Search

The continuing outbreaks of ebola virus disease highlight the ongoing threat posed by filoviruses. Fortunately, licensed vaccines and therapeutics are now available for Zaire ebolavirus. However, effective medical countermeasures, such as vaccines for other filoviruses such as Sudan ebolavirus and the Marburg virus, are presently in early stages of development and, in the absence of a large outbreak, would require regulatory approval via the U.S. Food and Drug Administration (FDA) Animal Rule. The selection of an appropriate animal model and virus challenge isolates for nonclinical studies are critical aspects of the development program. Here, we have focused on the recommendation of challenge isolates for Sudan ebolavirus and Marburg virus. Based on analyses led by the Filovirus Animal and Nonclinical Group (FANG) and considerations for strain selection under the FDA Guidance for the Animal Rule, we propose prototype virus isolates for use in nonclinical challenge studies.

The classification of smallpox by the U.S. Centers for Disease Control and Prevention (CDC) as a Category A Bioterrorism threat agent has resulted in the U.S. Government investing significant funds to develop and stockpile a suite of medical countermeasures to ameliorate the consequences of a smallpox epidemic. This stockpile includes both vaccines for prophylaxis and antivirals to treat symptomatic patients. In this manuscript, we describe the path to approval for the first therapeutic against smallpox, identified during its development as ST-246, now known as tecovirimat and TPOXX(®), a small-molecule antiviral compound sponsored by SIGA Technologies to treat symptomatic smallpox. Because the disease is no longer endemic, the development and approval of TPOXX(®) was only possible under the U.S. Food and Drug and Administration Animal Rule (FDA 2002). In this article, we describe the combination of animal model studies and clinical trials that were used to satisfy the FDA requirements for the approval of TPOXX(®) under the Animal Rule.

The elimination of smallpox as an endemic disease and the obvious ethical problems with clinical challenge requires the efficacy evaluation of medical countermeasures against smallpox using the FDA Animal Rule. This approach requires the evaluation of antiviral efficacy in an animal model whose infection recapitulates the human disease sufficiently well enough to provide predictive value of countermeasure effectiveness. The narrow host range of variola virus meant that no other animal species was sufficiently susceptible to variola to manifest a disease with predictive value. To address this dilemma, the FDA, after a public forum with virologists in December 2011, suggested the development of two animal models infected with the cognate orthopoxvirus, intradermal infection of rabbits and intranasal infection of mice, to supplement the non-human primate models in use. In this manuscript, we describe the development of an intradermal challenge model of New Zealand White rabbits with rabbitpox virus (RPXV) for poxvirus countermeasure evaluation. Lethality of RPXV was demonstrated in both 9 and 16-weeks old rabbits with an LD50 < 10 PFU. The natural history of RPXV infection was documented in both ages of rabbits by monitoring the time to onset of abnormal values in clinical data at a lethal challenge of 300 PFU. All infected animals became viremic, developed a fever, exhibited weight loss, developed secondary lesions, and were euthanized after 7 or 8 days. The 16-weeks RPXV-infected animals exhibiting similar clinical signs with euthanasia applied about a day later than for 9-weeks old rabbits. For all animals, the first two unambiguous indicators of infection were detection of viral copies by quantitative polymerase chain reaction and fever at 2 and 3 days following challenge, respectively. These biomarkers provide clinically-relevant trigger(s) for initiating therapy. The major advantage for using 16-weeks NZW rabbits is that older rabbits were more robust and less subject to stress-induced death allowing more reproducible studies.

In 2007, the United States– Food and Drug Administration (FDA) issued guidance concerning animal models for testing the efficacy of medical countermeasures against variola virus (VARV), the etiologic agent for smallpox. Ectromelia virus (ECTV) is naturally-occurring and responsible for severe mortality and morbidity as a result of mousepox disease in the murine model, displaying similarities to variola infection in humans. Due to the increased need of acceptable surrogate animal models for poxvirus disease, we have characterized ECTV infection in the BALB/c mouse. Mice were inoculated intranasally with a high lethal dose (125 PFU) of ECTV, resulting in complete mortality 10 days after infection. Decreases in weight and temperature from baseline were observed eight to nine days following infection. Viral titers via quantitative polymerase chain reaction (qPCR) and plaque assay were first observed in the blood at 4.5 days post-infection and in tissue (spleen and liver) at 3.5 days post-infection. Adverse clinical signs of disease were first observed four and five days post-infection, with severe signs occurring on day 7. Pathological changes consistent with ECTV infection were first observed five days after infection. Examination of data obtained from these parameters suggests the ECTV BALB/c model is suitable for potential use in medical countermeasures (MCMs) development and efficacy testing.

Highly attenuated modified vaccinia virus Ankara (MVA) is being considered as a safer alternative to conventional smallpox vaccines such as Dryvax or ACAM 2000, but it requires higher doses or more-frequent boosting than replication-competent Dryvax. Previously, we found that passive transfer of A27 antibodies can enhance protection afforded by vaccinia immune globulin (VIG), which is derived from Dryvax immunized subjects. Here we investigated whether protective immunity elicited by MVA could be augmented by prime-boost or combination immunizations with a recombinant A27 (rA27) protein. We found that a prime/boost immunization regimen with rA27 protein and MVA, in either sequence order, conferred protection to mice challenged with a lethal dose of vaccinia virus strain Western Reserve (VV-WR), compared to no protection after immunizations with a similar dose of either MVA or rA27 alone. Moreover, protection was achieved in mice primed simultaneously with combination of both MVA and rA27 in different vaccination routes, without any boost, even though MVA or rA27 alone at the same dose gave no protection. These findings show that rA27 can synergize with MVA to elicit robust protection that has a dose-sparing effect on MVA and can accelerate protection by eliminating the need for a booster dose.

The immune response elicited by LC16m8, a candidate smallpox vaccine that was developed in Japan by cold selection during serial passage of the Lister vaccine virus in primary rabbit kidney cells, was compared to Dryvax in a mouse model. LC16m8 carries a mutation resulting in the truncation of the B5 protein, an important neutralizing target of the extracellular envelope form of vaccinia virus (EV). LC16m8 elicited a broad-spectrum immunoglobulin G (IgG) response that neutralized both EV and the intracellular mature form of vaccinia virus and provoked cell-mediated immune responses, including the activation of CD4 + and CD8 + cells, similarly to Dryvax. Mice inoculated with LC16m8 had detectable but low levels of anti-B5 IgG compared to Dryvax, but both Dryvax and LC16m8 sera neutralized vaccinia virus EV in vitro. A truncated B5 protein (∼8 kDa) was expressed abundantly in LC16m8-infected cells, and both murine immune sera and human vaccinia virus immunoglobulin recognized the truncated recombinant B5 protein in antigen-specific enzyme-linked immunosorbent assays. At a high-dose intranasal challenge (100 or 250 50% lethal doses), LC16m8 and Dryvax conferred similar levels of protection against vaccinia virus strain WR postvaccination. Taken together, the results extend our current understanding of the protective immune responses elicited by LC16m8 and indicate that the relative efficacy in a mouse model rivals that of previously licensed smallpox vaccines.

The licensed smallpox vaccine Dryvax is used as the standard in comparative immunogenicity and protection studies of new smallpox vaccine candidates. Although the correlates of protection against smallpox are unknown, recent studies have shown that a humoral response against the intracellular mature virion and extracellular enveloped virion (EV) forms of vaccinia virus is crucial for protection. Using a recombinant Semliki Forest virus (rSFV) vector system, we expressed a set of full-length EV proteins for the development of EV antigen-specific enzyme-linked immunosorbent assays (ELISAs) and the production of monospecific antisera. The EV-specific ELISAs were used to evaluate the EV humoral response elicited by Dryvax and the nonreplicating modified vaccinia virus Ankara (MVA) in mouse vaccination experiments comparing doses and routes of vaccination. Quantitatively similar titers of antibodies against EV antigens A33R, A56R, and B5R were measured in mice vaccinated with Dryvax and MVA when MVA was administered at a dose of 10 8 plaque-forming units. Further, a substantial increase in the EV-specific antibody response was induced in mice inoculated with MVA by using a prime-boost schedule. Finally, we investigated the abilities of the EV-expressing rSFV vectors to elicit the production of polyclonal monospecific antisera against the corresponding EV proteins in mice. The monospecific serum antibody levels against A33R, A56R, and B5R were measurably higher than the antibody levels induced by Dryvax. The resulting polyclonal antisera were used in Western blot analysis and immunofluorescence assays, indicating that rSFV particles are useful vectors for generating monospecific antisera.

Using vaccinia immune globulin (VIG), a high-titer antibody preparation from immunized subjects, we demonstrate that the humoral immune response in humans is directed against numerous antigens in the Dryvax vaccine strain. Western blot and immunoprecipitation analyses revealed highly antigenic proteins associated with both the extracellular enveloped virus and intracellular mature virus forms. The modified vaccinia virus Ankara (MVA), a new generation smallpox vaccine that is attenuated for replication in humans, expresses most, but not all, of the major vaccinia antigens recognized by antibodies in VIG, lacking the highly antigenic protein corresponding to the A-type inclusion body protein. Since new-generation smallpox vaccines such as MVA will require extensive comparison to traditional smallpox vaccines in animal models of immunogenicity and protection, we compared the vaccinia virus antigens recognized by VIG to those recognized by sera from Dryvax and MVA immunized mice. The humoral immune response in immunized mice is qualitatively similar to that in humans.

In anticipation of large-scale smallpox vaccination, clinical trials of new vaccine candidates with improved safety profiles, and new vaccinia immune globulin (VIG) products, there is an immediate need to develop new assays to measure vaccinia-specific immune responses. The classical assay to measure vaccinia neutralization, the plaque-reduction neutralization test (PRNT), is slow, labor intensive, and difficult to validate and transfer. Here we describe the development of a novel vaccinia-neutralization assay based on the expression of a reporter gene, beta-galactosidase (beta-Gal). Using a previously constructed vaccinia-beta-Gal recombinant virus, vSC56, we developed a neutralization assay that is rapid, sensitive, and reproducible. The readout is automated. We show that the neutralizing titers, ID(50), for several VIG products measured by our assay were similar to those obtained by PRNTs. A new Food and Drug Administration VIG standard was established for distribution to other laboratories. The new assay will serve as an important tool both for preclinical and clinical trials of new smallpox vaccines and for evaluation of therapeutic agents to treat vaccine-associated adverse reactions.

New stockpiles of smallpox vaccine are required as a contingency for protecting civilian and military personnel against deliberate dissemination of smallpox virus by terrorists or unfriendly governments. The smallpox vaccine in the current stockpile consists of a live animal poxvirus (Vaccinia virus [VACV]) that was grown on the skin of calves. Because of potential issues with controlling this earlier manufacturing process, which included scraping VACV lesions from calfskin, new vaccines are being developed and manufactured by using viral propagation on well-characterized cell substrates. We describe, from a regulatory perspective, the various strains of VACV, the adverse events associated with calf lymph-propagated smallpox vaccine, the issues regarding selection and use of cell substrates for vaccine production, and the issues involved in demonstrating evidence of safety and efficacy.

A vaccinia virus-bacteriophage T7 RNA polymerase hybrid transient expression vector has been developed for complementation analysis of late gene functions in vaccinia virus. The conditionally defective virus ts21 was modified to express the bacteriophage T7 RNA polymerase. The derived virus, vtsT7, was conditionally defective in viral late gene expression but produced high levels of a target protein under the control of a T7 promoter at non-permissive temperatures. The level of beta-galactosidase expression under the control of a T7 promoter was slightly lower in vtsT7 infections than those with the prototypical T7 RNA polymerase vector vTF7.3. However, the levels of expression for the human immunodeficiency virus envelope gene, a protein which undergoes post-translational modification, was slightly higher in vtsT7 infections, suggesting that some proteins may be expressed better in the absence of vaccinia virus late gene expression. Infections using vtsT7 at a low m.o.i. at 39 degrees C resulted in the accumulation of high molecular mass, non-linear replicative intermediates of vaccinia virus DNA replication and high levels of expression of a transfected gene proximal to a T7 promoter. The virus vtsT7 provides a means for the analysis of potential trans-acting factors participating in vaccinia virus late processes such as resolution of DNA replicative intermediates.

Whole-body bioimaging was employed to study the effects of passive immunotherapies on lethality and viral dissemination in BALB/c mice challenged with recombinant vaccinia viruses expressing luciferase. WRvFire and IHD-J-Luc vaccinia viruses induced lethality with similar times to death following intranasal infection, but WRvFire replicated at higher levels than IHD-J-Luc in the upper and lower respiratory tracts. Three types of therapies were tested: licensed human anti-vaccinia virus immunoglobulin intravenous (VIGIV); recombinant anti-vaccinia virus immunoglobulin (rVIG; Symphogen, Denmark), an investigational product containing a mixture of 26 human monoclonal antibodies (HuMAbs) against mature virion (MV) and enveloped virion (EV); and HuMAb compositions targeting subsets of MV or EV proteins. Bioluminescence recorded daily showed that pretreatment with VIGIV (30 mg) or with rVIG (100 g) on day 2 protected mice from death but did not prevent viral replication at the site of inoculation and dissemination to internal organs. Compositions containing HuMAbs against MV or EV proteins were protective in both infection models at 100 g per animal, but at 30 g, only anti-EV antibodies conferred protection. Importantly, the t statistic of the mean total fluxes revealed that viral loads in surviving mice were significantly reduced in at least 3 sites for 3 consecutive days (days 3 to 5) postchallenge, while significant reduction for 1 or 2 days in any individual site did not confer protection. Our data suggest that reduction of viral replication at multiple sites, including respiratory tract, spleen, and liver, as monitored by whole-body bioluminescence can be used to predict the effectiveness of passive immunotherapies in mouse models. Following a massive vaccination campaign led by the World Health Organization, smallpox was declared eradicated in 1980. Vaccination of the general public in the United States was discontinued in 1972. However, in light of concerns that variola virus, the causative agent of smallpox, can be used as a bioterrorist weapon, strategies have been initiated worldwide, including in the United States, to develop medical countermeasures. The Preparedness and Response Program at the U.S. Centers for Disease Control and Prevention (CDC) recommended building stockpiles of smallpox vaccines for vaccination against smallpox, and anti-vaccinia virus immunoglobulin (VIG) for the management of serious adverse reactions to vaccination and postexposure treatment (5, 33). Currently, inoculation of military personnel with smallpox vaccine is a pol

One of the greatest challenges to HCV vaccine development is the induction of effective immune responses using recombinant proteins or vectors. In order to better understand which vaccine-induced antibodies contribute to neutralization of HCV the quality of polyclonal anti-E1E2 antibody responses in immunized mice and chimpanzees was assessed at the level of epitope recognition using peptide scanning and neutralization of chimeric 1a/2a, 1b/2a and 2a HCVcc after blocking or affinity elution of specific antibodies. Mice and chimpanzees were immunized with genotype 1a (H77) HCV gpE1E2; all samples contained cross-neutralizing antibody against HCVcc. By functionally dissecting the polyclonal immune responses we identified three new regions important for neutralization within E1 (aa264–318) and E2 (aa448–483 and aa496–515) of the HCV glycoproteins, the third of which (aa496–515) is highly conserved (85–95%) amongst genotypes. Antibodies to aa496–515 were isolated by affinity binding and elution from the serum of a vaccinated chimpanzee and found to specifically neutralize chimeric 1a/2a, 1b/2a and 2a HCVcc. IC50 titres (IgG ng/mL) for the aa496–515 eluate were calculated as 142.1, 239.37 and 487.62 against 1a/2a, 1b/2a and 2a HCVcc, respectively. Further analysis demonstrated that although antibody to this new, conserved neutralization epitope is efficiently induced with recombinant proteins in mice and chimpanzees; it is poorly induced during natural infection in patients and chimpanzees (7 out of 68 samples positive) suggesting the epitope is poorly presented to the immune system in the context of the viral particle. These findings have important implications for the development of HCV vaccines and strategies designed to protect against heterologous viruses. The data also suggest that recombinant or synthetic antigens may be more efficient at inducing neutralizing antibodies to certain epitopes and that screening virally infected patients may not be the best approach for finding new cross-reactive epitopes.

Homologous recombination has been the exclusive means of introducing foreign DNA into the genomes of large DNA viruses. Here we demonstrate that direct in vitro ligation can be used to efficiently insert DNA fragments of up to 26,000 bp into the genome of vaccinia virus modified to contain a single NotI site either in the Escherichia coli lacZ gene or in the vaccinia virus thymidine kinase gene. Viruses containing chimeric genomes can be identified by chromogenic screening or thymidine-kinase-negative selection.

Vaccination with Dryvax elicits a broad humoral response against many viral proteins. Human vaccinia immune globulin was used to screen the secreted proteins from cells infected with Dryvax or the candidate smallpox vaccine LC16m8 to determine whether the protective humoral response included antibodies against secreted viral proteins. Many proteins were detected, with the primary band corresponding to a band of 28 or 30 kDa in cells infected with Dryvax or LC16m8, respectively. This was identified as the vaccinia virus complement protein (VCP), which migrated more slowly in LC16m8-infected cells due to post-translational glycosylation. Vaccinia virus deleted in VCP, vVCPko, protected mice from a lethal intranasal challenge of vaccinia Western Reserve strain. Mice vaccinated with purified VCP demonstrated a strong humoral response, but were not protected against a moderate lethal challenge of vaccinia virus, suggesting that the humoral response against VCP is not critical for protection.

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.

Adverse events associated with the use of live smallpox vaccines have led to the development of a new generation of attenuated smallpox vaccines that are prepared in cultured cells as alternatives. The inability to conduct direct clinical evaluation of their efficacy in humans demands that licensure be based on animal studies and exhaustive evaluation of their in vitro properties. One of the most important characteristics of live viral vaccines is their genetic stability, including reversion of the vaccine strain to more virulent forms, recombination with other viral sequences to produce potentially pathogenic viruses, and genetic drift that can result in decrease of immunogenicity and efficacy. To study genetic stability of an immunoessential vaccinia virus gene in a new generation smallpox vaccine, an advanced oligonucleotide microchip was developed and used to assay for mutations that could emerge in B5R gene, a vaccinia virus gene encoding for a protein that contains very important neutralizing epitopes. This microarray contained overlapping oligonucleotides covering the B5R gene of modified vaccinia virus Ankara (MVA), a well-studied candidate smallpox vaccine. The microarray assay was shown to be able to detect even a single point mutation, and to differentiate between vaccinia strains. At the same time, it could detect newly emerged mutations in clones of vaccinia strains. In the work described here, it was shown that MVA B5R gene was stable after 34 passages in Vero and MRC-5 cells that were proposed for use as cell substrates for vaccine manufacture. Potentially, the proposed method could be used as an identity test and could be extended for the entire viral genome and used to monitor consistency of vaccine production.

The smallpox vaccine Dryvax, which consists of replication-competent vaccinia virus, elicits antibodies that play a major role in protection. Several vaccinia proteins generate neutralizing antibodies, but their importance for protection is unknown. We investigated the potency of antibodies to the A27 protein of the mature virion in neutralization and protection experiments and the contributions of A27 antibodies to Dryvax-induced immunity. Using a recombinant A27 protein (rA27), we confirmed that A27 contains neutralizing determinants and that vaccinia immune globulin (VIG) derived from Dryvax recipients contains reactivity to A27. However, VIG neutralization was not significantly reduced when A27 antibodies were removed, and antibodies elicited by an rA27 enhanced the protection conferred by VIG in passive transfer experiments. These findings demonstrate that A27 antibodies do not represent the major fraction of neutralizing activity in VIG and suggest that immunity may be augmented by vaccines and immune globulins that include strong antibody responses to A27.

Vaccinia virus encodes an enzyme with DNA modifying activity that cleaves and inefficiently cross-links cruciformic DNA. This enzyme is contained within the virion, expressed at late times postinfection, and processes DNA in an energy-independent, Mg 2+ ion-independent manner. Viral nuclease activity was measured in extracts from cells infected with well-defined viral mutants. Since some viral extracts lacked nuclease activity, the gene encoding the activity was postulated to be one of the open reading frames absent in the viruses lacking activity. Inducible expression of each candidate open reading frame revealed that only the gene VACWR035, or K4L, was required for nuclease activity. A recombinant virus missing only the open reading frame for K4L lacked nuclease activity. Extracts from a recombinant virus expressing K4L linked to a FLAG polypeptide were able to cleave and cross-link cruciformic DNA. There were no significant differences between the virus lacking K4L and wild-type vaccinia virus WR with respect to infectivity, growth characteristics, or processing of viral replicative intermediate DNA, including both telomeric and cross-linked forms. Purification of the K4L FLAG polypeptide expressed in bacteria yielded protein containing nicking-joining activity, implying that K4L is the only vaccinia virus protein required for the nicking-joining enzymatic activity.

The only US FDA licensed smallpox vaccine, Dryvax, was associated with rare but serious neurological adverse events. After smallpox was eradicated in the United States, mass vaccination ceased in 1971. As counter-bioterrorism/biowarfare measures, new smallpox vaccines are now being investigated. However, there are no established pre-clinical neurotoxicity assays with which to evaluate these new vaccines prior to licensure. Here we report the development and initial characterization of a small animal neurotoxicity assay for vaccinia-based smallpox vaccines using Dryvax virus as a reference vaccine strain and the neuroadapted Western Reserve (WR) strain as a neurotoxic positive control. In neonatally inoculated mice, the WR strain produced significantly greater and more rapid onset of mortality than the Dryvax vaccine reference. Expression of virus antigen in neural cells and infectious virus replication in the brain was also significantly different between the two strains. In addition, the appearance of high titer virus antibody correlated with the clearance of virus from brain. With further validation, this assay incorporating a licensed vaccine reference standard and positive control strain may provide important pre-clinical neurotoxicity data on new vaccinia-based smallpox vaccine strains.

Several reports have indicated that prime-boost strategies of vaccination can enhance the level of specific immunity induced by nucleic acid vaccines. The present report describes such a strategy with herpes simplex virus (HSV)-2 glycoprotein D (gD), using combinations of plasmid vector that expresses gD (pgD2) and a recombinant modified vaccinia virus Ankara vector that expresses gD (MVA-gD2). The IgG antibody response to gD and the HSV-2 neutralizing antibody response were greatest when the MVA-gD2 vector was used as the priming immunization and then was boosted with either pgD2 or MVA-gD2. Determination of the isotype profile of MVA-gD2-primed mice revealed a much broader distribution of isotypes than that seen after DNA vaccination. In addition, antigen-stimulated spleen cells from mice primed with MVA-gD2 and boosted with either MVA-gD2 or pgD2 produced higher levels of interleukin-2 and interferon-gamma than did those from pgD2-primed mice, indicating that a prime-boost immunization strategy that uses the MVA and plasmid DNA vector dramatically enhances and diversifies the humoral and cellular immune response to HSV-2 gD.

The vaccinia virus WR A5L open reading frame (corresponding to open reading frame A4L in vaccinia virus Copenhagen) encodes an immunodominant late protein found in the core of the vaccinia virion. To investigate the role of this protein in vaccinia virus replication, we have constructed a recombinant virus, vA5Li, in which the endogenous gene has been deleted and an inducible copy of the A5 gene dependent on isopropyl-β- d -thiogalactopyranoside (IPTG) for expression has been inserted into the genome. In the absence of inducer, the yield of infectious virus was dramatically reduced. However, DNA synthesis and processing, viral protein expression (except for A5), and early stages in virion formation were indistinguishable from the analogous steps in a normal infection. Electron microscopy revealed that the major vaccinia virus structural form present in cells infected with vA5Li in the absence of inducer was immature virions. Viral particles were purified from vA5Li-infected cells in the presence and absence of inducer. Both particles contained viral DNA and the full complement of viral proteins, except for A5, which was missing from particles prepared in the absence of inducer. The particles prepared in the presence of IPTG were more infectious than those prepared in its absence. The A5 protein appears to be required for the immature virion to form the brick-shaped intracellular mature virion.

The severely attenuated and host range (HR) restricted modified vaccinia virus Ankara (MVA) was derived by >500 passages in chick embryo fibroblasts, during which multiple deletions and mutations occurred. To determine the basis of the HR defect, we prepared cosmids from the parental vaccinia virus Ankara genome and transfected them into nonpermissive monkey BS-C-1 cells that had been infected with MVA. Recombinant viruses that formed macroscopic plaques were detected after transfections with DNA segments that mapped near the left end of the viral genome. Plaque-forming viruses, generated by transfections with four individual cosmids and one pair of minimally overlapping cosmids, were purified, and their HRs were evaluated in BS-C-1 cells, rabbit RK-13 cells, and human HeLa, MRC-5, and A549 cells. The acquisition of the K1L and SPI-1 HR genes and the repair of large deletions were determined by polymerase chain reaction or pulse-field gel electrophoresis ofNotIrestriction enzyme digests of genomic DNA. The following results indicated the presence of previously unrecognized vaccinia virus HR genes: (1) the major mutations that restrict HR are within the left end of the MVA genome because the phenotypes of some recombinants approached that of the parental virus, (2) acquisition of the K1L gene correlated with the ability of recombinant viruses to propagate in RK-13 cells but did not enhance replication in human or monkey cell lines, (3) acquisition of the SPI-1 gene correlated with virus propagation in A549 cells but not with the extent of virus spread in monkey or other human cell lines, (4) there are at least two impaired HR genes because rescue occurred with nonoverlapping or minimally overlapping cosmids and recombinant viruses with intermediate HRs were isolated, and (5) at least one of the new HR genes did not map within any of the major deletions because the size of the left terminalNotIfragment was not appreciably altered in some recombinant viruses.

The vaccinia virus A32 open reading frame was predicted to encode a protein with a nucleoside triphosphate-binding motif and a mass of 34 kDa. To investigate the role of this protein, we constructed a mutant in which the original A32 gene was replaced by an inducible copy. The recombinant virus, vA32i, has a conditional lethal phenotype: infectious virus formation was dependent on isopropyl-β- d -thiogalactopyranoside (IPTG). Under nonpermissive conditions, the mutant synthesized early- and late-stage viral proteins, as well as viral DNA that was processed into unit-length genomes. Electron microscopy of cells infected in the absence of IPTG revealed normal-appearing crescents and immature virus particles but very few with nucleoids. Instead of brick-shaped mature particles with defined core structures, there were numerous electron-dense, spherical particles. Some of these spherical particles were wrapped with cisternal membranes, analogous to intracellular and extracellular enveloped virions. Mutant viral particles, purified by sucrose density gradient centrifugation, had low infectivity and transcriptional activity, and the majority were spherical and lacked DNA. Nevertheless, the particle preparation contained representative membrane proteins, cleaved and uncleaved core proteins, the viral RNA polymerase, the early transcription factor and several enzymes, suggesting that incorporation of these components is not strictly coupled to DNA packaging.

Whole body bioluminescence imaging was employed to test the effects of IgG-based therapies and Cidofovir on lethality and virus dissemination in BALB/c mice challenged intranasally with 10^5 pfu of recombinant vaccinia viruses (VV) expressing luciferase, WRvFire or IHDJ-Luc. Both viruses induced lethality within 6-8 days, with slightly different kinetics of replication in internal organs. Using statistical analysis of 80 animals/group we determined that replication of IHDJ-Luc (increased Extracellular Enveloped Virion compared to WR) rose faster and peaked earlier than WRvFire (predominantly Intracellular Mature Virion) in the liver and spleen. In the nasal cavity, WRvFire persisted at significantly higher levels than IHDJ-Luc. Vaccinia immunoglobulin for intravenous injection (VIGIV) administered at day -2 protected 100% of animals from WRvFire and IHDJ-Luc infections. Sym002 (26 anti-vaccinia human mAbs) completely protected mice from both challenges at 300-fold lower dose than VIGIV. A single treatment of Cidofovir (100 mg/kg) at day 1, 2, or 3 p.i. fully protected mice from WRvFire challenge. Complete protection conferred by treatments correlated with significant reductions in bioluminescence in nasal cavity or lungs and in both the liver and spleen between days 1-5. Our data demonstrated that despite some differences observed in the kinetics of VV dissemination, infections with these viruses were similarly susceptible to prophylactic and therapeutic treatments.

Protection from lethal challenge with recombinant WR-Luciferase (TK+) and IHDJ-Luciferase (TK+) vaccinia viruses (VV) was studied by detecting firefly luciferase activity in live Balb/c mice using IVIS technology. High correlation (R2=0.8-0.9) was observed between viral loads in the organs measured by plaque assay and bioluminescence. WR- and IHDJ VV that generate predominantly IMV and EEV forms, respectively, induced lethality within 8-10 days after intranasal challenge with 10^5 pfu yet their dissemination and susceptibility to therapies differed. WR persisted at significantly higher levels than IHDJ at the site of challenge, while IHDJ replicated better in the liver in agreement with the roles of EEV and IMV in host dissemination and inter host transmission. Vaccinia immunoglobulin (VIGIV) at Day -2 completely protected from the WR but not from IHDJ challenge. Sym002, a mixture of 26 human anti-vaccinia mAbs (Symphogen, Denmark), completely protected from WR challenge at 1000 lower dose than VIGIV, but only partially protected from IHDJ. Protection by Sym002 correlated with a significantly reduced flux at the nasopharyngeal area and in the liver. Importantly, our study detected significantly higher bioluminescence at the nasopharyngeal area and in the lungs in non-survivors than in survivors suggesting that bioimaging can substitute for lethality endpoint for evaluation of anti-smallpox treatments.

The concatemer junction from replicative forms of vaccinia virus DNA was cloned into plasmid vectors and shown to be a precise duplex copy of the viral terminal hairpin structure, with each strand corresponding to one of the alternative sequence isomers. The plasmids were relaxed circles with extruded cruciforms representing two copies of the vaccinia telomere hairpin structure. Head-to-head dimers containing two copies of the vaccinia virus concatemer junction were observed to contain only one set of stem-loop structures per molecule, suggesting that the initial formation of a small cruciform, and not branch migration, was the rate-limiting step in cruciform formation. The plasmids containing the concatemer junction were converted into nicked circular, linear and cross-linked linear molecules by a nuclease isolated from vaccinia virions. The region-specific cleavage near the border of the hairpin loop and the formation of DNA cross-links in some of the molecules is consistent with the nuclease acting as a nicking-closing enzyme that participates in the resolution of mature termini from replicative concatemer intermediates.

Vaccinia virus replicates in the cytoplasm of infected cells, generating transient replicative intermediates containing the DNA for the terminal sequences as concatemeric junctions. The processing of the terminal sequences for a series of vaccinia virus conditional lethal mutants at the nonpermissive temperature was analyzed by restriction enzyme digestion and Southern blot hybridization of DNA isolated from infected cells. Three phenotypes were observed: DNA replication negative (Rep-), DNA replication positive but concatemer resolution negative (Rep+ Res-), and DNA replication positive and concatemer resolution positive (Rep+ Res+). Interestingly, all six Rep+ Res- mutants from separate complementation groups were defective in late protein synthesis. Isatin beta-thiosemicarbazone, a drug that blocks late protein synthesis, also prevented resolution of concatemers. Orthogonal field gel electrophoresis of the DNA generated by the late defective mutants revealed a distribution of linear genome multimers. The multimers were processed into mature monomers after a shift to the permissive temperature in the presence of cytosine arabinoside for all the Rep+ Res- mutants except ts22, an irreversible mutant which cleaves RNA late in infection (R.F. Pacha and R.C. Condit, J. Virol. 56:395-403, 1985). Genome formation can be divided into two stages: DNA replication, which generates concatemers, and resolution, which processes concatemers into monomers with hairpin termini. Early viral genes are required for the former, and late viral genes are required for the latter.

A new, base-catalyzed cleavage of C 21 -steroids to give 17-ketosteroids is described. This reaction is specific for those steroids containing the C-17-dihydroxy acetone side chain. In the presence of oxygen, these same reaction conditions readily degrade corticosterone to the 17β-carboxylic acid.

Poxvirus vectors are extensively used as expression vehicles for protein and antigen expression in eukaryotic cells. Customarily, the foreign DNA is introduced into the poxvirus genome by homologous recombination. An alternative method using direct ligation vectors has been used to efficiently construct chimeric genomes in situations not readily amenable for homologous recombination. We describe the construction and characterization of a new set of direct ligation vectors designed to be universally applicable for the generation of chimeric vaccinia genomes. These vectors contain the pair of unique restriction sitesNotI andApaI to eliminate religation of poxvirus arms and fix the orientation of the insert DNA behind strongly expressing constitutive vaccinia promoters. The insertion cassette has been placed at the beginning of the thymidine kinase gene in vaccinia to use drug selection in the isolation of recombinants. These viruses provide a set of universally applicable direct ligation poxvirus cloning vectors, extending the utility of poxvirus vectors for construction and expression of complex libraries.

We have determined the complete nucleotide sequence of the genome of Minute Virus of Mice, an autonomous parvovirus. This single-stranded DNA is 5081 nucleotides long. The 3'-and 5'-ends of the viral strand contain imperfect palindromic sequences which consist, respectively, of 115 and 206 nucleotides. The 3'-terminal palindrome is composed of a unique sequence, whereas the 5'-terminal palindrome contains two sequences in equimolar amounts; these are related in that one is the inverted complement of the other. The DNA strand complementary to that which is encapsidated into virions contains two large open reading frames which together span almost the entire genome. Transcriptional and translational signals within the sequence have been identified and related to the known map coordinates of the viral transcripts. In this report we summarize some of the salient structural and organizational features of the MVM genome.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.

The junctions, separating unit-length genomes in intracellular concatemeric forms of vaccinia virus DNA, are duplex copies of the hairpin loops that form the ends of mature DNA molecules present in infectious virus particles. Circular E. coli plasmids with palindromic junction fragments were replicated in vaccinia virus-infected cells and resolved into linear minichromosomes with vector DNA in the center and vaccinia virus DNA hairpins at the two ends. Resolution did not occur when the concatemer joint was less than 250 bp or when plasmids were transfected into uninfected cells, indicating requirements for a specific DNA structure and viral trans-acting factors. These studies indicate that concatemers can serve as replicative intermediates and account for the generation of flip-flop sequence variation of the hairpins at the ends of the mature vaccinia virus genome.

Six chemically reactive derivatives of cortisol were synthesized in order to probe the steroid binding site of glucocorticoid receptors at increasing distances from the C 21 of cortisol. For this purpose, four new affinity label groups were employed, i.e. α-keto-mesylate, α-keto-thiol, thiol acetate and xanthate. The cortisol-21-thiol was prepared by a new synthesis of α-keto thiols. The thiol acetate and xanthate substituents also embody a unique approach to affinity labelling, wherein a small non-steroidal group could be transfered to the receptor in an attempt to obtain functionally active, covalently labelled receptors. The affinities for receptors and the biological activities of the six synthetic steroids were examined in two lines of rat hepatoma tissue culture cells—FU-55 and HTC. The relative affinities of these steroids for receptors did not correlate with the bulk of the steroid substituents. The thiol, thiol acetate and xanthate derivatives were better competitors of [ 3 H]dexamethasone binding than the parent steroid cortisol. Interaction of cortisol-thiol acetate and cortisol-xanthate with HTC cell receptors was further examined in a cell-free exchange assay that renders steroid-free receptors incapable of binding the subsequently added [ 3 H]-steroid. The behavior of the reactive thiol acetate and xanthate derivatives in this exchange assay, plus their unexpectedly high apparent affinity for receptors, are consistent with the formation of a functionally active, covalently labelled glucocorticoid receptor via transfer affinity labelling. The biological activity of all six steroids in whole cells indicates that these potential affinity label functional groups may be most useful in cell-free studies.