Search

Meloidogyne hapla is a serious pest of many cultivated plants. In response to the economic significance of the species, efforts are being made to develop a new method to reduce its harmful effects on crops. The aim of the study was to determine the effect of diffusates from seeds of selected species of legumes on the motility of second-stage juveniles and to evaluate the effect of meal from seeds of selected species of legume on the capacity to infect the roots of tomato plants by the J2 stage. The experiment examined the effect of diffusates on the motility of the J2 stage performed in Petri dishes, at temperatures of 10 °C, 17 °C and 21 °C. The evaluation of the J2 stage infectivity was estimated in a pot experiment performed under controlled conditions of 20 ± 1 °C. The pots were filled with sterile substrate mixed with meal from the seeds of selected plants at 1%, 5% and 10% of the substrate weight. The studies carried out in the Petri dishes showed varying effects of the seed diffusates from selected legume plants on the motility of the J2 stage of Meloidogyne hapla. J2 were found to lose their motility within 24 h after immersion in water containing seed diffusates from Melilotus albus, Trifolium pratense T. repens, in the temperature ranges investigated (10 °C, 17 °C and 21 °C). However, in a mixture of seed diffusates and soil filtrate from the root zone of tomato plants, the absence of motility in the second-stage juveniles was observed after 24 h at 17 °C and 21 °C, with seed diffusates from Lotus corniculatus, Medicago sativa, Medicago × varia, Melilotus officinalis, as well as Onobrychis viciifolia, Ornithopus sativus, Vicia sativa, used in the mixture. Galega officinalis Risa (GoR) seed diffusates were found to have an inhibiting effect on the motility of the J2 stage of M. hapla 24 h following the immersion of the J2 stage in the solution of the soil filtrate containing tomato root diffusates, at 21 °C. The J2 stage were not rendered immotile in all the experiment set-ups involving the seeds of V. faba, Lupinus spp., likewise in the control set-ups. In the pots studied, a significant effect of the addition of legume seed meal on the development of M. hapla nematodes and tomato plants was found. The introduction of Lotus corniculatus, Onobrychis viciifolia and Vicia sativa seed meal into the substrate in the proportion of 1%, 5% and 10% resulted in the inhibition of the J2 stage penetration into the roots of tomato plants at temperatures of 17 °C and 21 °C. With the admixture of the M. sativa and T. repens seed meal, within the temperature range investigated, no nematode infection was observed in the roots, regardless of the seed meal content in the substrate. As regards to the fresh weight, tomato plants grown in a substrate containing 1% and 5% of the V. sativa cv. Jaga seed meal were characterised by significantly higher plant weight values as compared to those grown in the control set-up. The obtained results imply that is advisable to expand the scope of research to include other economically important crops damaged by the northern root-knot nematode.

Meloidogyne hapla is one of the most important nematode pathogens. It is a sedentary, biotrophic parasite of plants that overwinters in the soil or in diseased roots. The development of M. hapla is temperature dependent. Numerous studies have been performed on the effect of temperature on the development of M. hapla, but only a few of them analyzed the heat shock protein (hsp) genes. The aim of the study was to perform expression profiling of eight hsp genes (Mh-hsp90, Mh-hsp1, Mh-hsp4, Mh-hsp6, Mh-hsp60, Mh-dnj19, Mh-hsp43, and Mh-hsp12.2) at two development stages of M. hapla, i.e., in eggs and second-stage juveniles (J2). The eggs and J2 were incubated under cold stress (5 °C), heat stress (35 °C, 40 °C), and non-stress (10 °C, 20 °C, and 30 °C) conditions. Expression profiling was performed by qPCR. It was demonstrated that only two genes, Mh-hsp60 and Mh-dnj19, have been upregulated by heat and cold stress at both development stages. Heat stress upregulated the expression of more hsp genes than cold stress did. The level of upregulation of most hsp genes was more marked in J2 than in eggs. The obtained results suggest that the Mh-hsp90 and Mh-hsp1 genes can be used as bioindicators of environmental impacts on nematodes of the Meloidogyne genus. [ABSTRACT FROM AUTHOR]

Meloidogyne hapla is a serious pest of many cultivated plants. In response to the economic significance of the species, efforts are being made to develop a new method to reduce its harmful effects on crops. The aim of the study was to determine the effect of diffusates from seeds of selected species of legumes on the motility of second-stage juveniles and to evaluate the effect of meal from seeds of selected species of legume on the capacity to infect the roots of tomato plants by the J2 stage. The experiment examined the effect of diffusates on the motility of the J2 stage performed in Petri dishes, at temperatures of 10 °C, 17 °C and 21 °C. The evaluation of the J2 stage infectivity was estimated in a pot experiment performed under controlled conditions of 20 ± 1 °C. The pots were filled with sterile substrate mixed with meal from the seeds of selected plants at 1%, 5% and 10% of the substrate weight. The studies carried out in the Petri dishes showed varying effects of the seed diffusates from selected legume plants on the motility of the J2 stage of Meloidogyne hapla. J2 were found to lose their motility within 24 h after immersion in water containing seed diffusates from Melilotus albus, Trifolium pratense T. repens, in the temperature ranges investigated (10 °C, 17 °C and 21 °C). However, in a mixture of seed diffusates and soil filtrate from the root zone of tomato plants, the absence of motility in the second-stage juveniles was observed after 24 h at 17 °C and 21 °C, with seed diffusates from Lotus corniculatus, Medicago sativa, Medicago × varia, Melilotus officinalis, as well as Onobrychis viciifolia, Ornithopus sativus, Vicia sativa, used in the mixture. Galega officinalis Risa (GoR) seed diffusates were found to have an inhibiting effect on the motility of the J2 stage of M. hapla 24 h following the immersion of the J2 stage in the solution of the soil filtrate containing tomato root diffusates, at 21 °C. The J2 stage were not rendered immotile in all the experiment set-ups involving the seeds of V. faba, Lupinus spp., likewise in the control set-ups. In the pots studied, a significant effect of the addition of legume seed meal on the development of M. hapla nematodes and tomato plants was found. The introduction of Lotus corniculatus, Onobrychis viciifolia and Vicia sativa seed meal into the substrate in the proportion of 1%, 5% and 10% resulted in the inhibition of the J2 stage penetration into the roots of tomato plants at temperatures of 17 °C and 21 °C. With the admixture of the M. sativa and T. repens seed meal, within the temperature range investigated, no nematode infection was observed in the roots, regardless of the seed meal content in the substrate. As regards to the fresh weight, tomato plants grown in a substrate containing 1% and 5% of the V. sativa cv. Jaga seed meal were characterised by significantly higher plant weight values as compared to those grown in the control set-up. The obtained results imply that is advisable to expand the scope of research to include other economically important crops damaged by the northern root-knot nematode. [ABSTRACT FROM AUTHOR]

Phytonematode infections are a major constraint to agriculture and can cause pre-harvest losses of up to one-third of the crop in affected fields. With increasing restrictions on the use of chemical pesticides due to environmental and human hazards, and increasing nematode pressure due to climate change, soil degradation and agricultural intensification, more sustainable ways to manage such plant pests are needed to meet the growing demand for food. Therefore, the reproduction of thermophilic Meloidogyne spp. was evaluated in comparison with that of the northern root-knot nematode Meloidogyne hapla on the wild strawberry Fragaria vesca vs. semperflorens cv. Alexandria, a potential source of resistance to nematode infection. M. hapla showed a high reproductive rate in F. vesca, while the thermophilic Meloidogyne species tested showed significant lower reproductive rates. This suggests that F. vesca vs. semperflorens cv. Alexandria, although not resistant to the nematode species tested, could be used in a management system to down-regulate nematode pressure. In addition, this study helps to reinforce the importance of crop wild relatives in the search for resistance traits to support a more sustainable agriculture. [ABSTRACT FROM AUTHOR]

Hemp is a crop that has gained interest in Washington and Oregon. As with other crops, hemp production faces challenges due to biotic factors, including plant-parasitic nematodes. During a survey for plant-parasitic nematodes associated with hemp, Meloidogyne sp. was found in a composite root sample collected in Oregon. Morphological characterization of second-stage juveniles identified the nematode as Meloidogyne hapla. Molecular identification confirmed the population as M. hapla. To our knowledge, this is the first report of M. hapla on hemp in the Pacific Northwest of the United States.

The most important root-knot nematodes specific for potatoes crops in Europe are Meloidogyne chitwoodi and M. fallax which are regulated as Union quarantine pests, according to Commission Implementing Regulation Annex II B of EU Reg. 2019/2072). A monitoring program is ongoing for detection and identification of quarantine and regulated non quarantine pests with economic importance for Solanum tuberosum in Romania. One of the goals of this program is to have a clear situation of nematodes which can occur in order to establish the status of them in Romania and their distribution. In the literature there is mentioned also another root-knot nematode species which can be present on potato, namely Meloidogyne hapla. Official surveys are based on taking sample consists of soil and potatoes tubers. For extraction of juvenile nematodes (J2) from soil samples were used Oostenbrink elutriator and Baermann funnel and for females from potato tubers samples by enzymatic digestion of potato peels. The identification of Meloidogyne species was done by morphological and molecular methods. It was the first record of M. hapla on Solanum tuberosum in Romania. [ABSTRACT FROM AUTHOR]

The rhizosphere bacteria Bacillus velezensis GJ-7, as a biological control agent (BCA), has significant biological control effects on Meloidogyne hapla, and has strong colonization ability in the root of Panax notoginseng. In this study, we conducted a comparative transcriptome analysis using P. notoginseng plant roots treated with B. velezensis GJ-7 or sterile water alone and in combination with M. hapla inoculation to explore the interactions involving the P. notoginseng plant, B. velezensis GJ-7, and M. hapla. Four treatments from P. notoginseng roots were sequenced, and twelve high-quality total clean bases were obtained, ranging from 3.57 to 4.74 Gb. The Gene Ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment showed that numerous DEGs are involved in the phenylpropane biosynthesis pathway and the MAPK signaling pathway in the roots of P. notoginseng with B. velezensis GJ-7 treatments. The analysis results of the two signaling pathways indicated that B. velezensis GJ-7 could enhance the expression of lignin- and camalexin-synthesis-related genes in plant roots to resist M. hapla. In addition, B. velezensis GJ-7 could enhance plant resistance to M. hapla by regulating the expression of resistance-related genes and transcription factors (TFs), including ETR, ERF, ChiB, WRKY22, and PR1. The expression of plant disease resistance genes in the roots of P. notoginseng with different treatments was validated by using real-time quantitative PCR (qRT-PCR), and the results were consistent with transcriptome sequencing. Taken together, this study indicated that B. velezensis GJ-7 can trigger a stronger defense response of P. notoginseng against M. hapla. [ABSTRACT FROM AUTHOR]

Meloidogyne hapla is one of the most important nematode pathogens. It is a sedentary, biotrophic parasite of plants that overwinters in the soil or in diseased roots. The development of M. hapla is temperature dependent. Numerous studies have been performed on the effect of temperature on the development of M. hapla, but only a few of them analyzed the heat shock protein (hsp) genes. The aim of the study was to perform expression profiling of eight hsp genes (Mh-hsp90, Mh-hsp1, Mh-hsp4, Mh-hsp6, Mh-hsp60, Mh-dnj19, Mh-hsp43, and Mh-hsp12.2) at two development stages of M. hapla, i.e., in eggs and second-stage juveniles (J2). The eggs and J2 were incubated under cold stress (5 °C), heat stress (35 °C, 40 °C), and non-stress (10 °C, 20 °C, and 30 °C) conditions. Expression profiling was performed by qPCR. It was demonstrated that only two genes, Mh-hsp60 and Mh-dnj19, have been upregulated by heat and cold stress at both development stages. Heat stress upregulated the expression of more hsp genes than cold stress did. The level of upregulation of most hsp genes was more marked in J2 than in eggs. The obtained results suggest that the Mh-hsp90 and Mh-hsp1 genes can be used as bioindicators of environmental impacts on nematodes of the Meloidogyne genus.

Assuming that the seeds of Vicia sativa L. have a stressful effect on J2 stage Meloidogyne hapla, we undertook research on the effect of these seeds on the motility and mortality of J2 and determined the expression levels of selected hsp genes in J2. The assessment of the effect of V. sativa seeds on the motility of M. hapla specimens consisted of observing the movement of J2 immersed in a seed diffusate or in a tomato root filtrate at temperatures of 10, 17, and 21°C. In J2 treated with V. sativa (cv. Ina) seed diffusates, the expression level of hsp genes was determined by qPCR. J2 exposed to V. sativa diffusates were found to lose their motility, while their mortality did not exceed 30%. J2 in the seed diffusate were characterized by an increase in the expression levels of the Mh-hsp90, Mh-hsp1, and Mh-hsp43 genes. It is suggested that the hsp90 gene may be a potential bioindicator of the environmental impact on Meloidogyne nematodes. The impaired ability to move in J2 of M. hapla is attributable to the occurrence of V. sativa seeds in their habitat. These studies may contribute to developing methods of reducing crop damage caused by M. hapla.

Highly adapted obligate endoparasites of the root system, root-knot nematodes (Meloidogyne spp.), cause great damage to agricultural crops. Our research is aimed at the assessment of nematicidal activity and effectiveness of antagonist fungal and bacterial strains against the most common type of root-knot nematode in the south of Russia. By means of molecular genetic identification, it was found that in the south of Russia, the species Meloidogyne hapla Chitwood, 1949 and Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 cause galls on the roots of open-ground and greenhouse tomato. Screening of microbial agents against second-stage juvenile (J2) M. hapla was carried out in the laboratory. At the end of the experiment, two liquid fungal cultures of Paecilomyces lilacinus BK-6 and Metarhizium anisopliae BK-2 were isolated, the nematicidal activity of which reached 100.0 and 70.2%, and exceeded the values of the biological standard (Nemotafagin-Mikopro) by 38.4% and 8.8%. The highest biological efficacy was noted in the liquid cultures of P. lilacinus BK-6, M. anisopliae BK-2, and Arthrobotrys conoides BK-8 when introduced into the soil before planting tomato. The number of formed galls on the roots was lower in comparison with the control by 81.0%, 75.5%, and 74.4%. [ABSTRACT FROM AUTHOR]

Coffee is an important commodity for Kenya, where production is steadily declining, despite a global rise in demand. Of the various constraints affecting production, plant-parasitic nematodes are a significant, but often overlooked, threat. As a perennial crop, treating plantations once infected with nematodes becomes difficult. The current study evaluated the drenching application of two biocontrol agents, Trichoderma asperellum and Purpureocillium lilacinum, for their nematode control efficacy, as well as their impact on the soil nematode community structure on mature, established coffee trees in Kenya. Seven Arabica coffee field trials were conducted over two years on trees of various ages. All the fields were heavily infested with Meloidogyne hapla, the first report of the species on coffee in Kenya. Both fungal biocontrol agents were detected endophytically infecting roots and recovered from soil but not until six months after initial applications. The population densities of M. hapla had significantly declined in roots of treated trees 12months after the initial application, although soil nematode density datawere similar across treatments. Based upon the maturity index and the Shannon index, treatment with T. asperellum led to improved soil health conditions and enrichment of diversity in themicrobial community. Application of P. lilacinum, in particular, led to an increased abundance of fungivorous nematodes, especially Aphelenchus spp., for which P. lilacinum would appear to be a preferred food source. The soils in the trials were all stressed and denuded, however, which likely delayed the impact of such treatments or detection of any differences between treatments using indices, such as the functional metabolic footprint, over the period of study. A longer period of study would therefore likely provide a better indication of treatment benefits. The current study positively demonstrates, however, the potential for using biologically based options for the environmentally and climate-smart management of nematode threats in a sustainable manner on established, mature coffee plantations. [ABSTRACT FROM AUTHOR]

Tomato plants are susceptible to significant yield losses when infested by the northern root-knot nematode, Meloidogyne hapla. While there are many options for conventional chemical management, few of these options offer effective control for organic growers or those who seek to adopt more environmentally considerate strategies. In this study, we showed that a new, biologically based product (referred to as “MN21.2”) has potential for controlling populations of the northern root-knot nematode, Meloidogyne hapla, as a pest of susceptible tomato (cv. Rutgers) in a greenhouse trial. This is significant because if this product’s efficacy is supported under field conditions, it may provide organic tomato growers with a valuable tool for fighting the plant-parasitic nematode pest, M. hapla.

The Bacillus velezensis GJ-7 strain isolated from the rhizosphere soil of Panax notoginseng showed high nematicidal activity and therefore has been considered a biological control agent that could act against the root-knot nematode Meloidogyne hapla. However, little was known about whether the GJ-7 strain could produce volatile organic compounds (VOCs) that were effective in biocontrol against M. hapla. In this study, we evaluated the nematicidal activity of VOCs produced by the fermentation of GJ-7 in three-compartment Petri dishes. The results revealed that the mortality rates of M. hapla J2s were 85% at 24 h and 97.1% at 48 h after treatment with the VOCs produced during GJ-7 fermentation. Subsequently, the VOCs produced by the GJ-7 strain were identified through solid-phase micro-extraction gas chromatography mass spectrometry (SPME-GC/MS). Six characteristic VOCs from the GJ-7 strain fermentation broth were identified, including 3-methyl-1-butanol, 3-methyl-2-pentanone, 5-methyl-2-hexanone, 2-heptanone, 2,5-dimethylpyrazine, and 6-methyl-2-heptanone. The in vitro experimental results from 24-well culture plates showed that the six volatiles had direct-contact nematicidal activity against M. hapla J2s and inhibition activity against egg hatching. In addition, 3-methyl-1-butanol and 2-heptanone showed significant fumigation effects on M. hapla J2s and eggs. Furthermore, all six of the VOCs repelled M. hapla J2 juveniles in 2% water agar Petri plates. The above data suggested that the VOCs of B. velezensis GJ-7 acted against M. hapla through multiple prevention and control modes (including direct-contact nematicidal activity, fumigant activity, and repellent activity), and therefore could be considered as potential biocontrol agents against root-knot nematodes. [ABSTRACT FROM AUTHOR]

Coffee is an important commodity for Kenya, where production is steadily declining, despite a global rise in demand. Of the various constraints affecting production, plant-parasitic nematodes are a significant, but often overlooked, threat. As a perennial crop, treating plantations once infected with nematodes becomes difficult. The current study evaluated the drenching application of two biocontrol agents, Trichoderma asperellum and Purpureocillium lilacinum, for their nematode control efficacy, as well as their impact on the soil nematode community structure on mature, established coffee trees in Kenya. Seven Arabica coffee field trials were conducted over two years on trees of various ages. All the fields were heavily infested with Meloidogyne hapla, the first report of the species on coffee in Kenya. Both fungal biocontrol agents were detected endophytically infecting roots and recovered from soil but not until six months after initial applications. The population densities of M. hapla had significantly declined in roots of treated trees 12 months after the initial application, although soil nematode density data were similar across treatments. Based upon the maturity index and the Shannon index, treatment with T. asperellum led to improved soil health conditions and enrichment of diversity in the microbial community. Application of P. lilacinum, in particular, led to an increased abundance of fungivorous nematodes, especially Aphelenchus spp., for which P. lilacinum would appear to be a preferred food source. The soils in the trials were all stressed and denuded, however, which likely delayed the impact of such treatments or detection of any differences between treatments using indices, such as the functional metabolic footprint, over the period of study. A longer period of study would therefore likely provide a better indication of treatment benefits. The current study positively demonstrates, however, the potential for using biologically based options for the environmentally and climate-smart management of nematode threats in a sustainable manner on established, mature coffee plantations.

The rhizosphere bacteria Bacillus velezensis GJ-7, as a biological control agent (BCA), has significant biological control effects on Meloidogyne hapla, and has strong colonization ability in the root of Panax notoginseng. In this study, we conducted a comparative transcriptome analysis using P. notoginseng plant roots treated with B. velezensis GJ-7 or sterile water alone and in combination with M. hapla inoculation to explore the interactions involving the P. notoginseng plant, B. velezensis GJ-7, and M. hapla. Four treatments from P. notoginseng roots were sequenced, and twelve high-quality total clean bases were obtained, ranging from 3.57 to 4.74 Gb. The Gene Ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment showed that numerous DEGs are involved in the phenylpropane biosynthesis pathway and the MAPK signaling pathway in the roots of P. notoginseng with B. velezensis GJ-7 treatments. The analysis results of the two signaling pathways indicated that B. velezensis GJ-7 could enhance the expression of lignin- and camalexin-synthesis-related genes in plant roots to resist M. hapla. In addition, B. velezensis GJ-7 could enhance plant resistance to M. hapla by regulating the expression of resistance-related genes and transcription factors (TFs), including ETR, ERF, ChiB, WRKY22, and PR1. The expression of plant disease resistance genes in the roots of P. notoginseng with different treatments was validated by using real-time quantitative PCR (qRT-PCR), and the results were consistent with transcriptome sequencing. Taken together, this study indicated that B. velezensis GJ-7 can trigger a stronger defense response of P. notoginseng against M. hapla.

Highly adapted obligate endoparasites of the root system, root-knot nematodes (Meloidogyne spp.), cause great damage to agricultural crops. Our research is aimed at the assessment of nematicidal activity and effectiveness of antagonist fungal and bacterial strains against the most common type of root-knot nematode in the south of Russia. By means of molecular genetic identification, it was found that in the south of Russia, the species Meloidogyne hapla Chitwood, 1949 and Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 cause galls on the roots of open-ground and greenhouse tomato. Screening of microbial agents against second-stage juvenile (J2) M. hapla was carried out in the laboratory. At the end of the experiment, two liquid fungal cultures of Paecilomyces lilacinus BK-6 and Metarhizium anisopliae BK-2 were isolated, the nematicidal activity of which reached 100.0 and 70.2%, and exceeded the values of the biological standard (Nemotafagin-Mikopro) by 38.4% and 8.8%. The highest biological efficacy was noted in the liquid cultures of P. lilacinus BK-6, M. anisopliae BK-2, and Arthrobotrys conoides BK-8 when introduced into the soil before planting tomato. The number of formed galls on the roots was lower in comparison with the control by 81.0%, 75.5%, and 74.4%.

The root rot disease complex of Meloidogyne hapla Chitwood, 1949 (Nemata: Meloidogynidae) and Rhizoctonia solani Kühn was investigated in 2021 under controlled conditions with different applications on tomato. Three week-old seedlings (cv. Alberty F1) were inoculated with M. hapla and/or R. solani according to priority of the applications. After sixty days, the parameters of plant and root height, plant and root wet weight, numbers of gall and egg masses, disease severity, M. hapla second stage juvenile density and R. solani density in the soil were recorded. The plant growth parameters were more adversely affected in plants inoculated with R. solani 2 weeks after the M. hapla application, whereas the number of galls and egg masses in the roots were negatively affected in only M. hapla inoculation 2 weeks after the inoculation of R. solani application. The disease severity of R. solani inoculation 2 weeks after M. hapla application (44.7%) and simultaneous M. hapla and R. solani application (33.6%) were found to be higher than only R. solani application (21.6%) and M. hapla inoculation 2 weeks after R. solani application (22.9%). In this study, it was found that M. hapla infestation of tomato increased root rot disease caused by R. solani. [ABSTRACT FROM AUTHOR]

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

The Bacillus velezensis GJ-7 strain isolated from the rhizosphere soil of Panax notoginseng showed high nematicidal activity and therefore has been considered a biological control agent that could act against the root-knot nematode Meloidogyne hapla. However, little was known about whether the GJ-7 strain could produce volatile organic compounds (VOCs) that were effective in biocontrol against M. hapla. In this study, we evaluated the nematicidal activity of VOCs produced by the fermentation of GJ-7 in three-compartment Petri dishes. The results revealed that the mortality rates of M. hapla J2s were 85% at 24 h and 97.1% at 48 h after treatment with the VOCs produced during GJ-7 fermentation. Subsequently, the VOCs produced by the GJ-7 strain were identified through solid-phase micro-extraction gas chromatography mass spectrometry (SPME-GC/MS). Six characteristic VOCs from the GJ-7 strain fermentation broth were identified, including 3-methyl-1-butanol, 3-methyl-2-pentanone, 5-methyl-2-hexanone, 2-heptanone, 2,5-dimethylpyrazine, and 6-methyl-2-heptanone. The in vitro experimental results from 24-well culture plates showed that the six volatiles had direct-contact nematicidal activity against M. hapla J2s and inhibition activity against egg hatching. In addition, 3-methyl-1-butanol and 2-heptanone showed significant fumigation effects on M. hapla J2s and eggs. Furthermore, all six of the VOCs repelled M. hapla J2 juveniles in 2% water agar Petri plates. The above data suggested that the VOCs of B. velezensis GJ-7 acted against M. hapla through multiple prevention and control modes (including direct-contact nematicidal activity, fumigant activity, and repellent activity), and therefore could be considered as potential biocontrol agents against root-knot nematodes.

Root-knot nematodes (RKNs) are soil-borne pathogens that severely affect Panax notoginseng growth and productivity. Thus, there is an urgent need for biological control agents or green nematicides to control root-knot nematodes. Rhizosphere bacteria can effectively control RKNs through different mechanisms. In this study, the three rhizosphere Bacillus strains, isolated from the root of P. notoginseng , were evaluated for the nematicidal activity and biological control efficacy against root-knot nematodes. In addition, we also evaluated the colonization ability of the two bacterial strains with significant biocontrol effect and dynamic regulation of genes related to systemic resistance in P. notoginseng. The rhizosphere Bacillus velezensis GJ-7 and Bacillus cereus NS-2 showed high nematicidal activity against Meloidogyne hapla in vitro and significantly reduced the number of root galls in three different control experiments. The results of colonization experiments showed that the strains GJ-7 and NS-2 colonized P. notoginseng root rapidly and stably. Additionally, the colonization of the strains NS-2 and GJ-7 activated the defense-responsive genes in P. notoginseng. These results indicated that the B. cereus strain NS-2 and B. velezensis strain GJ-7 have the potential for successful ecological niche occupation and enhance plant resistance and therefore could be considered as potential biocontrol agents against root-knot nematodes. [ABSTRACT FROM AUTHOR]

Root-knot nematodes in the genus Meloidogyne are an important group of plant-parasitic nematodes causing severe damage on agricultural crops worldwide. A study was conducted to identify the species of root-knot nematodes causing damage on honeybush monocultures and to assess the seasonal variations in the nematode population. Soil samples were collected from six experimental sites in Genadendal, Western Cape province of South Africa from 2016 to 2017. DNA was extracted from single-second stage juveniles and species identifi cation was done using species-specifi c sequence-characterised amplifi ed regions (SCAR) primers. Meloidogyne hapla and M. javanica were identifi ed from the sites. Mean population density of the nematodes varied significantly (p < 0.05) in the six sites, with the peak population being recorded in summer of 2017. The study suggests that seasonal variation in temperature and moisture could contribute to changes in the population density of root-knot nematodes in the soil.

Root-knot nematodes (RKNs) are soil-borne pathogens that severely affect Panax notoginseng growth and productivity. Thus, there is an urgent need for biological control agents or green nematicides to control root-knot nematodes. Rhizosphere bacteria can effectively control RKNs through different mechanisms. In this study, the three rhizosphere Bacillus strains, isolated from the root of P. notoginseng, were evaluated for the nematicidal activity and biological control efficacy against root-knot nematodes. In addition, we also evaluated the colonization ability of the two bacterial strains with significant biocontrol effect and dynamic regulation of genes related to systemic resistance in P. notoginseng. The rhizosphere Bacillus velezensis GJ-7 and Bacillus cereus NS-2 showed high nematicidal activity against Meloidogyne hapla in vitro and significantly reduced the number of root galls in three different control experiments. The results of colonization experiments showed that the strains GJ-7 and NS-2 colonized P. notoginseng root rapidly and stably. Additionally, the colonization of the strains NS-2 and GJ-7 activated the defense-responsive genes in P. notoginseng. These results indicated that the B. cereus strain NS-2 and B. velezensis strain GJ-7 have the potential for successful ecological niche occupation and enhance plant resistance and therefore could be considered as potential biocontrol agents against root-knot nematodes.

Meloidogyne hapla causes significant economic damage to many cultivated plants including especially vegetables, fruit trees and potatoes. Due to the high number of hosts of this species, it limits the variety of crops to be planted in infested areas. In order to make quarantine measures and management strategies timely against M. hapla , the species need to be identified accurately and quickly. In this study, Kompetitive Allele-Specific PCR (KASP) genotyping assays were developed to identify M. hapla. Two forward primers and one reverse primer were designed as well and performed in the KASP protocols. The designed KASP assays were able to successfully distinguish M. hapla isolates from other root-knot nematodes (RKNs) and plant-parasitic nematodes (PPNs) species. The results showed that even DNA isolated from only one juvenile of M. hapla can be sufficient for molecular identification, and the sensitivity of the assay was very high. The developed KASP assays can be used for accurate and rapid identification of M. hapla. • SNP-based KASP assay was developed for the identification of Meloidogyne hapla. • Meloidogyne hapla was separated easily from plant-parasitic nematodes using developed assay. • Even DNA isolated from one juvenile of M. hapla can be sufficient for KASP assay. [ABSTRACT FROM AUTHOR]

The activity of alcohol extracts from 6 plant species was investigated with respect to the root-knot nematode-strawberry system. An evaluation was made of the nematostatic and nematicidal activity of the extracts. In production conditions, the most active was the extract Tanacetum vulgare at concentration 0.6%. It had the lowest M. hapla population density, with gall index and root/soil population densities not different than the oxamil treated plants and there were no stastically proved difference between T. vulgare and non-infested control.

Summary: The mechanism of root-knot nematode (RKN) resistance in black oat 'Terara' and its stability under high temperatures were examined. To investigate the suppressive mechanism, we observed root invasion and development of RKN in 'Terara'. Juveniles of Meloidogyne incognita , M. arenaria and M. javanica successfully invaded roots of 'Terara' 3 days after inoculation (DAI), whereas juveniles of M. hapla were hardly observed in black oat roots. The total number of M. incognita and the ratio of successfully developing juveniles were significantly lower in roots of 'Terara' than a susceptible cultivar from 7 DAI. A number of M. incognita developed to sausage-shaped juveniles in 'Terara'; however, juveniles beyond that stage were seldom observed. Histological observation of feeding sites suggested the poor development of giant cells was involved in this arrested development. Juveniles of M. arenaria and M. javanica also only developed to the sausage-shaped stage at 21 DAI. These observations indicated that 'Terara' and resistant common oat cultivars suppressed RKN in a similar way. The effect of high temperature on resistance was evaluated using 'Terara' cultivated at 30°C throughout the experiment and at 32°C for the initial 5 DAI. The number of egg masses of M. incognita under the 32°C treatment was slightly higher than the 25°C control. However, it was still suppressed to 4.9% of the susceptible cultivar. [ABSTRACT FROM AUTHOR]

Gene expression studies often require reliable housekeeping (HK) genes to accurately capture gene expression levels under given conditions. This is especially true for root-knot nematodes (RKN, Meloidogyne spp.), whose drastic developmental changes are strongly dependent upon their environment. Here we utilized a publicly available M. hapla RNAseq database to identify putative HK genes throughout the nematode lifecycle. We then validated these candidate HK genes on M. incognita in order to develop a small library of suitable HK genes for RKN. Seven putative HK genes were selected for validation based on high expression level and ease of primer design. The expression of these genes was quantified by qPCR at different developmental stages to capture the entire life cycle of M. incognita which included eggs and naive infective juveniles through 3-wk post inoculation. Two algorithms, geNorm and Normfinder, identified three genes (Disu, Poly, and Skinase) constitutively and uniformly expressed throughout the entire life cycle of RKN. We believe these genes are superior HK genes suitable to be used as internal reference genes at all stages of RKN. Importantly, while we identified Actin, a commonly used HK gene, as a candidate gene within our RNAseq analyses, our qPCR results did not demonstrate stable expression throughout the nematode life cycle of this gene. This study successfully validated suitable HK genes utilizing both RNAseq data and standard qPCR methods across two species of RKN; suitable HK genes are likely applicable to other species of RKN, or even plant-parasitic nematodes. Additional lists of potential HK genes are also provided if the nematode of interest does not have homologues of the three superior reference genes described here. Gene expression studies on RKN should use validated HK genes to ensure accurate representation of transcript abundance.

Root-knot nematodes (RKN; Meloidogyne spp.) are among the most damaging pests to tomato production in the USA and worldwide, with yield losses ranging from 25 to 100%. Host resistance conferred by the Mi gene in tomato is effective against some species of RKN (e.g. M. incognita, M. javanica, and M. arenaria); however, there are virulent species and lines including M. hapla and M. eterolobii that break Mi-mediated resistance. Plant innate immunity is another possible form of defense against pathogen attack and is known to be induced by chemical elicitors. Nicotinamide adenine dinucleotide (NAD) is one such chemical elicitor that regulates plant defense responses to multiple biotic stresses. In this study, we investigated the role of NAD in the context of induced tomato innate immunity and RKN pathogenicity in two tomato cultivars; VFN and Rutgers, with and without Mi, respectively. Single soil drench application of NAD 24 hr before nematode inoculation significantly induced defense response pathways, reduced infective-juveniles penetration, number of galls, and increased plant mass in both cultivars. Importantly, we observed no direct toxic effects of NAD on nematode viability and infectivity. The results presented here suggest that NAD induces resistance against RKN pathogenicity likely through the accumulation of tomato basal defense responses rather than the direct effect on the infective-juveniles behavior.

Background and Aims: Plant-parasitic nematodes are able to sense and respond to gradients of chemical signals. How pH and inorganic salts in the rhizosphere affect nematode accumulation and host-seeking is poorly understood. We investigate the response of different groups of plant-parasitic nematodes to pH and salt concentration gradients. Methods: Responses of infective juveniles (J2) of the economically important plant-parasitic nematodes, soybean cyst nematodes (SCN; Heterodera glycines) and root-knot nematodes (RKN; Meloidogyne incognita and M. hapla) to pH and salt gradients were assessed using Pluronic F-127 gel-based assays. Microelectrodes were utilized to measure pH and ion concentration gradients in the gel. Key Results: Differences were found between the three nematode species in response to acid, base and salts. For SCN, maximum nematode accumulation was between pH range 4.98–5.46 in an acid gradient, while the preferred alkaline pH ranges were 8.40–8.78 and 9.52–9.99. The preferred Cl− concentration for SCN attraction was 171–256 mM. RKN showed weak attraction to base and salt at low J2 concentration but increasing attraction at a greater nematode concentration. Conclusions: The pH and inorganic salts affect nematode behavior, accumulation, and survival. These findings provide new considerations for strategies to manage plant-parasitic nematodes under field conditions. [ABSTRACT FROM AUTHOR]

Summary: The effects of temperature and absence of a host plant on the population dynamics of the sheath nematode, Hemicycliophora conida , were studied under glasshouse conditions. Regarding temperature, population dynamics of H. conida on tomato 'Moneymaker' were monitored weekly over a period of 12 weeks. In the first experiment, with an average temperature of 21.4°C, population growth of H. conida continuously increased over time from an initial density of 106 nematodes (100 ml soil)−1 to a final density of 820 nematodes (100 ml soil)−1, resulting in a reproduction rate of 7.7. The time required to complete one generation was 6.5 weeks or 598 temperature degree days at 8°C base temperature (TDD8). A second experiment showed that the development of H. conida on tomato was faster at 22.1°C than at 19.0°C. At 22.1°C, one generation was completed after 6 weeks (= 588 TDD8) compared to 8 weeks (=634 TDD8) at 19.0°C. The higher temperature also resulted in a higher reproduction rate (93 at 22.1°C vs 7.8 at 19.0°C). In the absence of a host plant, the population density of H. conida decreased over time. However, this natural decline was less pronounced than for the root-knot nematode Meloidogyne hapla. In the first experiment, the population density of H. conida decreased within 18 weeks by 89.5%, while M. hapla was already no longer detectable 12 weeks after inoculation. In the second experiment, H. conida decreased by 98.2% within 16 weeks compared to 99.98% for M. hapla. [ABSTRACT FROM AUTHOR]

Root-knot nematodes (Meloidogyne spp.) are obligate endoparasites of a wide range of plant species. The infective stage is attracted strongly to and enters host roots at the zone of elongation, but the compounds responsible for this attraction have not been identified. We developed a simple assay to investigate nematode response to chemical gradients that uses Pluronic F-127, a synthetic block copolymer that, as a 23% aqueous solution, forms a liquid at low temperature and a gel at room temperature. Test chemicals are put into a modified pipette tip, or ‘chemical dispenser,’ and dispensers are inserted into the gel in which nematodes have been dispersed. Meloidogyne hapla is attracted to pH gradients formed by acetic acid and several other Brønsted acids and aggregates between pH 4.5 and 5.4. While this pH range was attractive to all tested root-knot nematode strains and species, the level of aggregation depended on the species/strain assessed. For actively growing roots, the pH at the root surface is most acidic at the zone of elongation. This observation is consistent with the idea that low pH is an attractant for nematodes. Root-knot nematodes have been reported to be attracted to carbon dioxide, but our experiments suggest that the observed attraction may be due to acidification of solutions by dissolved CO2 rather than to CO2 itself. These results suggest that Pluronic F-127 gel will be broadly applicable for examining responses of a range of organisms to chemical gradients or to each other.

Essential oils of medicinal and aromatic plants are important and promissing to manage the nematological problems in agriculture. In this study, five of the plants including Origanum onites, Salvia officinalis, Lippia citriodora, Mentha spicata and Mentha longifolia for egg hatching inhibition and four of the plants including Mentha piperita, Foeniculum vulgare, Coriandrum sativum and Ocimum basilicum for juvenile mortality were tested on Meloidogyne hapla under laboratory conditions. The oils were achieved by using water distillation method with a Clevenger apparatus. As the results of egg hatching trial, the highest egg hatching inhibition rate was found as 54% for O. onites. In addition, the other inhibition rates varied as 31.4%, 21.6%, 23.8%, 25.7% for the other plants, S. officinalis, M. longifolia, M. spicata and L. citriodora, respectively. Essential oil of each plant components were determined by gas chromatography (GC). Carvacrol was found as the main component (68.8%) of O. onites followed by Thujone 27.7% for S. officinalis, I-Menthone 76.9% for M. longifolia, Carvone 27.1% for M. spicata and Citral 19.3% for L. citriodora. For the juveile mortality, Mentha piperita showed the highest mortality rate as 93.2% and was followed by F. vulgare 72.9%, C. sativum 69.3% and O. basilicum 64.9%. The main component of the used plants were Carvone 39.3%, Anethole 40.2%, Linalool 81.3% and Linalool 54.6%, respectively. Keywords: Essential oil, Medicinal and aromatic plants, Meloidogyne hapla

Meloidogyne spp. are serious pests on many economically important plants, including food crops, vegetables, ornamental trees, and shrubs. Galled roots of Paulownia tomentosa Steud were collected from a plantation in the 2018 growing season in Poland. Morphological, morphometric, and molecular studies revealed the presence of Meloidogyne hapla in root systems and root zones of empress trees. To our knowledge, this is the first record of the occurrence of this nematode species on Paulownia tomentosa in Poland, as well as in Europe.

Essential oils of medicinal and aromatic plants are important and promissing to manage the nematological problems in agriculture. In this study, five of the plants including Origanum onites, Salvia officinalis, Lippia citriodora, Mentha spicata and Mentha longifolia for egg hatching inhibition and four of the plants including Mentha piperita, Foeniculum vulgare, Coriandrum sativum and Ocimum basilicum for juvenile mortality were tested on Meloidogyne hapla under laboratory conditions. The oils were achieved by using water distillation method with a Clevenger apparatus. As the results of egg hatching trial, the highest egg hatching inhibition rate was found as 54% for O. onites. In addition, the other inhibition rates varied as 31.4%, 21.6%, 23.8%, 25.7% for the other plants, S. officinalis, M. longifolia, M. spicata and L. citriodora, respectively. Essential oil of each plant components were determined by gas chromatography (GC). Carvacrol was found as the main component (68.8%) of O. onites followed by Thujone 27.7% for S. officinalis, I-Menthone 76.9% for M. longifolia, Carvone 27.1% for M. spicata and Citral 19.3% for L. citriodora. For the juveile mortality, Mentha piperita showed the highest mortality rate as 93.2% and was followed by F. vulgare 72.9%, C. sativum 69.3% and O. basilicum 64.9%. The main component of the used plants were Carvone 39.3%, Anethole 40.2%, Linalool 81.3% and Linalool 54.6%, respectively. [ABSTRACT FROM AUTHOR]

Root-knot nematodes (Meloidogyne spp.) are among the biotic factors that limit tomato production worldwide. The objectives of this study were to assess the distribution and identify Meloidogyne spp. and associated problems from major tomato growing areas of Ethiopia. A total of 212-rhizosphere soil and 123 root samples were sampled from 40 localities during 2012/13 growing season. A total of 646 respondents participated in the questionnaire to assess knowledge and practice of farmers and factors associated with RKN damage on tomato. Out of the 212 soil samples collected, 47.2% were found infested by various Meloidogyne species 8 weeks after the start of the bioassay test. Out of the 123 root samples collected, 65% had root galls. The highest prevalence (100%) of RKN was found on samples collected from Adami Tullu, Babile, Erer Gota, Hurso, Jittu, Tikur Wuha, Tepo Choronke, Zeway and Koka. The highest incidence (100%) of RKN was found from Adami Tullu, Jara Weyo, Babile, Erer Gota, Hurso, Jittu, Tikur Wuha, Tony farm, Tepo Choronke, Zeway and Koka localities based on direct observation of galls on collected root samples. Out of the 646 respondents, 43.3% reported to have RKN damage symptoms when shown the symptoms while 56.7% of them did not report damage. The highest significant effect on the dependent variable RKN damage on tomato roots comes from the previous crop, soil texture, awareness about RKN and source of irrigation water used. The presence of Meloidogyne incognita, M. javanica, M. arenaria and M. hapla on tomato was confirmed using a combination of molecular and biochemical identification tools. Five isolates of Meloidogyne spp. were not properly identified and could be new species. The two tropical species, M. incognita (48.4%) and M. javanica (41.2%) were the most prevalent species. Both species were also co-infesting tomato plants. Meloidogyne hapla was detected for the first time in an open tomato production farmer's field at 'Zeway' locality with 1620 m.a.s.l. elevation. The occurrence of these Meloidogyne species alone, or in mixed populations from samples collected, clearly shows that RKN are widespread in major tomato growing areas of Ethiopia. In the near future, the economic importance of M. arenaria and M. hapla on tomato production in Ethiopian agriculture should be investigated. [ABSTRACT FROM AUTHOR]

Abstract In Florida, strawberry is an economically important horticultural crop. Plant-parasitic nematodes present a significant obstacle for strawberry growers in the sandy soils found in this state. Historically, nematodes have been controlled through the application of soil fumigants; however, there is interest in exploring the use of non-fumigant nematicides that can provide similar levels of control and at the same time be more environmentally friendly than fumigants. Using two field experiments, the effects of non-fumigant chemical and biological nematicides on plant vigour and fruit yield, populations of plant-parasitic nematodes, and populations of free-living nematode feeding groups were evaluated. In experiment 1, soil fumigation with metam potassium, as well as all non-fumigant chemical nematicides (fluopyram, fluensulfone, fluazaindolizine) failed to increase plant vigour, fruit yield, or suppress populations of plant-parasitic nematodes. In experiment 2, fluopyram increased fruit yield and suppressed Belonolaimus longicaudatus populations by the end of the growing season. Biological nematicides (Dazitol®, Majestene®, and Nemakill®) did not enhance crop establishment or suppress plant-parasitic nematode populations. Soil fumigation with 1,3-dichloropropene + chloropicrin provided consistent enhancement of plant vigour and fruit yield, as well as suppressed populations of B. longicaudatus ; however, populations of free-living nematodes were also reduced. Overall, soil application of fluopyram shows potential to be a component of an integrated pest management strategy for the control of B. longicaudatus populations on strawberry in Florida. Highlights • Chemical and biological nematicides were evaluated on strawberry in Florida. • In experiment 1, metam potassium and non-fumigant nematicides did not improve yield. • In experiment 2, fluopyram increased yield and suppressed Belonolaimus longicaudatus. • Fumigation with 1,3D + chloropicrin improved yield, vigor, and suppressed nematodes. [ABSTRACT FROM AUTHOR]

Root-knot nematodes (RKN; Meloidogyne spp.) are among the most damaging pests to tomato production in the USA and worldwide, with yield losses ranging from 25 to 100%. Host resistance conferred by the Mi gene in tomato is effective against some species of RKN (e.g. M. incognita, M. javanica, and M. arenaria); however, there are virulent species and lines including M. hapla and M. eterolobii that break Mimediated resistance. Plant innate immunity is another possible form of defense against pathogen attack and is known to be induced by chemical elicitors. Nicotinamide adenine dinucleotide (NAD) is one such chemical elicitor that regulates plant defense responses to multiple biotic stresses. In this study, we investigated the role of NAD in the context of induced tomato innate immunity and RKN pathogenicity in two tomato cultivars; VFN and Rutgers, with and without Mi, respectively. Single soil drench application of NAD 24 hr before nematode inoculation significantly induced defense response pathways, reduced infective-juveniles penetration, number of galls, and increased plant mass in both cultivars. Importantly, we observed no direct toxic effects of NAD on nematode viability and infectivity. The results presented here suggest that NAD induces resistance against RKN pathogenicity likely through the accumulation of tomato basal defense responses rather than the direct effect on the infective-juveniles behavior. [ABSTRACT FROM AUTHOR]

Gene expression studies often require reliable housekeeping (HK) genes to accurately capture gene expression levels under given conditions. This is especially true for root-knot nematodes (RKN, Meloidogyne spp.), whose drastic developmental changes are strongly dependent upon their environment. Here we utilized a publicly available M. hapla RNAseq database to identify putative HK genes throughout the nematode lifecycle. We then validated these candidate HK genes on M. incognita in order to develop a small library of suitable HK genes for RKN. Seven putative HK genes were selected for validation based on high expression level and ease of primer design. The expression of these genes was quantified by qPCR at different developmental stages to capture the entire life cycle of M. incognita which included eggs and naive infective juveniles through 3-wk post inoculation. Two algorithms, geNorm and Normfinder, identified three genes (Disu, Poly, and Skinase) constitutively and uniformly expressed throughout the entire life cycle of RKN. We believe these genes are superior HK genes suitable to be used as internal reference genes at all stages of RKN. Importantly, while we identified Actin, a commonly used HK gene, as a candidate gene within our RNAseq analyses, our qPCR results did not demonstrate stable expression throughout the nematode life cycle of this gene. This study successfully validated suitable HK genes utilizing both RNAseq data and standard qPCR methods across two species of RKN; suitable HK genes are likely applicable to other species of RKN, or even plant-parasitic nematodes. Additional lists of potential HK genes are also provided if the nematode of interest does not have homologues of the three superior reference genes described here. Gene expression studies on RKN should use validated HK genes to ensure accurate representation of transcript abundance. [ABSTRACT FROM AUTHOR]

Abstract The field efficacy of Pseudomonas fluorescens , Purpureocillium lilacinum and Trichoderma viride liquid formulations was investigated against natural populations of root-knot nematode, Meloidogyne hapla. Two field experiments were conducted to test the effect of these biocontrol agents by seed treatment (ST) at 100 mL/kg of seed and by soil drenching (SD) at 5 L/ha. Their effect was compared with that of carbofuran 3G at 1 kg a.i. ha−1. Results showed that all the tested biocontrol agents were capable of reducing M. hapla juvenile (J2) population in soil, infection of female population in roots and egg numbers per gram of root at various levels. The biocontrol efficacy also varied according to the delivery method. The P. fluorescens- ST caused greatest reduction of J2 populations (67–69%) in soil, female infection (67–69%) in roots and egg numbers per gram of root (68–69%). Similar efficacy was observed in P. lilacinum -SD, which reduced J2 population by 64–67%, infection of female populations by 62–63% and egg numbers by 63–66%. The carrot plants treated with P. fluorescens- ST and P. lilacinum -SD were 33–36% taller with 28–36% more leaves and 27–30% longer leaves than untreated plants. It resulted in 20–21% higher root tuber yield in P. fluorescens -ST and 19% in P. lilacinum -SD plots. Root colonization of the introduced P. fluorescens was 6 times higher when it was applied as ST than as SD. The trend was opposite in P. lilacinum, which colonized 4–5 times higher in the SD method than as ST. The efficacy was comparable with that of carbofuran application. It is concluded that P. fluorescens -ST at 100 mL/kg of seed and P. lilacinum -SD at 5 L/ha are highly effective for the management of M. hapla, which infects carrot under field conditions. Highlights • Liquid Pseudomonas fluorescens , P. lilacinum and T. viride controlled M. hapla in carrot fields. • P. fluorescens seed treatment (ST) and P. lilacinum soil drenching (SD) were more effective for M. hapla control. • P. fluorescens- ST and P. lilacinum -SD improved growth and yield of carrot. • P. fluorescens colonization was higher in ST than SD; the trend was opposite for P. lilacinum. • T. viride was less effective for M. hapla control in carrot fields. [ABSTRACT FROM AUTHOR]

Drosomycin-type antifungal peptides (DTAFPs) are natural effectors of the innate immune system, which are restrictedly distributed in plants and ecdysozoans. Mehamycin is a bi-domain DTAFP (abbreviated as bDTAFP) firstly found in the Northern root-knot nematode Meloidogyne hapla . Here, we report its structural and functional features and the evolution of bDTAFPs in nematodes. Different from classical DTAFPs, mehamycin contains an insertion, called single Disulfide Bridge-linked Domain (abbreviated as sDBD), located in a loop region of the drosomycin scaffold. Despite this, recombinant mehamycin likely adopts a similar fold to drosomycin, as revealed by the circular dichroism spectral analysis. Functionally, it showed some weak activity against three species of fungi but relatively stronger activity against seven species of Gram-positive bacteria, indicative of functional diversification between mehamycin and classical DTAFPs. By computational data mining of the nematode databases, we identified polymorphic genes encoding mehamycin and a new multigene family of bDTAFPs (named roremycins) from Rotylenchulus reniformis . A combination of data suggests that the origination of sDBDs from M. hapla and R. reniformis is a consequence of convergent evolution, in which some probably suffered positive selection during evolution. Our study may be valuable in understanding the role of these unique antimicrobial peptides in the innate immunity of nematodes. [ABSTRACT FROM AUTHOR]

ABSTRACT: In recent years "redness" has increasingly appeared in strawberry plants with leaves taking on a reddish color. No causal agent has been associated with plants. Since strawberries presented problems due to the incidence of nematodes, the purpose of this study was to look at the relationship between production, resistance to the Meloidogyne hapla nematode and the "redness" symptom in strawberry cultivars. Two experiments were performed, both with the 'Camino Real', 'Festival', 'Oso Grande', 'Albion' and 'Camarosa' cultivars. The first experiment was performed in the field, where the following were evaluated: strawberry production, fruit quality, macro and micronutrient contents in fruit and leaves, percentage of plant survival, incidence of nematodes, quantity of eggs in the roots and juveniles in the soil, and the incidence of Botrytis cinerea . In the second experiment, the strawberries were transplanted into pots and filled with pinus bark-based commercial substrate. Half the pots were inocculated with Meloidogyne hapla . Cultivars presented differences in fruit production and also in the incidence of "redness". Lowest performance in production was related to the high incidence of the nematode Meloidogyne hapla. 'Oso Grande' and 'Albion' presented nematode-resistant behavior. It was possible find a relationship between the incidence of the Meloidogyne hapla nematode, and the incidence of "redness" only 'Camino Real' cultivar.

Keywords: Cyclopia maculata; herbal tea; Meloidogyne hapla; Meloidogyne javanica; plant-parasitic nematode EN Cyclopia maculata herbal tea Meloidogyne hapla Meloidogyne javanica plant-parasitic nematode 591 593 3 07/03/20 20200501 NES 200501 Root-knot nematode (RKN) I Meloidogyne i species are one of the most important plant-parasitic nematodes causing severe damage to agricultural crops worldwide. Significant yield losses often result from the feeding activities of the nematodes on plant roots, which in many cases disrupt the vascular system of the roots and may lead to plant death. Cyclopia maculata, herbal tea, Meloidogyne hapla, Meloidogyne javanica, plant-parasitic nematode. [Extracted from the article]

The suppressive effect of a black oat, Avena strigosa, breeding line KH1a on Meloidogyne spp. was examined in pot tests and on Meloidogyne incognita in pot and field tests. In pot tests, roots of black oats were examined 42-46 days after inoculation of 500 second-stage juveniles. There were significantly fewer egg masses on the roots of KH1a than on 12 black oat cultivars examined. KH1a was a poor host for four isolates of M. incognita, two isolates of M. arenaria and one isolate of M. javanica, and a non-host for one isolate of M. hapla. The effect of autumn and spring cropping of KH1a on soil nematode density was examined in M. incognitainfested fields. Nematode density after autumn cropping of KH1a was significantly lower than that after susceptible black oat, resulting in significantly lower Pf/Pi in KH1a (0.10 and 0.13) than in susceptible black oat (0.42 and 0.74). Damage indices of the succeeding crop, sweet potato, were significantly lower in KH1a plots than in susceptible black oat plots. In spring cropping, there were significantly fewer soil nematodes in KH1a plots than in susceptible black oat plots 3 weeks after cultivation. In both autumn and spring cropping, there was no significant difference in soil nematode density between KH1a and bare fallow. These results suggested that KH1a is a good alternative to current susceptible cultivars for the management of M. incognita. [ABSTRACT FROM AUTHOR]