Search

This article presents information on polyclonal antibodies. Polyclonal antibodies were produced against sonicated and heat-killed cells of Pseudomonas syringae pv. pisi strain UQM551 and Pseudomonas syringae pv. syringae strain, and their specificities were compared. Evidence is presented that the serological specificity between these two pathovars lies in surface antigens. Of the surface antigens purified and tested, only fiagelia and tipopolysaccharide from the cell wall showed no cross-reactivity with heterologous antisera. Antisera to glutaraldehyde-fixed flagella of the two strains showed a high level of specificity.

All strains tested which are pathogenic to peas and which react with antiserum to Pseudomonas syringae pv. pisi contain two to four plasmids; non-pathogens contain none. Two plasmids from a pathogenic strain were transferred individually to a non-pathogenic recipient strain of Pseudomonas syringae: both plasmids converted the recipient to a pathogen on peas and from hypersensitivity negative to hypersensitivity positive on tobacco. Neither plasmid encoded homoserine catabolism. [ABSTRACT FROM AUTHOR]

Abstract Background We aimed to engineer transgenic plants for the purpose of early detection of plant pathogen infection, which was accomplished by employing synthetic pathogen inducible promoters fused to reporter genes for altered phenotypes in response to the pathogen infection. Toward this end, a number of synthetic promoters consisting of inducible regulatory elements fused to a red fluorescent protein (RFP) reporter were constructed for use in phytosensing. Results For rapid analysis, an Agrobacterium-mediated transient expression assay was evaluated, then utilized to assess the inducibility of each synthetic promoter construct in vivo. Tobacco (Nicotiana tabacum cv. Xanthi) leaves were infiltrated with Agrobacterium harboring the individual synthetic promoter-reporter constructs. The infiltrated tobacco leaves were re-infiltrated with biotic (bacterial pathogens) or abiotic (plant defense signal molecules salicylic acid, ethylene and methyl jasmonate) agents 24 and 48 hours after initial agroinfiltration, followed by RFP measurements at relevant time points after treatment. These analyses indicated that the synthetic promoter constructs were capable of conferring the inducibility of the RFP reporter in response to appropriate phytohormones and bacterial pathogens, accordingly. Conclusions These observations demonstrate that the Agrobacterium-mediated transient expression is an efficient method for in vivo assays of promoter constructs in less than one week. Our results provide the opportunity to gain further insights into the versatility of the expression system as a potential tool for high-throughput in planta expression screening prior to generating stably transgenic plants for pathogen phytosensing. This system could also be utilized for temporary phytosensing; e.g., not requiring stably transgenic plants.

Abstract Background The ubiquitin protein is present in all eukaryotic cells and promoters from ubiquitin genes are good candidates to regulate the constitutive expression of transgenes in plants. Therefore, two switchgrass (Panicum virgatum L.) ubiquitin genes (PvUbi1 and PvUbi2) were cloned and characterized. Reporter constructs were produced containing the isolated 5' upstream regulatory regions of the coding sequences (i.e. PvUbi1 and PvUbi2 promoters) fused to the uidA coding region (GUS) and tested for transient and stable expression in a variety of plant species and tissues. Results PvUbi1 consists of 607 bp containing cis-acting regulatory elements, a 5' untranslated region (UTR) containing a 93 bp non-coding exon and a 1291 bp intron, and a 918 bp open reading frame (ORF) that encodes four tandem, head -to-tail ubiquitin monomer repeats followed by a 191 bp 3' UTR. PvUbi2 consists of 692 bp containing cis-acting regulatory elements, a 5' UTR containing a 97 bp non-coding exon and a 1072 bp intron, a 1146 bp ORF that encodes five tandem ubiquitin monomer repeats and a 183 bp 3' UTR. PvUbi1 and PvUbi2 were expressed in all examined switchgrass tissues as measured by qRT-PCR. Using biolistic bombardment, PvUbi1 and PvUbi2 promoters showed strong expression in switchgrass and rice callus, equaling or surpassing the expression levels of the CaMV 35S, 2x35S, ZmUbi1, and OsAct1 promoters. GUS staining following stable transformation in rice demonstrated that the PvUbi1 and PvUbi2 promoters drove expression in all examined tissues. When stably transformed into tobacco (Nicotiana tabacum), the PvUbi2+3 and PvUbi2+9 promoter fusion variants showed expression in vascular and reproductive tissues. Conclusions The PvUbi1 and PvUbi2 promoters drive expression in switchgrass, rice and tobacco and are strong constitutive promoter candidates that will be useful in genetic transformation of monocots and dicots.

Switchgrass (Panicum virgatum L.) is a North American grass species with biofuel potential. Claviceps spp. is known to infect the florets of various grass species, initially characterized by a sticky honeydew exudate and later as sclerotium replacing the seed in the infected ovary (Tanaka et al 2023). Since 2019, from July to October, switchgrass panicles in Georgia have been observed with honeydew and black sclerotia. The disease was first noted on some of the 285 accessions of the genome-wide association study (GWAS) panels at the University of Georgia's Iron Horse Farm in Watkinsville and Gibbs Farm in Tifton, GA. In Watkinsville, GA, ergot incidence was 5%, 6%, 65% and 54% in 2019, 2020, 2021 and 2022, respectively. Symptomatic panicles with honeydew and sclerotia were collected in 2021 (sample Scl) and 2023 (samples Cla_M and ATH20cl) from Watkinsville, GA. Under microcopy, panicles with honeydew symptoms had mycelium and conidia (9 μm long [range of 5-13 μm] and 4 μm wide [3-5 μm]) consistent with Claviceps spp. (Tooley et al. 2001). Sclerotia were 1.5 mm long (range 1-3 mm). Sclerotia were surface sterilized for 3 minutes in 5% NaOCl, followed by 70% ethanol then rinsed three times in distilled water. Sterilized sclerotia were plated on potato dextrose agar and placed on bench top with a 12-hour day/night cycle at room temperature (22°C) (Singh 1976). After 2 months, the sclerotia produced sterile apothecia. For molecular identification, genomic DNA was extracted from three honeydew samples following the protocol of Doyle and Doyle (1987). The internal transcribed spacer (ITS) region and RNA polymerase second largest subunit (RPB2) gene were amplified using ITS4/ITS5 (White et al. 1990) and 5F2/7CR (Liu et al. 1999) primer sets. The ITS region of ATH20cl, Cla_M, and Scl (GenBank nos. PP546317- PP546319) showed 92.83-97.48% identity to C. clavispora (NR_163506.1). The RPB2 region of ATH20cl, Cla_M, and Scl (GenBank nos. PP573916- PP573918) showed 97.46-97.72% identity to C. clavispora (LT216566.1). The maximum likelihood tree constructed in MEGA-X (Kumar et al. 2018) using concatenated ITS (539 bp) and RPB2 (792 bp) gene sequences from this study and eleven reference sequences from Tanaka et al. (2023), revealed close relatedness of ATH20cl, Cla_M, and Scl to C. clavispora under section Pusillae. The pathogenicity test for samples ATH20cl and Cla_M was conducted in the greenhouse on switchgrass cultivar 'Alamo' grown in injection molded pots containing Sungro professional growing mix. Three replicates plants at reproductive (R3) growth stage were inoculated by immersing panicles in 105 spores/ml suspension for 5 minutes and bagged for 3 days (Tooley et al. 2001). Control plants were immersed in distilled water. Honeydew symptoms and sclerotia appeared within 7- and 90-days post-inoculation, respectively, whereas control plants remained symptom-free. The honeydew collected from the infected Alamo panicles were reconfirmed to produce similar spores to those collected from the field. This is the first report of ergot caused by C. clavispora in switchgrass. Ergot was also observed since 2019 on some accessions from the same GWAS panel planted at the University of Tennessee Plant Sciences Farm in Knoxville, TN. This information will be beneficial to determine the effect of ergot on biomass production and seed quality of switchgrass in the southeastern U.S.

Purpose: The approach to skin closure in spinal surgery is dependent on surgeon preference and experience. Wound complications, including dehiscence and surgical site infection (SSI), are common following spine surgery. The authors reviewed various wound closure techniques employed in spinal surgery., Methods: A systematic review was conducted to identify articles comparing wound closure techniques after posterior spinal surgery. Articles that employed experimental or observational cohort study designs and reported rates of SSI, dehiscence, or scarring following spinal surgery were included., Results: Eight studies examining closure techniques of the skin were identified: five retrospective cohort studies and three randomized-controlled trials. No differences in the incidence of SSI were reported based on suture technique, although staples were associated with higher SSI rates in single level spinal fusion, and barbed suture resulted in decreased wound complications. The use of intracutaneous sutures was associated with a higher incidence of wound dehiscence when compared to tension-relieving far-near near-far suture (FNS) and far-near near-far interrupted point (FNP) sutures. However, the latter two also resulted in the highest rates of delayed wound healing (i.e., time to fully heal). Modified Allgöwer-Donati suture (MADS) resulted in smaller scar area when compared to vertical mattress suture., Conclusion: Significant differences exist in wound healing when comparing suture techniques in spinal surgery. Surgical staples allow for faster closing time, but are also associated with higher wound complications. Intracutaneous sutures appear to have higher rates of dehiscence compared to vertical mattress suture but display faster wound healing. Future studies are necessary to elucidate contributory factors, including local ischemia and changes in tensile forces., Level of Evidence: Level IV., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Key Message: The soybean gene GmSABP2-1 encodes methyl salicylate esterase and its overexpression led to significant reduction in development of pathogenic soybean cyst nematode. Soybean cyst nematode (SCN, Heterodera glycines) is one of the most devastating pests of soybean (Glycine max L. Merr.). In searching for SCN-defense genes, a soybean gene of the methylesterase (MES) family was found to be upregulated in an SCN-resistant soybean line and downregulated in an SCN-susceptible line upon SCN infection. This gene was designated as GmSABP2-1. Here, we report on biochemical and overexpression studies of GmSABP2-1 to examine its possible function in SCN resistance. The protein encoded by GmSABP2-1 is closely related to known methyl salicylate esterases. To determine the biochemical function of GmSABP2-1, a full-length cDNA of GmSABP2-1 was cloned into a protein expression vector and expressed in Escherichia coli. The resulting recombinant GmSABP2-1 was demonstrated to catalyze the demethylation of methyl salicylate. The biochemical properties of GmSABP2-1 were determined. Its apparent Km value was 46.2 ± 2.2 μM for methyl salicylate, comparable to those of the known methyl salicylate esterases. To explore the biological significance of GmSABP2-1 in soybean defense against SCN, we first overexpressed GmSABP2-1 in transgenic hairy roots of an SCN-susceptible soybean line. When infected with SCN, GmSABP2-1-overexpressing hairy roots showed 84.5% reduction in the development of SCN beyond J2 stage. To provide further genetic evidence for the role of GmSABP2-1 in SCN resistance, stable transgenic soybean plants overexpressing GmSABP2-1 were produced. Analysis of the GmSABP2-1-overexpressing lines showed a significant reduction in SCN development compared to non-transgenic plants. In conclusion, we demonstrated that GmSABP2-1 encodes methyl salicylate esterase and functions as a resistance-related gene against SCN., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Key Message: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Economically viable production of biobased products and fuels requires high-yielding, high-quality, sustainable process-advantaged crops, developed using bioengineering or advanced breeding approaches. Understanding which crop phenotypic traits have the largest impact on biofuel economics and sustainability outcomes is important for the targeted feedstock crop development. Here, we evaluated biomass yield and cell-wall composition traits across a large natural variant population of switchgrass ( Panicum virgatum L .) grown across three common garden sites. Samples from 331 switchgrass genotypes were collected and analyzed for carbohydrate and lignin components. Considering plant survival and biomass after multiple years of growth, we found that 84 of the genotypes analyzed may be suited for commercial production in the southeastern U.S. These genotypes show a range of growth and compositional traits across the population that are apparently independent of each other. We used these data to conduct techno-economic analyses and life cycle assessments evaluating the performance of each switchgrass genotype under a standard cellulosic ethanol process model with pretreatment, added enzymes, and fermentation. We find that switchgrass yield per area is the largest economic driver of the minimum fuel selling price (MSFP), ethanol yield per hectare, global warming potential (GWP), and cumulative energy demand (CED). At any yield, the carbohydrate content is significant but of secondary importance. Water use follows similar trends but has more variability due to an increased dependence on the biorefinery model. Analyses presented here highlight the primary importance of plant yield and the secondary importance of carbohydrate content when selecting a feedstock that is both economical and sustainable., Competing Interests: The authors declare no competing financial interest., (© 2024 The Authors. Published by American Chemical Society.)

In spite of its high mortality rate and difficulty in finding a cure, scientific advancements have contributed to a reduction in cancer-related fatalities. Aberrant gene expression during carcinogenesis emphasizes the importance of targeting the signaling networks that control gene expression in cancer treatment. Long noncoding RNAs (lncRNAs), which are transcribed RNA molecules that play a role in gene expression regulation, are a recent innovative therapeutic approach for diagnosing and treating malignancies. MALAT1, a well-known lncRNA, functions in gene expression, RNA processing, and epigenetic control. High expression levels of MALAT1 are associated with several human disorders, including metastasis, invasion, autophagy, and proliferation of cancer cells. MALAT1 affects various signaling pathways and microRNAs (miRNAs), and this study aims to outline its functional roles in cancer metastasis and its interactions with cellular signaling pathways. Moreover, MALAT1 and its interactions with signaling pathways can be promising target for cancer treatment., (© 2023. The Author(s), under exclusive licence to Springer Nature Switzerland AG.)

Tissue growth kinetics and interface dynamics depend on the properties of the tissue environment and cell-cell interactions. In cellular environments, substrate heterogeneity and geometry arise from a variety factors, such as the structure of the extracellular matrix and nutrient concentration. We used the CellSim3D model, a kinetic cell division simulator, to investigate the growth kinetics and interface roughness dynamics of epithelial tissue growth on heterogeneous substrates with varying topologies. The results show that the presence of quenched disorder has a clear effect on the colony morphology and the roughness scaling of the interface in the moving interface regime. In a medium with quenched disorder, the tissue interface has a smaller interface roughness exponent, α, and a larger growth exponent, β. The scaling exponents also depend on the topology of the substrate and cannot be categorized by well-known universality classes.

Background: Several case-control studies have suggested that global and loci-specific deoxyribonucleic acid (DNA) methylation in peripheral blood mononuclear cells (PBMCs) of DNA might be potential biomarkers of cancer diagnosis and prognosis. In this study, for the first time, we intended to assess the diagnostic power of the methylation level of tumor suppressor candidate 3 ( TUSC3 ) gene promoter in patients with colorectal cancer (CRC)., Materials and Methods: In the current study, we quantitatively assessed the promoter methylation level of TUSC3 in PBMCs of 70 CRC cases and 75 non-cancerous subjects via methylation quantification of endonuclease-resistant DNA (MethyQESD) method., Results: The methylation level of the TUSC3 was meaningfully higher in CRC cases than in non-CRC subjects (43.55 ± 21.80% vs. 16.07 ± 13.63%, respectively; P < 0.001). The sensitivity and specificity of this gene for the detection of CRC were 88.6% and 76.0%, respectively. The receiver operating characteristic (ROC) curve examination discovered an area under the curve (AUC) of 0.880, representing a very high accuracy of the TUSC3 methylation marker in distinguishing CRC subjects from healthy individuals. However, there was no substantial diversity in methylation level between various CRC stages ( P : 0.088)., Conclusion: For CRC screening, PBMCs are a reliable source for DNA methylation analysis and TUSC3 promoter methylation can be utilized as a hopeful biomarker for early and non-invasive diagnosis of CRC., Competing Interests: There are no conflicts of interest., (Copyright: © 2023 Advanced Biomedical Research.)

Soybean ( Glycine max ) is an important crop in agricultural production where water shortage limits yields in soybean. Root system plays important roles in water-limited environments, but the underlying mechanisms are largely unknown. In our previous study, we produced a RNA-seq dataset generated from roots of soybean at three different growth stages (20-, 30-, and 44-day-old plants). In the present study, we performed a transcriptome analysis of the RNA-seq data to select candidate genes with probable association with root growth and development. Candidate genes were functionally examined in soybean by overexpression of individual genes using intact soybean composite plants with transgenic hairy roots. Root growth and biomass in the transgenic composite plants were significantly increased by overexpression of the GmNAC19 and GmGRAB1 transcriptional factors, showing up to 1.8-fold increase in root length and/or 1.7-fold increase in root fresh/dry weight. Furthermore, greenhouse-grown transgenic composite plants had significantly higher seed yield by about 2-fold than control plants. Expression profiling in different developmental stages and tissues showed that GmNAC19 and GmGRAB1 were most highly expressed in roots, displaying a distinct root-preferential expression. Moreover, we found that under water-deficit conditions, overexpression of GmNAC19 enhanced water stress tolerance in transgenic composite plants. Taken together, these results provide further insights into the agricultural potential of these genes for development of soybean cultivars with improved root growth and enhanced tolerance to water-deficit conditions., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Mazarei, Routray, Piya, Stewart and Hewezi.)

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean ( Glycine max ) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm ( Helicoverpa zea ) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines ) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Sultana, Mazarei, Jurat-Fuentes, Hewezi, Millwood and Stewart.)

The universality of interfacial roughness in growing epithelial tissue has remained a controversial issue. Kardar-Parisi-Zhang (KPZ) and molecular beam epitaxy (MBE) universality classes have been reported among other behaviors including a total lack of universality. Here, we simulate tissues using the cellsim3d kinetic division model for deformable cells to investigate cell-colony scaling. With seemingly minor model changes, it can reproduce both KPZ- and MBE-like scaling in configurations that mimic the respective experiments. Tissue growth with strong cell-cell adhesion in a linear geometry is KPZ like, while weakly adhesive tissues in a radial geometry are MBE like. This result neutralizes the apparent scaling controversy.

We previously identified cis -regulatory motifs in the soybean ( Glycine max ) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines . The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita . There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda ; and bacteria: Pseudomonas syringe pv. glycinea , P. syringe pv. tomato , and P. marginalis ) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Sultana, Mazarei, Millwood, Liu, Hewezi and Stewart.)

Switchgrass ( Panicum virgatum L.) has immense potential as a bioenergy crop with the aim of producing biofuel as an end goal. Nitrogen (N)-related sustainability traits, such as nitrogen use efficiency (NUE) and nitrogen remobilization efficiency (NRE), are important factors affecting switchgrass quality and productivity. Hence, it is imperative to develop nitrogen use-efficient switchgrass accessions by exploring the genetic basis of NUE in switchgrass. For that, we used 331 diverse field-grown switchgrass accessions planted under low and moderate N fertility treatments. We performed a genome wide association study (GWAS) in a holistic manner where we not only considered NUE as a single trait but also used its related phenotypic traits, such as total dry biomass at low N and moderate N, and nitrogen use index, such as NRE. We have evaluated the phenotypic characterization of the NUE and the related traits, highlighted their relationship using correlation analysis, and identified the top ten nitrogen use-efficient switchgrass accessions. Our GWAS analysis identified 19 unique single nucleotide polymorphisms (SNPs) and 32 candidate genes. Two promising GWAS candidate genes, caffeoyl-CoA O-methyltransferase ( CCoAOMT ) and alfin-like 6 ( AL6 ), were further supported by linkage disequilibrium (LD) analysis. Finally, we discussed the potential role of nitrogen in modulating the expression of these two genes. Our findings have opened avenues for the development of improved nitrogen use-efficient switchgrass lines., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Shrestha, Chhetri, Kainer, Xu, Hamilton, Piasecki, Wolfe, Wang, Saha, Jacobson, Millwood, Mazarei and Stewart.)

Phytosensors are genetically engineered plant-based sensors that feature synthetic promoters fused to reporter genes to sense and report the presence of specific biotic and abiotic stressors on plants. However, when induced reporter gene output is below detectable limits, owing to relatively weak promoters, the phytosensor may not function as intended. Here, we show modifications to the system to amplify reporter gene signal by using a synthetic transcription factor gene driven by a plant pathogen-inducible synthetic promoter. The output signal was unambiguous green fluorescence when plants were infected by pathogenic bacteria. We produced and characterized a phytosensor with improved sensing to specific bacterial pathogens with targeted detection using spectral wavelengths specific to a fluorescence reporter at 3 m standoff detection. Previous attempts to create phytosensors revealed limitations in using innate plant promoters with low-inducible activity since they are not sufficient to produce a strong detectable fluorescence signal for standoff detection. To address this, we designed a pathogen-specific phytosensor using a synthetic promoter-transcription factor system: the S-Box cis -regulatory element which has low-inducible activity as a synthetic 4xS-Box promoter, and the Q-system transcription factor as an amplifier of reporter gene expression. This promoter-transcription factor system resulted in 6-fold amplification of the fluorescence after infection with a potato pathogen, which was detectable as early as 24 h post-bacterial infection. This novel bacterial pathogen-specific phytosensor potato plant demonstrates that the Q-system may be leveraged as a powerful orthogonal tool to amplify a relatively weak synthetic inducible promoter, enabling standoff detection of a previously undetectable fluorescence signal. Pathogen-specific phytosensors would be an important asset for real-time early detection of plant pathogens prior to the display of disease symptoms on crop plants., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Persad-Russell, Mazarei, Schimel, Howe, Schmid, Kakeshpour, Barnes, Brabazon, Seaberry, Reuter, Lenaghan and Stewart.)

Proteinase inhibitors (PIs) from legumes have the potential for use as protectants in response to pests and pathogens. Legumes have evolved PIs that inhibit digestive proteinases upon herbivory resulting in delayed development, deformities, and reduced fertility of herbivorous insects. Legume PIs (serine proteinase inhibitors and cysteine proteinase inhibitors) have been overexpressed in plants to confer plant protection against herbivores. Recently, the co-expression of multiple PIs in transgenic plants enhanced host defense over single PI expression, i.e., in an additive fashion. Therefore, a synthetic PI could conceivably be designed using different inhibitory domains that may provide multifunctional protection. Little attention has yet given to expanding PI gene repertoires to improve PI efficacy for targeting multiple proteinases. Also, PIs have been shown to play an important role in response to abiotic stresses. Previously published papers have presented several aspects of strategic deployment of PIs in transgenic plants, which is the focus of this review by providing a comprehensive update of the recent progress of using PIs in transgenic plants. We also emphasize broadening the potential usefulness of PIs and their future direction in research, which will likely result in a more potent defense against herbivores., (© 2021. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Unmanned aerial vehicles (UAVs) provide an intermediate scale of spatial and spectral data collection that yields increased accuracy and consistency in data collection for morphological and physiological traits than satellites and expanded flexibility and high-throughput compared to ground-based data collection. In this study, we used UAV-based remote sensing for automated phenotyping of field-grown switchgrass ( Panicum virgatum ), a leading bioenergy feedstock. Using vegetation indices calculated from a UAV-based multispectral camera, statistical models were developed for rust disease caused by Puccinia novopanici , leaf chlorophyll, nitrogen, and lignin contents. For the first time, UAV remote sensing technology was used to explore the potentials for multiple traits associated with sustainable production of switchgrass, and one statistical model was developed for each individual trait based on the statistical correlation between vegetation indices and the corresponding trait. Also, for the first time, lignin content was estimated in switchgrass shoots via UAV-based multispectral image analysis and statistical analysis. The UAV-based models were verified by ground-truthing via correlation analysis between the traits measured manually on the ground-based with UAV-based data. The normalized difference red edge (NDRE) vegetation index outperformed the normalized difference vegetation index (NDVI) for rust disease and nitrogen content, while NDVI performed better than NDRE for chlorophyll and lignin content. Overall, linear models were sufficient for rust disease and chlorophyll analysis, but for nitrogen and lignin contents, nonlinear models achieved better results. As the first comprehensive study to model switchgrass sustainability traits from UAV-based remote sensing, these results suggest that this methodology can be utilized for switchgrass high-throughput phenotyping in the field.

Resistance to temozolomide (TMZ) is the main cause of death in glioblastoma multiforme (GBM). The use of nanocarriers for drug delivery applications is one of the known approaches to overcome drug resistance. This study aimed to investigate the possible effect of selenium-chitosan nanoparticles loaded with TMZ on the efficacy of TMZ on the expression of MGMT, E2F6, and RELA genes and the rate of apoptosis in the C6 cell line. Selenium nanoparticles (SNPs) were loaded with TMZ and then they were coated by Eudragit ® RS100 (Eud) and chitosan (C S ) to prepare Se@TMZ/Eud-Cs. Physicochemical properties were determined by scanning electron microscope (SEM), energy-dispersive X-ray spectroscopy (EDAX), thermal gravimetric analysis (TGA), Fourier-transform infrared spectroscopy (FTIR), and dynamic light scattering (DLS) methods. Se@TMZ/Eud-Cs was evaluated for loading and release of TMZ by spectrophotometric method. Subsequently, SNPs loaded with curcumin (as a fluorophore) were analyzed for in vitro uptake by C6 cells. Cytotoxicity and apoptosis assay were measured by MTT assay and Annexin-PI methods. Finally, real-time PCR was utilized to determine the expression of MGMT, E2F6, and RELA genes. Se@TMZ/Eud-Cs was prepared with an average size of 200 nm as confirmed by the DLS and microscopical methods. Se@TMZ/Eud-Cs presented 82.77 ± 5.30 loading efficiency with slow and pH-sensitive release kinetics. SNPs loaded with curcumin showed a better uptake performance by C6 cells compared with free curcumin ( p -value < 0.01). Coated nanoparticles loaded with TMZ showed higher cytotoxicity, apoptosis ( p -value < 0.0001), and down-regulation of MGMT, E2F6, and RELA and lower IC50 value ( p -value < 0.0001) than free TMZ and control ( p -value < 0.0001) groups. Using Cs as a targeting agent in Se@TMZ/Eud-Cs system improved the possibility for targeted drug delivery to C6 cells. This drug delivery system enhanced the apoptosis rate and decreased the expression of genes related to TMZ resistance. In conclusion, Se@TMZ/Eud-Cs may be an option for the enhancement of TMZ efficiency in GBM treatment.

Unmanned aerial vehicle (UAV) technology is an emerging powerful approach for high-throughput plant phenotyping field-grown crops. Switchgrass ( Panicum virgatum L.) is a lignocellulosic bioenergy crop for which studies on yield, sustainability, and biofuel traits are performed. In this study, we exploited UAV-based imagery (LiDAR and multispectral approaches) to measure plant height, perimeter, and biomass yield in field-grown switchgrass in order to make predictions on bioenergy traits. Manual ground truth measurements validated the automated UAV results. We found UAV-based plant height and perimeter measurements were highly correlated and consistent with the manual measurements ( r = 0.93, p < 0.001). Furthermore, we found that phenotyping parameters can significantly improve the natural saturation of the spectral index of the optical image for detecting high-density plantings. Combining plant canopy height (CH) and canopy perimeter (CP) parameters with spectral index (SI), we developed a robust and standardized biomass yield model [biomass = ( m × SI) × CP × CH] where the m is an SI-sensitive coefficient linearly varying with the plant phenological changing stage. The biomass yield estimates obtained from this model were strongly correlated with manual measurements ( r = 0.90, p < 0.001). Taking together, our results provide insights into the capacity of UAV-based remote sensing for switchgrass high-throughput phenotyping in the field, which will be useful for breeding and cultivar development., (Copyright © 2020 Li, Piasecki, Millwood, Wolfe, Mazarei and Stewart.)

DNA methylation is a widespread epigenetic mark that contributes to transcriptome reprogramming during plant-pathogen interactions. However, the distinct role of DNA methylation in establishing resistant and susceptible responses remains largely unexplored. Here, we developed and used a pair of near-isogenic lines (NILs) to characterize DNA methylome landscapes of soybean roots during the susceptible and resistant interactions with soybean cyst nematode (SCN; Heterodera glycines). We also compared the methylomes of the NILs and their parents to identify introduced and stably inherited methylation variants. The genomes of the NILs were substantially differentially methylated under uninfected conditions. This difference was associated with differential gene expression that may prime the NIL responses to SCN infection. In response to SCN infection, the susceptible line exhibited reduced global methylation levels in both protein-coding genes and transposable elements, whereas the resistant line showed the opposite response, increased global methylation levels. Heritable and novel nonparental differentially methylated regions overlapping with genes associated with soybean response to SCN infection were identified and validated using transgenic hairy root system. Our analyses indicate that DNA methylation patterns associated with the susceptible and resistant interactions are highly specific and that novel and stably inherited methylation variants are of biological significance., (© 2020 The Authors. New Phytologist © 2020 New Phytologist Trust.)

Switchgrass ( Panicum virgatum L.) is a lignocellulosic perennial grass with great potential in bioenergy field. Lignocellulosic bioenergy crops are mostly resistant to cell wall deconstruction, and therefore yield suboptimal levels of biofuel. The one-carbon pathway (also known as C1 metabolism) is critical for polymer methylation, including that of lignin and hemicelluloses in cell walls. Folylpolyglutamate synthetase (FPGS) catalyzes a biochemical reaction that leads to the formation of folylpolyglutamate, an important cofactor for many enzymes in the C1 pathway. In this study, the putatively novel switchgrass PvFPGS1 gene was identified and its functional role in cell wall composition and biofuel production was examined by RNAi knockdown analysis. The PvFPGS1 -downregulated plants were analyzed in the field over three growing seasons. Transgenic plants with the highest reduction in PvFPGS1 expression grew slower and produced lower end-of-season biomass. Transgenic plants with low-to-moderate reduction in PvFPGS1 transcript levels produced equivalent biomass as controls. There were no significant differences observed for lignin content and syringyl/guaiacyl lignin monomer ratio in the low-to-moderately reduced PvFPGS1 transgenic lines compared with the controls. Similarly, sugar release efficiency was also not significantly different in these transgenic lines compared with the control lines. However, transgenic plants produced up to 18% more ethanol while maintaining congruent growth and biomass as non-transgenic controls. Severity of rust disease among transgenic and control lines were not different during the time course of the field experiments. Altogether, the unchanged lignin content and composition in the low-to-moderate PvFPGS1 -downregulated lines may suggest that partial downregulation of PvFPGS1 expression did not impact lignin biosynthesis in switchgrass. In conclusion, the manipulation of PvFPGS1 expression in bioenergy crops may be useful to increase biofuel potential with no growth penalty or increased susceptibility to rust in feedstock., (Copyright © 2020 Mazarei, Baxter, Srivastava, Li, Xie, Dumitrache, Rodriguez, Natzke, Zhang, Turner, Sykes, Davis, Udvardi, Wang, Davison, Blancaflor, Tang and Stewart.)

Existing therapeutic strategies for breast cancer are limited by tumor recurrence and drug-resistance. Antioxidant plant-derived compounds such as flavonoids reduce adverse outcomes and have been identified as a potential source of antineoplastic agent with less undesirable side effects. Here, we describe the novel regulation of fatty-acid synthase (FASN), the key enzyme in de novo fatty-acid synthesis, whereby Vitis vinifera L. cv Vermentino leaf hydroalcoholic extract lowers its protein stability that is regulated by small ubiquitin-like modifier (SUMO)ylation. The phenolic compounds characterization was performed by liquid chromatography-mass spectrometry (LC-MS), whereas mass spectrometry (LC-MS/MS), Western blotting/co-immunoprecipitation (Co-IP) and RT-PCR, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), clonogenicity assays, and FACS analysis were used to measure the expression of targets and tumorigenicity. Vermentino extract exhibits antitumorigenic effects, and we went on to determine that FASN and ubiquitin-conjugating enzyme 9 (UBC9), the sole E2 enzyme required for SUMOylation, were significantly reduced. Moreover, FASN was found SUMOylated in human breast cancer tissues and cell lines, and lack of SUMOylation caused by SUMO2 silencing reduced FASN protein stability. These results suggest that SUMOylation protects FASN against proteasomal degradation and may exert oncogenic activity through alteration of lipid metabolism, whereas Vermentino extract inhibits these effects which supports the additional validation of the therapeutic value of this compound in breast cancer.

Key Message: A novel and robust lipofection-mediated transfection approach for the use of DNA-free Cas9/gRNA RNP for gene editing has demonstrated efficacy in plant cells. Precise genome editing has been revolutionized by CRISPR/Cas9 systems. DNA-based delivery of CRISPR/Cas9 is widely used in various plant species. However, protein-based delivery of the in vitro translated Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complex into plant cells is still in its infancy even though protein delivery has several advantages. These advantages include DNA-free delivery, gene-edited host plants that are not transgenic, ease of use, low cost, relative ease to be adapted to high-throughput systems, and low off-target cleavage rates. Here, we show a novel lipofection-mediated transfection approach for protein delivery of the preassembled Cas9/gRNA RNP into plant cells for genome editing. Two lipofection reagents, Lipofectamine 3000 and RNAiMAX, were adapted for successful delivery into plant cells of Cas9/gRNA RNP. A green fluorescent protein (GFP) reporter was fused in-frame with the C-terminus of the Cas9 protein and the fusion protein was successfully delivered into non-transgenic tobacco cv. 'Bright Yellow-2' (BY2) protoplasts. The optimal efficiencies for Lipofectamine 3000- and RNAiMAX-mediated protein delivery were 66% and 48%, respectively. Furthermore, we developed a biolistic method for protein delivery based on the known proteolistics technique. A transgenic tobacco BY2 line expressing an orange fluorescence protein reporter pporRFP was targeted for knockout. We found that the targeted mutagenesis frequency for our Lipofectamine 3000-mediated protein delivery was 6%. Our results showed that the newly developed lipofection-mediated transfection approach is robust for the use of the DNA-free Cas9/gRNA technology for genome editing in plant cells.

CRISPR/Cas9 has been widely applied to various plant species accelerating the pace of plant genome editing and precision breeding in crops. Unintended effects beyond off-target nucleotide mutations are still somewhat unexplored. We investigated the degree and patterns of epigenetic changes after gene editing. We examined changes in DNA methylation in genome-edited promoters of naturally hypermethylated genes (AT1G72350 and AT1G09970) and hypomethylated genes (AT3G17320 and AT5G28770) from Arabidopsis . Transgenic plants were developed via Agrobacterium -mediated floral dip transformation. Homozygous edited lines were selected from segregated T 2 plants by an in vitro digestion assay using ribonucleoprotein complex. Bisulfite sequencing comparisons were made between paired groups of edited and non-edited plants to identify changes in DNA methylation of the targeted loci. We found that directed mutagenesis via CRISPR/Cas9 resulted in no unintended morphological or epigenetic alterations. Phenotypes of wild-type, transgenic empty vector, and transgenic edited plants were similar. Epigenetic profiles revealed that methylation patterns of promoter regions flanking target sequences were identical among wild-type, transgenic empty vector, and transgenic edited plants. There was no effect of mutation type on epigenetic status. We also evaluated off-target mutagenesis effects in the edited plants. Potential off-target sites containing up to 4-bp mismatch of each target were sequenced. No off-target mutations were detected in candidate sites. Our results showed that CRISPR/Cas9 did not leave an epigenetic footprint on either the immediate gene-edited DNA and flanking DNA or introduce off-target mutations., (Copyright © 2020 Lee, Mazarei, Pfotenhauer, Dorrough, Poindexter, Hewezi, Lenaghan, Graham and Stewart.)

Genetic engineering has been used to decrease the lignin content and to change the lignin composition of switchgrass ( Panicum virgatum L.) to decrease cell wall recalcitrance to enable more efficient cellulosic biofuel production. Previous greenhouse and field studies showed that downregulation of the gene encoding switchgrass caffeic acid O -methyltransferase (COMT) and overexpression of the switchgrass PvMYB4 (MYB4) gene effectively improved ethanol yield. To understand potential environmental impacts of cultivating these transgenic bioenergy crops in the field, we quantified the effects of field cultivation of transgenic switchgrass on soil organic carbon (SOC) dynamics. Total and active SOC as well as soil respiration were measured in soils grown with two COMT-downregulated transgenic lines (COMT2 and COMT3), three MYB4-overexpressed transgenic lines (L1, L6, and L8), and their corresponding non-transgenic controls. No differences in total SOC, dissolved organic carbon (DOC), and permanganate oxidizable carbon (POXC) were detected between transgenic and non-transgenic treatments for both COMT (10.4-11.1 g kg -1 for SOC, 60.0-64.8 mg kg -1 for DOC, and 299-384 mg kg -1 for POXC) and MYB4 lines (6.89-8.21 g kg -1 for SOC, 56.0-61.1 mg kg -1 for DOC, and 177-199 mg kg -1 for POXC). Soil CO 2 -carbon (CO 2 -C) production from the COMT2 transgenic line was not significantly different from its non-transgenic control. In contrast, the COMT3 transgenic line had greater soil CO 2 -C production than its non-transgenic control (210 vs. 165 µg g -1 ) after 72 days of laboratory incubation. Combining the improvement in ethanol yield and biomass production reported in previous studies with negligible change in SOC and soil respiration, COMT2 could be a better biofuel feedstock than COMT3 for environmental conservation and cost-effective biofuel production. On the other hand, MYB4 transgenic line L8 produced more biomass and total ethanol per hectare while it released more CO 2 -C than the control (253 vs. 207 µg g -1 ). Long-term in situ monitoring of transgenic switchgrass systems using a suite of soil and environmental variables is needed to determine the sustainability of growing genetically modified bioenergy crops., Competing Interests: The authors declare that they have no competing interests., (© 2019 Xu et al.)

Extreme events occur in a variety of natural, technical, and societal systems and often have catastrophic consequences. Their low-probability, high-impact nature has recently triggered research into improving our understanding of generating mechanisms, providing early warnings as well as developing control strategies. For the latter to be effective, knowledge about dynamical resistance of a system prior to an extreme event is of utmost importance. Here we introduce a novel time-series-based and non-perturbative approach to efficiently monitor dynamical resistance and apply it to high-resolution observations of brain activities from 43 subjects with uncontrollable epileptic seizures. We gain surprising insights into pre-seizure dynamical resistance of brains that also provide important clues for success or failure of measures for seizure prevention. The novel resistance monitoring perspective advances our understanding of precursor dynamics in complex spatio-temporal systems with potential applications in refining control strategies.

[This corrects the article DOI: 10.1186/s13068-019-1353-7.].

Background: The recalcitrance of cellulosic biomass is widely recognized as a key barrier to cost-effective biological processing to fuels and chemicals, but the relative impacts of physical, chemical and genetic interventions to improve biomass processing singly and in combination have yet to be evaluated systematically. Solubilization of plant cell walls can be enhanced by non-biological augmentation including physical cotreatment and thermochemical pretreatment, the choice of biocatalyst, the choice of plant feedstock, genetic engineering of plants, and choosing feedstocks that are less recalcitrant natural variants. A two-tiered combinatoric investigation of lignocellulosic biomass deconstruction was undertaken with three biocatalysts ( Clostridium thermocellum , Caldicellulosiruptor bescii, Novozymes Cellic ® Ctec2 and Htec2), three transgenic switchgrass plant lines (COMT, MYB4, GAUT4) and their respective nontransgenic controls, two Populus natural variants, and augmentation of biological attack using either mechanical cotreatment or cosolvent-enhanced lignocellulosic fractionation (CELF) pretreatment., Results: In the absence of augmentation and under the conditions tested, increased total carbohydrate solubilization (TCS) was observed for 8 of the 9 combinations of switchgrass modifications and biocatalysts tested, and statistically significant for five of the combinations. Our results indicate that recalcitrance is not a trait determined by the feedstock only, but instead is coequally determined by the choice of biocatalyst. TCS with C. thermocellum was significantly higher than with the other two biocatalysts. Both CELF pretreatment and cotreatment via continuous ball milling enabled TCS in excess of 90%., Conclusion: Based on our results as well as literature studies, it appears that some form of non-biological augmentation will likely be necessary for the foreseeable future to achieve high TCS for most cellulosic feedstocks. However, our results show that this need not necessarily involve thermochemical processing, and need not necessarily occur prior to biological conversion. Under the conditions tested, the relative magnitude of TCS increase was augmentation > biocatalyst choice > plant choice > plant modification > plant natural variants. In the presence of augmentation, plant modification, plant natural variation, and plant choice exhibited a small, statistically non-significant impact on TCS.

Switchgrass ( Panicum virgatum L.) is a leading lignocellulosic bioenergy feedstock. Cellulose is a major component of the plant cell walls and the primary substrate for saccharification. Accessibility of cellulose to enzymatic breakdown into fermentable sugars is limited by the presence of lignin in the plant cell wall. In this study, putatively novel switchgrass secondary cell wall cellulose synthase PvCesA4 and primary cell wall PvCesA6 genes were identified and their functional role in cellulose synthesis and cell wall composition was examined by overexpression and knockdown of the individual genes in switchgrass. The endogenous expression of PvCesA4 and PvCesA6 genes varied among including roots, leaves, stem, and reproductive tissues. Increasing or decreasing PvCesA4 and PvCesA6 expression to extreme levels in the transgenic lines resulted in decreased biomass production. PvCesA6 -overexpressing lines had reduced lignin content and syringyl/guaiacyl lignin monomer ratio accompanied by increased sugar release efficiency, suggesting an impact of PvCesA6 expression levels on lignin biosynthesis. Cellulose content and cellulose crystallinity were decreased, while xylan content was increased in PvCesA4 and PvCesA6 overexpression or knockdown lines. The increase in xylan content suggests that the amount of non-cellulosic cell wall polysaccharide was modified in these plants. Taken together, the results show that the manipulation of the cellulose synthase genes alters the cell wall composition and availability of cellulose as a bioprocessing substrate.

Background: Genetic engineering of switchgrass ( Panicum virgatum L.) for reduced cell wall recalcitrance and improved biofuel production has been a long pursued goal. Up to now, constitutive promoters have been used to direct the expression of cell wall biosynthesis genes toward attaining that goal. While generally sufficient to gauge a transgene's effects in the heterologous host, constitutive overexpression often leads to undesirable plant phenotypic effects. Green tissue-specific promoters from switchgrass are potentially valuable to directly alter cell wall traits exclusively in harvestable aboveground biomass while not changing root phenotypes., Results: We identified and functionally characterized three switchgrass green tissue-specific promoters and assessed marker gene expression patterns and intensity in stably transformed rice ( Oryza sativa L.), and then used them to direct the expression of the switchgrass MYB4 ( PvMYB4 ) transcription factor gene in transgenic switchgrass to endow reduced recalcitrance in aboveground biomass. These promoters correspond to photosynthesis-related light-harvesting complex II chlorophyll-a/b binding gene ( PvLhcb ), phosphoenolpyruvate carboxylase ( PvPEPC ), and the photosystem II 10 kDa R subunit ( PvPsbR ). Real-time RT-PCR analysis detected their strong expression in the aboveground tissues including leaf blades, leaf sheaths, internodes, inflorescences, and nodes of switchgrass, which was tightly up-regulated by light. Stable transgenic rice expressing the GUS reporter under the control of each promoter (756-2005 bp in length) further confirmed their strong expression patterns in leaves and stems. With the exception of the serial promoter deletions of PvLhcb , all GUS marker patterns under the control of each 5'-end serial promoter deletion were not different from that conveyed by their respective promoters. All of the shortest promoter fragments (199-275 bp in length) conveyed strong green tissue-specific GUS expression in transgenic rice. PvMYB4 is a master repressor of lignin biosynthesis. The green tissue-specific expression of PvMYB4 via each promoter in transgenic switchgrass led to significant gains in saccharification efficiency, decreased lignin, and decreased S/G lignin ratios. In contrast to constitutive overexpression of PvMYB4 , which negatively impacts switchgrass root growth, plant growth was not compromised in green tissue-expressed PvMYB4 switchgrass plants in the current study., Conclusions: Each of the newly described green tissue-specific promoters from switchgrass has utility to change cell wall biosynthesis exclusively in aboveground harvestable biomass without altering root systems. The truncated green tissue promoters are very short and should be useful for targeted expression in a number of monocots to improve shoot traits while restricting gene expression from roots. Green tissue-specific expression of PvMYB4 is an effective strategy for improvement of transgenic feedstocks.

Key Message: A switchgrass vascular tissue-specific promoter (PvPfn2) and its 5'-end serial deletions drive high levels of vascular bundle transgene expression in transgenic rice. Constitutive promoters are widely used for crop genetic engineering, which can result in multiple off-target effects, including suboptimal growth and epigenetic gene silencing. These problems can be potentially avoided using tissue-specific promoters for targeted transgene expression. One particularly urgent need for targeted cell wall modification in bioenergy crops, such as switchgrass (Panicum virgatum L.), is the development of vasculature-active promoters to express cell wall-affective genes only in the specific tissues, i.e., xylem and phloem. From a switchgrass expression atlas we identified promoter sequence upstream of a vasculature-specific switchgrass profilin gene (PvPfn2), especially in roots, nodes and inflorescences. When the putative full-length (1715 bp) and 5'-end serial deletions of the PvPfn2 promoter (shortest was 413 bp) were used to drive the GUS reporter expression in stably transformed rice (Oryza sativa L.), strong vasculature-specificity was observed in various tissues including leaves, leaf sheaths, stems, and flowers. The promoters were active in both phloem and xylem. It is interesting to note that the promoter was active in many more tissues in the heterologous rice system than in switchgrass. Surprisingly, all four 5'-end promoter deletions, including the shortest fragment, had the same expression patterns as the full-length promoter and with no attenuation in GUS expression in rice. These results indicated that the PvPfn2 promoter variants are new tools to direct transgene expression specifically to vascular tissues in monocots. Of special interest is the very compact version of the promoter, which could be of use for vasculature-specific genetic engineering in monocots.

Cell walls in crops and trees have been engineered for production of biofuels and commodity chemicals, but engineered varieties often fail multi-year field trials and are not commercialized. We engineered reduced expression of a pectin biosynthesis gene (Galacturonosyltransferase 4, GAUT4) in switchgrass and poplar, and find that this improves biomass yields and sugar release from biomass processing. Both traits were maintained in a 3-year field trial of GAUT4-knockdown switchgrass, with up to sevenfold increased saccharification and ethanol production and sixfold increased biomass yield compared with control plants. We show that GAUT4 is an α-1,4-galacturonosyltransferase that synthesizes homogalacturonan (HG). Downregulation of GAUT4 reduces HG and rhamnogalacturonan II (RGII), reduces wall calcium and boron, and increases extractability of cell wall sugars. Decreased recalcitrance in biomass processing and increased growth are likely due to reduced HG and RGII cross-linking in the cell wall.

Sustainable utilization of lignocellulosic perennial grass feedstocks will be enabled by high biomass production and optimized cell wall chemistry for efficient conversion into biofuels. MicroRNAs are regulatory elements that modulate the expression of genes involved in various biological functions in plants, including growth and development. In greenhouse studies, overexpressing a microRNA (miR156) gene in switchgrass had dramatic effects on plant architecture and flowering, which appeared to be driven by transgene expression levels. High expressing lines were extremely dwarfed, whereas low and moderate-expressing lines had higher biomass yields, improved sugar release and delayed flowering. Four lines with moderate or low miR156 overexpression from the prior greenhouse study were selected for a field experiment to assess the relationship between miR156 expression and biomass production over three years. We also analysed important bioenergy feedstock traits such as flowering, disease resistance, cell wall chemistry and biofuel production. Phenotypes of the transgenic lines were inconsistent between the greenhouse and the field as well as among different field growing seasons. One low expressing transgenic line consistently produced more biomass (25%-56%) than the control across all three seasons, which translated to the production of 30% more biofuel per plant during the final season. The other three transgenic lines produced less biomass than the control by the final season, and the two lines with moderate expression levels also exhibited altered disease susceptibilities. Results of this study emphasize the importance of performing multiyear field studies for plants with altered regulatory transgenes that target plant growth and development., (© 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

Background: The mission of the BioEnergy Science Center (BESC) was to enable efficient lignocellulosic-based biofuel production. One BESC goal was to decrease poplar and switchgrass biomass recalcitrance to biofuel conversion while not affecting plant growth. A transformation pipeline (TP), to express transgenes or transgene fragments (constructs) in these feedstocks with the goal of understanding and decreasing recalcitrance, was considered essential for this goal. Centralized data storage for access by BESC members and later the public also was essential., Results: A BESC committee was established to codify procedures to evaluate and accept genes into the TP. A laboratory information management system (LIMS) was organized to catalog constructs, plant lines and results from their analyses. One hundred twenty-eight constructs were accepted into the TP for expression in switchgrass in the first 5 years of BESC. Here we provide information on 53 of these constructs and the BESC TP process. Eleven of the constructs could not be cloned into an expression vector for transformation. Of the remaining constructs, 22 modified expression of the gene target. Transgenic lines representing some constructs displayed decreased recalcitrance in the field and publications describing these results are tabulated here. Transcript levels of target genes and detailed wall analyses from transgenic lines expressing six additional tabulated constructs aimed toward modifying expression of genes associated with wall structure (xyloglucan and lignin components) are provided. Altered expression of xyloglucan endotransglucosylase/hydrolases did not modify lignin content in transgenic plants. Simultaneous silencing of two hydroxycinnamoyl CoA:shikimate hydroxycinnamoyl transferases was necessary to decrease G and S lignin monomer and total lignin contents, but this reduced plant growth., Conclusions: A TP to produce plants with decreased recalcitrance and a LIMS for data compilation from these plants were created. While many genes accepted into the TP resulted in transgenic switchgrass without modified lignin or biomass content, a group of genes with potential to improve lignocellulosic biofuel yields was identified. Results from transgenic lines targeting xyloglucan and lignin structure provide examples of the types of information available on switchgrass lines produced within BESC. This report supplies useful information when developing coordinated, large-scale, multi-institutional reverse genetic pipelines to improve crop traits.

Background: Genetically engineered biofuel crops, such as switchgrass ( Panicum virgatum L.), that produce their own cell wall-digesting cellulase enzymes would reduce costs of cellulosic biofuel production. To date, non-bioenergy plant models have been used in nearly all studies assessing the synthesis and activity of plant-produced fungal and bacterial cellulases. One potential source for cellulolytic enzyme genes is herbivorous insects adapted to digest plant cell walls. Here we examine the potential of transgenic switchgrass-produced TcEG1 cellulase from Tribolium castaneum (red flour beetle). This enzyme, when overproduced in Escherichia coli and Saccharomyces cerevisiae , efficiently digests cellulose at optima of 50 °C and pH 12.0., Results: TcEG1 that was produced in green transgenic switchgrass tissue had a range of endoglucanase activity of 0.16-0.05 units (µM glucose release/min/mg) at 50 °C and pH 12.0. TcEG1 activity from air-dried leaves was unchanged from that from green tissue, but when tissue was dried in a desiccant oven (46 °C), specific enzyme activity decreased by 60%. When transgenic biomass was "dropped-in" into an alkaline buffer (pH 12.0) and allowed to incubate at 50 °C, cellobiose release was increased up to 77% over non-transgenic biomass. Saccharification was increased in one transgenic event by 28%, which had a concurrent decrease in lignin content of 9%. Histological analysis revealed an increase in cell wall thickness with no change to cell area or perimeter. Transgenic plants produced more, albeit narrower, tillers with equivalent dry biomass as the control., Conclusions: This work describes the first study in which an insect cellulase has been produced in transgenic plants; in this case, the dedicated bioenergy crop switchgrass. Switchgrass overexpressing the TcEG1 gene appeared to be morphologically similar to its non-transgenic control and produced equivalent dry biomass. Therefore, we propose TcEG1 transgenics could be bred with other transgenic germplasm (e.g., low-lignin lines) to yield new switchgrass with synergistically reduced recalcitrance to biofuel production. In addition, transgenes for other cell wall degrading enzymes may be stacked with TcEG1 in switchgrass to yield complementary cell wall digestion features and complete auto-hydrolysis.

Transgenic Panicum virgatum L. silencing (KD) or overexpressing (OE) specific genes or a small RNA (GAUT4-KD, miRNA156-OE, MYB4-OE, COMT-KD and FPGS-KD) was grown in the field and aerial tissue analysed for biofuel production traits. Clones representing independent transgenic lines were established and senesced tissue was sampled after year 1 and 2 growth cycles. Biomass was analysed for wall sugars, recalcitrance to enzymatic digestibility and biofuel production using separate hydrolysis and fermentation. No correlation was found between plant carbohydrate content and biofuel production pointing to overriding structural and compositional elements that influence recalcitrance. Biomass yields were greater for all lines in the second year as plants establish in the field and standard amounts of biomass analysed from each line had more glucan, xylan and less ethanol (g/g basis) in the second- versus the first-year samples, pointing to a broad increase in tissue recalcitrance after regrowth from the perennial root. However, biomass from second-year growth of transgenics targeted for wall modification, GAUT4-KD, MYB4-OE, COMT-KD and FPGS-KD, had increased carbohydrate and ethanol yields (up to 12% and 21%, respectively) compared with control samples. The parental plant lines were found to have a significant impact on recalcitrance which can be exploited in future strategies. This summarizes progress towards generating next-generation bio-feedstocks with improved properties for microbial and enzymatic deconstruction, while providing a comprehensive quantitative analysis for the bioconversion of multiple plant lines in five transgenic strategies., (© 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here, we report the functional characterization of one member of the soybean TPS gene family, which was designated GmAFS. Recombinant GmAFS produced in Escherichia coli catalysed the formation of a sesquiterpene (E,E)-α-farnesene. GmAFS is closely related to (E,E)-α-farnesene synthase gene from apple, both phylogenetically and structurally. GmAFS was further investigated for its biological role in defence against nematodes and insects. Soybean cyst nematode (SCN) is the most important pathogen of soybean. The expression of GmAFS in a SCN-resistant soybean was significantly induced by SCN infection compared with the control, whereas its expression in a SCN-susceptible soybean was not changed by SCN infection. Transgenic hairy roots overexpressing GmAFS under the control of the CaMV 35S promoter were generated in an SCN-susceptible soybean line. The transgenic lines showed significantly higher resistance to SCN, which indicates that GmAFS contributes to the resistance of soybean to SCN. In soybean leaves, the expression of GmAFS was found to be induced by Tetranychus urticae (two-spotted spider mites). Exogenous application of methyl jasmonate to soybean plants also induced the expression of GmAFS in leaves. Using headspace collection combined with gas chromatography-mass spectrometry analysis, soybean plants that were infested with T. urticae were shown to emit a mixture of volatiles with (E,E)-α-farnesene as one of the most abundant constituents. In summary, this study showed that GmAFS has defence roles in both below-ground and above-ground organs of soybean against nematodes and insects, respectively., (© 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

Background: The native recalcitrance of plants hinders the biomass conversion process using current biorefinery techniques. Down-regulation of the caffeic acid O -methyltransferase ( COMT ) gene in the lignin biosynthesis pathway of switchgrass reduced the thermochemical and biochemical conversion recalcitrance of biomass. Due to potential environmental influences on lignin biosynthesis and deposition, studying the consequences of physicochemical changes in field-grown plants without pretreatment is essential to evaluate the performance of lignin-altered plants. We determined the chemical composition, cellulose crystallinity and the degree of its polymerization, molecular weight of hemicellulose, and cellulose accessibility of cell walls in order to better understand the fundamental features of why biomass is recalcitrant to conversion without pretreatment. The most important is to investigate whether traits and features are stable in the dynamics of field environmental effects over multiple years., Results: Field-grown COMT down-regulated plants maintained both reduced cell wall recalcitrance and lignin content compared with the non-transgenic controls for at least 3 seasons. The transgenic switchgrass yielded 35-84% higher total sugar release (enzymatic digestibility or saccharification) from a 72-h enzymatic hydrolysis without pretreatment and also had a 25-32% increase in enzymatic sugar release after hydrothermal pretreatment. The COMT -silenced switchgrass lines had consistently lower lignin content, e.g., 12 and 14% reduction for year 2 and year 3 growing season, respectively, than the control plants. By contrast, the transgenic lines had 7-8% more xylan and galactan contents than the wild-type controls. Gel permeation chromatographic results revealed that the weight-average molecular weights of hemicellulose were 7-11% lower in the transgenic than in the control lines. In addition, we found that silencing of COMT in switchgrass led to 20-22% increased cellulose accessibility as measured by the Simons' stain protocol. No significant changes were observed on the arabinan and glucan contents, cellulose crystallinity, and cellulose degree of polymerization between the transgenic and control plants. With the 2-year comparative analysis, both the control and transgenic lines had significant increases in lignin and glucan contents and hemicellulose molecular weight across the growing seasons., Conclusions: The down-regulation of COMT in switchgrass resulting in a reduced lignin content and biomass recalcitrance is stable in a field-grown trial for at least three seasons. Among the determined affecting factors, the reduced biomass recalcitrance of the COMT -silenced switchgrass, grown in the field conditions for two and three seasons, was likely related to the decreased lignin content and increased biomass accessibility, whereas the cellulose crystallinity and degree of its polymerization and hemicellulose molecular weights did not contribute to the reduction of recalcitrance significantly. This finding suggests that lignin down-regulation in lignocellulosic feedstock confers improved saccharification that translates from greenhouse to field trial and that lignin content and biomass accessibility are two significant factors for developing a reduced recalcitrance feedstock by genetic modification.

Soybean (Glycine max (L.) Merr.) salicylic acid methyl transferase (GmSAMT1) catalyses the conversion of salicylic acid to methyl salicylate. Prior results showed that when GmSAMT1 was overexpressed in transgenic soybean hairy roots, resistance is conferred against soybean cyst nematode (SCN), Heterodera glycines Ichinohe. In this study, we produced transgenic soybean overexpressing GmSAMT1 and characterized their response to various SCN races. Transgenic plants conferred a significant reduction in the development of SCN HG type 1.2.5.7 (race 2), HG type 0 (race 3) and HG type 2.5.7 (race 5). Among transgenic lines, GmSAMT1 expression in roots was positively associated with SCN resistance. In some transgenic lines, there was a significant decrease in salicylic acid titer relative to control plants. No significant seed yield differences were observed between transgenics and control soybean plants grown in one greenhouse with 22 °C day/night temperature, whereas transgenic soybean had higher yield than controls grown a warmer greenhouse (27 °C day/23 °C night) temperature. In a 1-year field experiment in Knoxville, TN, there was no significant difference in seed yield between the transgenic and nontransgenic soybean under conditions with negligible SCN infection. We hypothesize that GmSAMT1 expression affects salicylic acid biosynthesis, which, in turn, attenuates SCN development, without negative consequences to soybean yield or other morphological traits. Thus, we conclude that GmSAMT1 overexpression confers broad resistance to multiple SCN races, which would be potentially applicable to commercial production., (© 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)