affected patients. The possibility that other polymorphisms or mutations in this gene play a role in the development of AD cannot be ruled out. However, the results of the present study suggest that in opposition to the two reported studies, this polymorphism does not seem to be implicated in LOAD Brazilian patients. It also shows the importance of replication studies in different populations, as susceptibility loci might differ in different ethnic groups; this will have important implications in future treatments with pharmacological agents.

To the Editor: A dominant missense mutation p.P56S in the vesicle associated membrane protein associated protein B (VAPB) gene was described in eight Brazilian families of Portuguese descent showing a wide spectrum of motor neuron diseases (MNDs) including spinal muscular atrophy (SMA) and familial amyotrophic lateral sclerosis (ALS) (ALS8) (1, 2). Haplotype analysis indicated a common ancestor with a founding event 23 generations previously, when this ancestor was still living in Portugal (3). We report the first identification of the p.P56S mutation in the VAPB gene in a non-Brazilian patient. A 43-year-old man (III-1) showed slowly progressive muscular weakness for 2 years and a family history of autosomal dominant neuromuscular disease through at least three generations (Fig 1). The patient's mother (II-1) suffered from slowly progressive muscular weakness over 30 years. No pyramidal tract signs had been observed. She was wheelchair bound 20 years after onset and died at the age of 67. The maternal grandfather (I-1) had a history of progressive muscular weakness, had died aged 57 and had six siblings. Three (I-5, I-6, I-7) suffered from muscular weakness. One cousin of the patient's mother (II-2) was diagnosed with SMA. There was no family record of Portuguese or Brazilian ancestors in at least four previous generations. All family members originated from northern Germany. Fig. 1 Family tree. Family members who are deemed affected based upon family history are marked gray. It is not known if family members I-2, I-3, I-4, I-5, I-6, I-7, and II-2 are still alive. The index patient (III-1) showed paresis of the hip flexors and extensors (Medical Research Council (MRC) grade 4/5) and fasciculations in the proximal muscles of arms, legs on both sides. Deep tendon reflexes were normal except for absent Achilles tendon reflexes. There were no pyramidal tract signs. Needle electromyography showed fasciculations and signs of chronic denervation. Nerve conduction studies of tibial nerves revealed slightly reduced amplitudes on the left. Motor evoked potentials in both tibialis anterior muscles after magnetic stimulation of the motor cortex and the lumbar roots were normal. Genomic DNA of the index case was extracted from peripheral blood and amplified using primer pairs flanking all exons and exon/intron boundaries of the VAPB gene. Amplicons were purified and sequenced directly on an ABI PRISM 310 Genetic Analyzer (PE, Applied Biosystems). The p.P56S mutation was screened in 100 German healthy controls. Haplotype analysis was performed using microsatellite markers D20S100, D20S171 and D20S173 from the ABI Prism Linkage Mapping Set kit version 2 (Applied Biosystems, Foster City, CA) as reported previously (3). The forward 5′AAGACAAGCAAAACTAAAGAACTGC3′and reverse 5′TTCCCATTACCGGTTATCCA-3′ primers were used to amplify part of 3′ UTR sequence of the tubulin beta 1 (TUBB1) gene. A polymorphism in this region was used as intrafamilial marker. Polymerase chain reaction products were analyzed using a MegaBace 1000 DNA Sequencer (Amersham Bioscience, Little Chalfont, UK). DNA from the index patient was compared to three affected individuals from three different kindreds of the Brazilian families. Sequencing revealed a heterozygous p.P56S point mutation in exon 2 of the VAPB gene. This mutation was not present in 200 German control chromosomes. Haplotype analysis revealed that this patient had a different haplotype compared to the Brazilian families (Table 1). Table 1 Haplotype comparison of the German index patient and the patients from three different Brazilian families with the p.P56S vesicle associated membrane protein associated protein B (VAPB) gene mutationa The phenotype of our index case and his mother represented late onset SMA as observed in one-third of the Brazilian patients carrying the p.P56S VAPB mutation (1). Although we cannot entirely exclude the possibility of Brazilian or Portuguese ancestors, haplotype analysis showed that our patient's mutation is not due to the same founder as in the reported Brazilian patients. Therefore, we assume that the p.P56S mutation happened in at least two independent events. Several studies failed to identify VAPB mutations in cohorts of patients with ALS (4–6)]. Mutations in the VAPB gene seem to be rare in familial MNDs. However, our case report demonstrates that the p.P56S mutation can be observed outside Brazil, and should be considered as a rare differential diagnosis in familial MNDs.