Search

Palytoxin (PLTX) and its congeners are emerging toxins held responsible for a number of human poisonings following the inhalation of toxic aerosols, skin contact, or the ingestion of contaminated seafood. Despite the strong structural analogies, the relative toxic potencies of PLTX congeners are quite different, making it necessary to isolate them individually in sufficient amounts for toxicological and analytical purposes. Previous studies showed poor PLTX recoveries with a dramatic decrease in PLTX yield throughout each purification step. In view of a large-scale preparative work aimed at the preparation of PLTX reference material, we have investigated evaporation as a critical—although unavoidable—step that heavily affects overall recoveries. The experiments were carried out in two laboratories using different liquid chromatography-mass spectrometry (LC-MS) instruments, with either unit or high resolution. Palytoxin behaved differently when concentrated to a minimum volume rather than when evaporated to complete dryness. The recoveries strongly depended on the solubility as well as on the material of the used container. The LC-MS analyses of PLTX dissolved in aqueous organic blends proved to give a peak intensity higher then when dissolved in pure water. After drying, the PLTX adsorption appeared stronger on glass surfaces than on plastic materials. However, both the solvents used to dilute PLTX and that used for re-dissolution had an important role. A quantitative recovery (97%) was achieved when completely drying 80% aqueous EtOH solutions of PLTX under N2-stream in Teflon. The stability of PLTX in acids was also investigated. Although PLTX was quite stable in 0.2% acetic acid solutions, upon exposure to stronger acids (pH &lt, 2.66), degradation products were observed, among which a PLTX methyl-ester was identified.

Interactions of novel bi-dimensional nanomaterials and live matter such as bacteria and viruses represent an extremely hot topic due to the unique properties of the innovative nanomaterials, capable in some cases to exhibit bactericide and antiviral actions. The interactions between bacteria and viruses and two dimensional nanosheets are here investigated. We extensively studied the interaction between a gram-negative bacterium, Escherichia coli, and a gram-positive bacterium, Staphylococcus aureus, with two different types of 2D nanoflakes such as MoS2, belonging to the Transition Metal Dichalcogenides family, and Graphene Oxide. The same two types of nanomaterials were employed to study their antiviral action toward the Herpes simplex virus type-1, (HSV-1). The experimental results showed different bactericide impacts as well as different antiviral power between the two nanomaterials. The experimental findings were interpreted in bacteria on the base of the Derjaguin–Landau–Verwey–Overbeek theory. A simple kinetic model of bacterial growth in the presence of the interacting nanosheets is also elaborated, to explain the observed results. The experimental results in viruses are really novel and somewhat surprising, evidencing a stronger antiviral action of Graphene Oxide as compared to MoS2. Results in viruses are complicated to quantitatively interpret due to the complexity of the system under study, constituted by virus/host cell and nanoflake, and due to the lack of a well assessed theoretical context to refer to. Thus, these results are interpreted in terms of qualitative arguments based on the chemical properties of the interactors in the given solvent medium.

The synthesis of two 5&prime, end (4-dimethylamino)azobenzene conjugated G-quadruplex forming aptamers, the thrombin binding aptamer (TBA) and the HIV-1 integrase aptamer (T30695), was performed. Their structural behavior was investigated by means of UV, CD, fluorescence spectroscopy, and gel electrophoresis techniques in K+-containing buffers and water-ethanol blends. Particularly, we observed that the presence of the 5&prime, (4-dimethylamino)azobenzene moiety leads TBA to form multimers instead of the typical monomolecular chair-like G-quadruplex and almost hampers T30695 G-quadruplex monomers to dimerize. Fluorescence studies evidenced that both the conjugated G-quadruplexes possess unique fluorescence features when excited at wavelengths corresponding to the UV absorption of the conjugated moiety. Furthermore, a preliminary investigation of the trans-cis conversion of the dye incorporated at the 5&prime, end of TBA and T30695 showed that, unlike the free dye, in K+-containing water-ethanol-triethylamine blend the trans-to-cis conversion was almost undetectable by means of a standard UV spectrophotometer.

The identification of molecules whose biological activity can be properly modulated by light is a promising therapeutic approach aimed to improve drug selectivity and efficacy on the molecular target and to limit the side effects compared to traditional drugs. Recently, two photo-switchable diastereomeric benzodiazopyrrole derivatives 1RR and 1RS have been reported as microtubules targeting agents (MTAs) on human colorectal carcinoma p53 null cell line (HCT 116 p53-/-). Their IC50 was enhanced upon Light Emitting Diode (LED) irradiation at 435&thinsp, nm and was related to their cis form. Here we have investigated the photo-responsive behavior of the acid derivatives of 1RR and 1RS, namely, d1RR and d1RS, in phosphate buffer solutions at different pH. The comparison of the UV spectra, acquired before and after LED irradiation, indicated that the trans&rarr, cis conversion of d1RR and d1RS is affected by the degree of ionization. The apparent rate constants were calculated from the kinetic data by means of fast UV spectroscopy and the conformers of the putative ionic species present in solution (pH range: 5.7&ndash, 8.0) were modelled. Taken together, our experimental and theoretical results suggest that the photo-conversions of trans d1RR/d1RS into the corresponding cis forms and the thermal decay of cis d1RR/d1RS are dependent on the presence of diazonium form of d1RR/d1RS. Finally, a photo-reaction was detected only for d1RR after prolonged LED irradiation in acidic medium, and the resulting product was characterized by means of Liquid Chromatography coupled to High resolution Mass Spectrometry (LC-HRMS) and Nuclear Magnetic Resonance (NMR) spectroscopy.

In order to expand the class of diazocompounds able to act as photo-activable microtubule inhibitors the potential of azo-heteroarenes has been explored. In this paper we focus on the synthesis, physical properties and biological effects of methyl rac-2-(2-((E)-(4-((R)-2,3-dihydroxypropoxy)phenyl) diazenyl)-1H-pyrrol-1-yl)-3-hydroxypropanoate (1a) and methyl rac-2-(2-((E)-(4-((S)-2,3-dihydroxypropoxy)phenyl) diazenyl)-1H-pyrrol-1-yl)-3-hydroxypropanoate (1b). Preliminary biological studies on the HCT-116 p53-/- cancer cell line have shown that the weak antiproliferative action of the trans isomers of these molecules, especially of 1a, is enhanced upon LED light irradiation at 435 nm. On A375 cells the molecules have not shown any effect on cell viability either in the dark or under irradiation. Moreover, the two diastereomeric components of 1a as pure stereomers have been synthesized and characterized for their chemical-physical properties. Interestingly, upon irradiation, 1a has shown an antiproliferative activity on the HCT-116 p53-/- cells greater than that of the pure stereomers, 1RR and 1RS. Tubulin polymerization assay has also demonstrated that 1a, 1RR and 1RS inhibit tubulin aggregation mostly after exposure of the samples to LED light irradiation.

Some G-quadruplex (GQ) forming aptamers, such as T30695, exhibit particularly promising properties among the potential anti-HIV drugs. T30695 G-quadruplex binds to HIV-1 integrase (IN) and inhibits its activity during 3′-end processing at nanomolar concentrations. Herein we report a study concerning six T30695-GQ variants, in which the R or S chiral glycerol T, singly replaced the thymine residues at the T30695 G-quadruplex loops. CD melting, EMSA and HMRS experiments provided information about the thermal stability and the stoichiometry of T30695-GQ variants, whereas CD and 1H NMR studies were performed to evaluate the effects of the modifications on T30695-GQ topology. Furthermore, LEDGF/p75 dependent and independent integration assays were carried out to evaluate how T loop modifications impact T30695-GQ biological activities. The obtained results showed that LEDGF/p75 adversely affects the potencies of T30695 and its variants. The IN inhibitory activities of the modified aptamers also depended on the position and on the chirality (R or S) of glycerol T loop in the GQ, mostly regardless of the G-quadruplex stabilities. In view of our and literature data, we suggest that the allosteric modulation of IN tetramer conformations by LEDGF/p75 alters the interactions between the aptamers and the enzyme. Therefore, the new T30695 variants could be suitable tools in studies aimed to clarify the HIV-1 IN tetramers allostery and its role in the integration activity.

The trans-to-cis photo-isomerization of azobenzene (AzB) and its derivatives (AzDs) is a well known process (1), that, in the course of the last two decades has been studied extensively for its high potential in a wide range of technological applications, extending from the photo-control of biological events (2) to the production of engineered materials (3). In this frame, we synthesized and studied the chemical-physical properties of two benzodiazopyrrole derivatives, named 1RS and 1RR (Figure 1). The photo-chemical properties of both molecules were studied, by 1H NMR, UV, and fast UV spectroscopy, in dark and under irradiation by LED light at 435 nm, using different solvent conditions. In methanol, UV spectra registered on samples of 1RS or 1RR kept in dark show the highest band centered at 400 nm. After irradiation, the shape and the intensity of this band strongly changed, thus evidencing that trans-cis conversion should occur in the solution. 1H NMR spectra registered before and after irradiation also show significant differences, attributable to light induced trans-cis conversion. Fast UV experiments were used to measure the time required to convert trans 1RS and 1RR to the corresponding metastable cis isomers and the half lives of the latter species. Using aqueous solutions, the half lives of both metastable cis form strongly depend on the pH of the solution. In particular the half lives of both cis 1RR and 1RS increase from ~1s at pH=5.7 to > 90s at pH=8. Notably, increasing the LED light exposition of the samples, the UV profile of 1RR in buffered solution at pH=5.7, but not that of 1RS, undergoes to irreversible change in the intensity and the position of bands. We are now studying the origin of this phenomenon.

The thrombin binding aptamer (TBA) is a 15-mer oligonucleotide (ON) which folds into a typical chair-like G-quadruplex structure containing one TGT and two TT loops.(1) It binds thrombin acting as an anticoagulant agent.(2) In our ongoing investigation on the molecular bases of the anti-thrombin activity of TBA, (3,4) we expanded TBA structure-activity relationships (SARs) by synthesizing four new analogues, named TBA-7R(Ph-NO2), TBA-7S(Ph-NO2), TBA-12R(Ph-NO2) and TBA-12S(Ph-NO2), in which, the (R) or (S)-3-(3-nitrophenoxy)propane-1,2-diol moiety replaced, one at a time, the thymine residues at positions 7 and 12. The new derivatives were then tested in vitro using the prothrombin time (PT) coagulation assay. In order to rationalize acquired SARs, a multi‐disciplinary approach including biophysical and computational studies was applied. The evaluation of the anti-thrombin activity showed that all the tested analogues are able to increase the prothrombin time of human plasma at both 2 and 20 μM concentrations. Preliminary results obtained by CD and Electrophoretic Mobility Shift Assay experiments, showed that all the synthesized aptamers are able to fold into G-quadruplex structures in buffered solutions containing Na+ or K+ ions. Analyses of CD melting curves, as well as, preliminary results obtained by computational studies, evidenced that the R or S chirality of (3-nitrophenoxy)propane-1,2-diol at 12 position affected the thermal stability of the resulting TBA-G-quadruplex, while the same effect is not observed at 7 position. Similarly, the relation between G-quadruplex thermal stability and antithrombin activity of the new analogues depends on the position (7 or 12) of the introduced glycerol derivative.

The synthesis and the structural characterization of azobenzene-conjugated GQs were formed. Firstly, we synthesized the R 4-(dimethylamino)azobenzene glycerol derivative (4-DMAzo). Trans-cis photo-isomerisation of 4-DMAzo can be induced by violet light, suitable to be used on DNA systems (1). Furthermore, the two hydroxyl groups of the glycerol linker inserted on one benzene ring are used to convert the azobenzene derivative into the appropriate phosphoramidite building block, thus allowing to the synthesis of 4-DMAzo 5'-end conjugated TBA and T30695. TBA forms a chair-like monomolecular and antiparallel GQ (2), whereas parallel-stranded monomers of T30695-GQs stack at 5'-ends to form very stable GQ dimers (3). We have explored by CD, CD melting, UV fluorescence and Electrophoresis Mobility Shift Assay (EMSA) techniques, the folding properties of the two G-quadruplex forming aptamers. From the collected data it appeared that the conjugated sequences are able to fold into GQs very similar to that of the corresponding unmodified aptamers. CD melting analyses evidenced that the difference between the melting temperatures of conjugated DMAzo-TBA-GQ and TBA is∼-6°C whereas that of DMAzo-T30695-GQ and T30695 was ∼+10°C. Furthermore, cis-trans photo-isomerisation of DMAzo moiety conjugated at 5'-end GQs, was preliminarily explored by UV-Vis spectroscopy. Spectra of free DMAzo, of 5'-DMAzo-TBA and 5'-DMAzo-T30695 were performed before and after irradiation by LED light at 435 nm. We also explored the fluorescence proprieties of the two conjugated GQ sequences in comparison to that of TBA and T30695 (4). In particular, steady-state emission spectra were acquired at 25 °C using buffered phosphate solution at pH 7.0 or ethanol/water as solvents. The preliminary results show that the intrinsic fluorescence of the GQs depends on the presence of DMAzo moiety at 5'-end as well as the medium used as solvent.

Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13.

Heterochiral oligodeoxynucleotides based on the thrombin binding aptamer sequence, namely, 5′gg3′-3′TT5′-5′ggtgtgg3′-3′TT5′-5′gg3′ (H1), 5′gg3′-3′TT5′-5′gg3′-3′TGT5′-5′gg3′-3′TT5′-5′gg3′ (H2), and 5′gGTTGgtgtgGTTGg3′ (H3), where lower case letters indicate L-residues, have been investigated in their ability to fold in G-quadruplex structures through a combination of gel electrophoresis, circular dichroism, and UV spectroscopy techniques. InH1andH2inversions of polarity sites have been introduced to control the strand direction in the loop regions. Collected data suggest that all modified sequences are able to fold in chair-like G-quadruplexes mimicking the originalTBAstructure.

Degradation of nucleic acids in biological environments is the major drawback of the therapeutic use of aptamers. Among the approaches used to circumvent this negative aspect, the introduction of 3'-3' inversion of polarity sites at the sequence 3'-end has successfully been proposed. However, the introduction of inversion of polarity at the ends of the sequence has never been exploited for G-quadruplex forming aptamers. In this communication we describe CD, UV, electrophoretic and biochemical investigations concerning thrombin binding aptamer analogues containing one or two inversions of polarity sites at the oligonucleotide ends. Data indicate that, in some cases, this straightforward chemical modification is able to improve, at the same time, the thermal stability, affinity to thrombin and nuclease resistance in biological environments, thus suggesting its general application as a post-SELEX modification also for other therapeutically promising aptamers adopting G-quadruplex structures.

The novel tetrasubstituted pyrrole derivatives 8g, 8h, and 8i showed selective cytotoxicity against M14 melanoma cells at low micromolar concentration. Structure???activity relationships (SARs) indicated the presence of three aromatic substituents on the pyrrole core as necessary for biological activity. Computational studies strongly suggest that the peculiar 3D orientation of these substituents is able to reproduce the hydrophobic side chains in LxxLL-like protein recognition motifs. Biological results showed altered p53 expression and nuclear translocation in cells sensitive to the compounds, suggesting p53 involvement in their anticancer mechanism of action. Unfortunately, because of poor solubility of the active analogues, it was not possible to perform further investigation by NMR techniques. Pharmacophore models were generated and used to perform 3D searches in molecular databases. Results indicated that two compounds share the same pharmacological profile and the same pharmacophoric features with our new derivatives, and one of them inhibited MDM2???MDM4 heterodimer formation.

Background The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Methods Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l -residues or both l -residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. Results CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. Conclusions A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. General significance Modified TBA analogues containing l -residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled “G-quadruplex” Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.

Human α-thrombin (TB) is a serine protease with a crucial role in coagulation and hemostasis. The monitoring of the TB level in blood serum could be of great importance in order to prevent serious damage to human health. In this work, an aptasensor is realized by in situ synthesis of a 17-mer Thrombin Binding Aptamer analogue (TBATT) on silanized macroporous silica (PSi). The interaction between TBATT and TB at different concentrations is monitored by a label-free optical method, spectroscopic reflectometry, and quantified by fast Fourier transform (FFT) analysis. A TBATT-TB affinity constant of 14 ± 8 nM and limit of detection of 1.5 ± 0.3 nM are demonstrated. The selectivity and reversibility of the aptasensor are also proved.

In this paper, we report the investigations, based on NMR, molecular modelling, CD measurements and electrophoresis, of thrombin binding aptamer (TBA) analogues containing an extra-residue at the 3′-end or at both the ends of the original TBA sequence, linked through 3′–3′ or 5′–5′ phosphodiester bonds. The data indicate that most of the modified aptamers investigated adopt chair-like G-quadruplex structures very similar to that of the TBA and that stacking interactions occur between the 3′–3′ or 5′–5′ extra residues and the deoxyguanosines of the upper G-tetrad. A comparison of the thermodynamic data of TBA-A and TBA-T containing a 3′–3′ extra residue and their canonical versions clearly indicates that the 3′–3′ phosphodiester bond is fundamental in endowing the modified aptamers with remarkably higher thermal stabilities than the original TBA.

An acyclic pyrimidine analogue, containing a five member cycle fused on the pyrimidine ring, was synthesized and introduced at position 7 or 12 of the 15-mer oligodeoxynucleotide GGTTGGTGTGGTTGG, known as Thrombin Binding Aptamer (TBA). Characterization by 1H-NMR and CD spectroscopies of the resulting aptamers, TBA-T7b and TBA-T12b, showed their ability to fold into the typical antiparallel chair-like G-quadruplex structure formed by TBA. The apparent CD melting temperatures indicated that the introduction of the acyclic residue, mainly at position 7, improves the thermal stability of resulting G-quadruplexes with respect to TBA. The anticoagulant activity of the new molecules was then valued in PT assay and it resulted that TBA-T7b is more potent than TBA in prolonging the clotting time. On the other hand, in purified fibrinogen assay the thrombin inhibitory activity of both modified sequences resulted lower than that of TBA using human enzyme, while the potency trend was again reversed using bovine enzyme. Obtained structure-activity relationships were investigated by structural and computational studies. Taken together, our results reveal the active role of TBA residues T7 and T12 and the relevance of some amminoacids located in the anion binding exosite I of the protein in aptamer-thrombin interaction.

We report here an efficient solid-phase synthesis of N -1-alkyl-substituted analogues of cyclic inosine-diphosphate-ribose (cIDPR), a mimic of cyclic ADP-ribose (cADPR). Our synthetic strategy makes use of a polystyrene support to which inosine was bonded through a 2′,3′-acetal linkage. Insertion of a ω-hydroxy-polymethylene chain of variable length on N-1, followed by conversion into N -1-alkylinosine-bis-phosphate derivatives and cyclization, allowed to obtain analogues of cIDPR of various ring size. The cyclization step was carried out both in solid-phase and in solution by pyrophosphate bond formation. The effect of the N -1-polymethylene chain length on the cyclization yields as well as the reaction conditions, which led to the solid-phase pyrophosphate bond formation, were thoroughly investigated.

Here we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy, molecular modelling, differential scanning calorimetry and prothrombin time assay, on analogues of the thrombin binding aptamer (TBA) in which individual thymidines were replaced by 5-fluoro-2'-deoxyuridine residues. The whole of the data clearly indicate that all derivatives are able to fold in a G-quadruplex structure very similar to the 'chair-like' conformation typical of the TBA. However, only ODNs TBA-F4: and TBA-F13: have shown a remarkable improvement both in the melting temperature (ΔTm ≈ +10) and in the anticoagulant activity in comparison with the original TBA. These findings are unusual, particularly considering previously reported studies in which modifications of T4 and T13 residues in TBA sequence have clearly proven to be always detrimental for the structural stability and biological activity of the aptamer. Our results strongly suggest the possibility to enhance TBA properties through tiny straightforward modifications.

The chemical synthesis of bunch-ODN I and II prone to form quadruplex structures containing G-and T-tetrads has been reported. Structural studies were performed by 1H-NMR and CD melting experiments.

The synthesis and preliminary structural studies of ODNs A8MeGGGT and TA8MeGGGT, where A8Me represents 2'-deoxy-8-methyladenosine, are reported.

A new analogue of cyclic inosine diphosphate ribose (cIDPR), in which the N-1 and N-9 ribosyl moieties were substituted by a carbocyclic moiety and a hydroxyl-alkyl chain, has been synthesized and characterized.

The three oligodeoxyribonucleotides (ODNs) a – c , having the telomeric repeat d(TTAGGG) 4 sequence and incorporating γ-hydroxypropano deoxyguanosine at different positions, were synthesized. Gel electrophoresis and CD analyses indicated that the ODNs assume monomolecular quadruplex structures in Na + and in K + buffers. The T m values, obtained by CD melting experiments, showed that the presence of the acrolein-dG adduct into the ODN b decreases the thermal stability of the monomolecular quadruplex structure in Na + solution, whereas for a and c no significant effect could be detected in the same experimental conditions. On the contrary, all ODNs a – d show the same behaviour in K + buffer. These findings are briefly discussed.

Oligonucleotides with a 3′−3′ inversion of polarity, containing an acridine moiety attached to the nucleotide base flanking the 3′−3′ phosphodiester bond, have been synthesised, characterised and used to form alternate-strand triple helix complexes. These have been investigated by UV melting studies and CD experiments. (© Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2004)

A new analogue 1 of cADPR was prepared through a synthetic pathway starting from 6-chloropurine 2 which underwent two sequential alkylations at N-9 and N-1, with formation of the intermediate 8 . The successive bis-phosphorylation of hydroxyalkyl functions, followed by deprotection and reprotection steps, afforded the derivative 13 , the substrate for the cyclization reaction. This was carried out according to the Matsuda procedure and led to the intramolecular pyrophosphate bond formation, thus affording 14 . The final deprotection of 14 , in alkaline conditions, gave the target compound 1 in good yield.

In this article we report an investigation concerning analogues of the thrombin binding aptamer (TBA) in which thymidines have been replaced, one at a time, by the unusual residue 5-hydroxymethyl-2'-deoxyuridine (hmU) that differs from the canonical thymidine only in the presence of an hydroxyl on the 5-methyl group. NMR and CD data clearly indicate that all TBA derivatives preserve the ability to fold in the original ''chair-like'' structure. The presence of the hmU residue doesn't affect notably thermal stability of the modified aptamers compared to the parent one, except the analogue H9 for which a more marked increase of the melting temperature has been observed. Although all TBA analogues have shown decreased affinities to thrombin, derivatives H3, H7 and H9 have proven to possess improved anticoagulant activities in comparison with the parent aptamer. Our data open-up the possibility to enhance the TBA biological properties, just introducing small chemical modifications.

Herein, we report optically pure modified acyclic nucleosides as ideal probes for aptamer modification. These new monomers offer unique advantages in exploring the role played in thrombin inhibition by a single residue modification at key positions of the TBA structure.

Reductive amination of 3',5'-O-(tetraisopropyldisilyloxane-1,3-diyl)-2'-deoxy-5-formyluridine with several aliphatic and aromatic amines, in various solvents, is described. In the case of aliphatic amines, the expected C-5 substituted methylamino pyrimidine nucleosides are formed along with by-products deriving from opening of the pyrimidine ring. Relative amounts of the by-products depend upon the polarity of the solvent employed.

A new thymidine analogue, bearing a ferrocenemethyl residue at the N-3 position of the base, was synthesized in high yields via Mitsunobu reaction of ferrocenemethanol with sugar protected thymidine, converted into the corresponding 3′-phosphoramidite and incorporated into oligonucleotides. Duplex and triplex formation experiments, evaluated by UV and CD spectroscopy, showed a dramatic decrease of the affinity towards complementary single strands, while for triplexes, the introduction of a ferrocene residue in the third strand resulted in higher melting temperatures, associated with a reduced content of triplex structure.

The chemical synthesis of several G-rich bunch-oligonucleotides and the structural characterization of the corresponding monomolecular G-quadruplexes (I-IV) have been reported. The synthetic method allow the achievement of monomolecular DNA quadruplex structures having unusual and predeterminable oligodeoxyribonucleotide (ODN) strand orientation.

In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate l residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions.

The antiviral activity of certain acyclic nucleosides drew our attention to the fact that the replacement of the furanose ring by an alkyl group bearing hydroxyl(s) could be a useful structural modification to modulate the biological properties of those nucleosides. Herein, we report on the synthesis of some novel acadesine analogues, where the ribose moiety is mimicked by a d-ribityl or by a hydroxybutyl chain.

Oligonucleotides with a 3′-3′ inversion of polarity and containing an acridine group attached to nucleotide base flanking the 3′-3′ phosphodiester bon have been synthesized, characterized and used as third strand in alternate triple helix formation. CD melting studies and molecular mechanics calculations have been carried out to investigate these triplex structures.

The solid-phase synthesis of the first example of a new diphosphate AICAR derivative is reported. The new substance is characterized by the presence of a 5'-phosphate group while a second phosphate moiety is installed on a 5-hydroxypentyl chain attached to the 4-N-position of AICAR. Cyclization of the diphosphate derivative by pyrophosphate bond formation allowed for the formation of a novel AICAR-based cyclic ADP-ribose (cADPR) mimic.

Previous studies indicate that some perylene bisimide derivatives can drive the assembly of DNA G-quadruplexes, thus suggesting the possible advantage in the adoption of perylene-conjugated G-rich oligonucleotides in biological and biotechnological applications. Nevertheless, the typical poor solubility of perylene bisimides strongly limits the number of suitable chemical strategies to prepare perylene-conjugated oligonucleotides. In order to overcome these difficulties, we employed the earlier described core twisted perylene derivatives possessing unique optical and electronic properties, besides good solubility in common solvents. As a first result, the large-scale synthesis of a new dibromoperylene derivative (PEOEBr) phosphoramidite building block is herein reported. Furthermore, the structural behavior of the conjugated PEOEBr-GGGTTAGGG (HTRp2) human telomeric repeat was investigated by using CD, UV, fluorescence, and gel electrophoresis techniques in desalted water and in K(+)- and Na(+)-containing buffers. We observed that the peculiar property of PEOEBr moieties to form dimers instead of extended aggregates drives the HTRp2 strands toward dimerization and mainly promotes the formation of quadruplex species having both the 5'-ends located at the same side of the structures. However, the counterions present in solutions (K(+) or Na(+)) as well as the strand concentration, also contribute to influence the topology and the stoichiometry of formed structures. Furthermore, unlike the unmodified sequence GGGTTAGGG (HTR2), HTRp2 strands quickly associate into G-quadruplexes even in desalted water, as assessed by CD experiments.

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".

A high-yield synthesis of [1-15N]-2′-deoxyinosine (5), [4-15N]-2′-deoxyAICAR (7), and [1-15N]-2′-deoxyguanosine (10) from 2′-deoxyinosine (1) using relatively low expensive 15NH3 as 15N source is described. The method exploits 2-C reactivity of 2′-deoxyinosine (1) to obtain its 15N-labelled counterpart, through [1-15N]-2′-deoxyinosine (5), and successively, [4-15N]-2′-deoxyAICAR (7). [1-15N]-2′-Deoxyguanosine (10) can be prepared as well, through an improved cyclization procedure. No protection of sugar hydroxyl groups is required at any stage.

Ribosylation and glucosylation of the base residues of inosine and uridine have been efficiently achieved using Mitsunobu reaction, leading to the N-1 and 6-O-glycosylinosine and N-3-glycosyluridine derivatives, all with β configuration at the glycosidic carbon. The unprecedented 5-amino-1-(β-D-ribofuranosyl)imidazole-4-[N-(β-D-glucopyranosyl)carboxamide] has also been synthesised.

G-quadruplexes are characteristic structural arrangements of guanine-rich DNA sequences that abound in regions with relevant biological significance. These structures are highly polymorphic differing in the number and polarity of the strands, loop composition, and conformation. Furthermore, the cation species present in solution strongly influence the topology of the G-quadruplexes. Recently, we reported the synthesis and structural studies of new G-quadruplex forming oligodeoxynucleotides (ODNs) in which the 3'- and/or the 5'-ends of four ODN strands are linked together by a non-nucleotidic tetra-end-linker (TEL). These TEL-ODN analogs having the sequence TGGGGT are able to form parallel G-quadruplexes characterized by a remarkable high thermal stability. We report here an investigation about the influence of the reduction of the TEL size on the molecularity, topology, and stability of the resulting TEL-G-quadruplexes using a combination of circular dichroism (CD), CD melting, (1)H NMR spectroscopy, gel electrophoresis, and molecular modeling data. We found that all TEL-(TGGGGT)(4) analogs, regardless the TEL size and the structural orientation of the ODN branches, formed parallel TEL-G-quadruplexes. The molecular modeling studies appear to be consistent with the experimental CD and NMR data revealing that the G-quadruplexes formed by TEL-ODNs having the longer TEL (L1-4) are more stable than the corresponding G-quadruplexes having the shorter TEL (S1-4). The relative stability of S1-4 was also reported. (c) 2009 Wiley Periodicals, Inc. Biopolymers 91: 466-477, 2009.

Herein we report an efficient solid-phase synthesis of some N-1-alkyl-substituted analogs of cyclic inosine-diphosphate-ribose (cIDPR), a mimic of cyclic ADP-ribose (cADPR) which has been described as an agonist of the cADPR/Ca(2+) signalling system. The proposed synthetic strategy uses a polystyrene support bearing inosine by a 2',3'-acetal linkage which is converted into several N-1-alkylinosine-bis-phosphate derivatives which in turn were cyclized by a solid-phase pyrophosphate bond formation.

A new analogue of cyclic inosine diphosphate ribose (cIDPR), in which the N-1 and N-9 ribosyl moieties were substituted by an alkyl moiety and an hydroxy-alkyl chain, has been synthesized and characterized.