Search

While microbiome and host regulation contribute independently to many disease states, it is unclear how circumcision in pediatric population influences subsequent changes in penile microbiome.Our study aims to analyze jointly paired taxonomic profiles and assess pathways implicated in inflammation, barrier protection, and energy metabolism.We analyzed 11 paired samples, periurethral collection, before and after circumcision, to generate microbiome and mycobiome profiling. Sample preparation of 16S ribosomal RNA and internal transcribed spacer sequencing was adapted from the methods developed by the National Institutes of Health Human Microbiome Project.We obtained the predictive functional attributes of the microbial communities between samples using Silva-Tax4Fun and the Greengenes-Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) approach. The predictive functioning of the microbial communities was determined by linearly combining the normalized taxonomic abundances into the precomputed association matrix of Kyoto Encyclopedia of Genes and Genomes orthology reference profiles.Several notable microbiome and mycobiome compositional differences were observed between pre- and postcircumcision patients. Pairwise comparisons across taxa revealed a significant decrease (p 0.05, false discovery rate corrected) of microbiome organisms (Clostridiales, Bacteroidales, and Campylobacterales) and mycobiome (Saccharomycetales and Pleosporales) following circumcision. A total of 14 pathways were found to differ in abundance between the pre- and postcircumcision groups (p 0.005, false discovery rate0.1 and linear discriminant analysis score3; five enriched and nine depleted). The pathways reduced after circumcision were mostly involved with amino acid and glucose metabolism, while pathways prior to circumcision were enriched in genetic information processing and transcription processes. As expected, enrichment in methyl-accepting chemotaxis protein, an integral membrane protein involved in directed motility of microbes to chemical cues and environment, occurred prior to circumcision, while the filamentous hemagglutinin pathway (a strong immunogenic protein) was depleted after circumcision CONCLUSIONS: Our results offer greater insight into the host-microbiota relationship of penile circumcision and may serve to lay the groundwork for future studies focused on drivers of inflammation, infection, and oncogenesis.Our study showed a significant reduction in bacteria and fungi after circumcision, particularly anaerobic bacteria, which are known to be potential inducers of inflammation and cancer. This is the first study of its kind showing the changes in microbiome after circumcision, and some of the changes that occur in healthy infants after circumcision that may explain the differences in cancer and inflammatory disorders in adulthood.

Background The application of next generation sequencing techniques has enabled characterization of urinary tract microbiome. Although many studies have demonstrated associations between the human microbiome and bladder cancer, they have not always reported consistent results, thereby necessitating cross-study comparisons. Thus, the fundamental questions remain how we can utilize this knowledge. The aim of our study was to examine for disease-associated changes in urine microbiome communities globally utilizing machine learning algorithm. The results were further validated using our own prospectively collected urine of bladder cancer patients. Results Our study included 129 bladder cancer urine samples, and 60 healthy controls across four different countries. At a meta-analysis false discovery rate (FDR) of 0.01, we identified a total of 97/548 genera to be differentially abundant in the BCa microbiome compared to healthy patients. Overall, while the differences in diversity metrics were clustered around the country of origin (Kruskal Wallis, P

Introduction: We aim to assess the transcriptomic features of the single cell level to identify intracellular pathogens in patients with high grade bladder cancer. Methodology: CellRanger and Alevin were utilized to extract cell barcodes and unique molecular identifiers. After quality control, reads were aligned with human reference genome with Kraken2 for species level identification of bacteria. Contaminants (false positives) were removed based on higher frequencies and negative control (reference control) of 2,491 sterile cell experiments. Seuret Findmarkers, scIntegrate, and scDensity Plot were utilized to normalize the data, cluster the cells, and calculate markers in each cluster of differentially expressed genes between the two conditions. We focused our analysis on Pseudomonas aeruginosa due to high urogenital virulence, and immunomodulation capabilities by pattern recognition receptors and inflammasome. Results: We identified presence of three over-represented intracellular taxa in tissue biopsies of patients with BC compared to healthy controls (after false discovery rate correction and cross validation of contaminants). Patients with history of high-grade BC demonstrated increased presence of Aeromonas (175,473 reads, 54%), Pseudomonas (75,002 reads, 26.73%), and Bacillus (15,410 reads, 5.49%) in their tissue samples, not visualized in healthy controls (counts Conclusion: Altogether, our analysis depicted the distribution of intracellular bacteria not previously recognized within tumor microenvironment utilizing scRNAseq, and revealed overexpression of RACK1 in Pseudomonas positive cells, associated with apoptosis resistance. Citation Format: Laura Bukavina, Mohit Sindhani, Henkel Valentine, Daniel Ranti, Kirtishri Mishra, Alexander Kutikov, Shilpa Gupta, John Sfakiano, Mahmoud Ghannoum, Mauricio Retuerto, Andres Correa, Robert Uzzo, Philip Abbosh. Identification of intratumor pathogens from single-cell RNA sequencing, cellular dysfunction and immune response [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5891.

This study assessed microbiome adherent to contact lenses and defined the bacterial communities associated with use of lens care solutions.Among 84 lenses screened for adherent ocular surface bacterial microbiome using 16S rRNA molecular amplification, 63 (75%) generated bacterial-specific amplicons processed using the Ion Torrent Personal Genome Machine workflow. Data were stratified by solution use (peroxide vs. polyhexamethylene biguanide [PHMB]-preserved multipurpose solution [MPS]). Diversity of lens-adherent microbiome was characterized using Shannon diversity index and richness index. Data were analyzed using principal components analysis and Kruskal-Wallis tests.We identified 19 phyla and 167 genera of bacteria adherent to the lenses. Proteobacteria was the most abundant phyla, followed by Firmicutes and Actinobacteria. The most abundant bacterial genera (1% abundance) were Ralstonia, Enterococcus, Streptococcus, Halomonas, Corynebacterium, Staphylococcus, Acinetobacter, Shewanella, Rhodococcus, and Cobetia. Sixteen of 20 lenses (80%) negative for bacterial DNA were worn by participants using peroxide solutions while only 4 (20%) were MPS-treated lenses (P=0.004). Genera diversity of lens-adherent microbiome showed a significant increase in MPS-treated lenses compared with peroxide (P=0.038). Abundance of Corynebacterium, Haemophilus, and Streptococcus were increased 4.3-, 12.3-, and 2.7-fold, respectively, in the MPS group compared with peroxide (P=0.014, 0.006, 0.047, respectively).Commensal, environmental, and pathogenic bacteria known to be present in the conjunctival microbiome can be detected on worn contact lenses. Although most contact lenses worn by asymptomatic wearers harbor bacterial DNA, compared with peroxide, lenses stored in a PHMB-preserved MPS have more quantifiable, abundant, and diverse bacterial communities adherent to them.

Microbiome dysbiosis has been associated with adverse outcomes of hematopoietic cell transplantation (HCT). We hypothesized that exposure to high-dose melphalan and antimicrobials in patients undergoing autologous HCT for plasma cell disorders results in oral and gastrointestinal microbial dysbiosis, which in turn is associated with regimen-related toxicities. We conducted a prospective study describing the longitudinal changes in oral and gastrointestinal bacteriome and mycobiome in this patient population. Our findings show that microbiome composition present at baseline is associated with the incidence and severity of post-transplantation nausea, vomiting, and culture-negative neutropenic fever, as well as with the rate of neutrophil engraftment. We also have evidence of an association between the microbial communities at count nadir and the development of regimen-related gastrointestinal toxicities commonly observed after exposure to high-dose melphalan. Although bacteriome diversity largely recovers within 1 month after transplantation, we observed a continuous decrease in oral and gastrointestinal mycobiome diversity, suggesting that the mycobiome requires a longer time to recover compared with the bacteriome.

The mechanisms causing HIV-associated immune activation remain incompletely understood. Alteration of intestinal integrity with subsequent translocation of bacterial products appears to play an important role; however, little is known about the impact of fungal translocation. We assessed the effect of fungal translocation and its association with immune activation in people living with HIV (PLWH) compared with uninfected controls. We measured serum levels of β-D-glucan (BDG) and anti-Saccharomyces cerevisiae antibodies (ASCA) immunoglobulin G (IgG) and immunoglobulin A (IgA) and markers of systemic inflammation and immune activation in virally suppressed PLWH on antiretroviral therapy (ART) and uninfected controls. T-test and Mann–Whitney tests were used to compare markers by HIV status and correlation and regression analyses were used to assess associations of fungal translocation markers with markers of inflammation. One hundred seventy-six participants were included (128 HIV+ and 48 HIV−); 72% male, 65% African American, median age was 50 years, and CD4 was 710 cells/cm(3). Levels of BDG tended to be lower in HIV+ when compared with controls (p = .05). No significant difference in levels of ASCA IgG and IgA was seen between groups (p > .75). There was a significant correlation between BDG and several markers of inflammation and immune activation in PLWH, not seen in uninfected controls. In contrast, no correlations were seen between levels of ASCA IgG and IgA with inflammatory markers. PLWH on ART do not have higher levels of BDG or ASCA when compared with uninfected controls, however, the association found between BDG and several inflammation markers suggests a potential role of fungal translocation in the heightened immune activation seen in treated HIV.

Background: The incidence of type 1 diabetes (T1D) and overweight/obesity is on the rise. Previous studies showed altered gut microbiota in children with T1D where gut microbial differences between obese and lean children without diabetes were reported. The purpose of the study was to characterize the microbial composition of lean and overweight children with T1D at disease onset in comparison to healthy controls. Methods: We enrolled 26 children with T1D at disease onset including 15 lean and 11 overweight T1D and compared them with age, gender and BMI matched 14 lean and 8 overweight controls. Stool swabs were collected and DNA extraction was performed using Qiagen DNA mini kit. Bacterial regions v3, v4 were amplified using 16s primers. Amplicons were cleaned, barcoded, size selected and sequencing was completed on Ion Torrent S5 sequencer. Results: The four most abundant phyla in both groups were Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria. At the genus level, noted significant increase in pro-inflammatory microbes such as Serratia in T1D compared to controls without diabetes (P value= 0.047). Overweight T1D had marked decrease in the beneficial genus Lactobacillus compared to overweight controls. Similar observation was reported when lean T1D was compared to matched lean controls. Although not significant, anti-inflammatory genera like Clostridium had lower relative abundance in obese T1D compared to their lean counterparts. At the species level, when overweight T1D were compared to their matched controls, there was a marked reduction in L. brevis and L. Zeae known for their anti-inflammatory effects (P value = 0.038, 0.046 respectively). Conclusion: Our study showed alterations in the gut microbiome in children with T1D with significant increase in pro-inflammatory microbes. Additionally, being overweight negatively impacted the microbiome. Disclosure S.B. Gowda: None. R.M. Farrell: Research Support; Self; TODAY study. Stock/Shareholder; Self; Dexcom, Inc., Tandem Diabetes Care. S.A. MacLeish: None. I. Salem: None. M.A. Retuerto: None. M.A. Ghannoum: None.

INTRODUCTION AND OBJECTIVE:The risk of infection after penile prosthesis implantation is one of the main concerns for urologic surgeons. Various pre-operative prep methods have been investigated, w...

Background Epidemiological studies indicate that the use of artificial sweeteners doubles the risk for Crohn’s disease (CD). Herein, we experimentally quantified the impact of 6-week supplementation with a commercial sweetener (Splenda; ingredients sucralose maltodextrin, 1:99, w/w) on both the severity of CD-like ileitis and the intestinal microbiome alterations using SAMP1/YitFc (SAMP) mice. Methods Metagenomic shotgun DNA sequencing was first used to characterize the microbiome of ileitis-prone SAMP mice. Then, 16S rRNA microbiome sequencing, quantitative polymerase chain reaction, fluorescent in situ hybridization (FISH), bacterial culture, stereomicroscopy, histology, and myeloperoxidase (MPO) activity analyses were then implemented to compare the microbiome and ileitis phenotype in SAMP with that of control ileitis-free AKR/J mice after Splenda supplementation. Results Metagenomics indicated that SAMP mice have a gut microbial phenotype rich in Bacteroidetes, and experiments showed that Helicobacteraceae did not have an exacerbating effect on ileitis. Splenda did not increase the severity of (stereomicroscopic/histological) ileitis; however, biochemically, ileal MPO activity was increased in SAMP treated with Splenda compared with nonsupplemented mice (P < 0.022) and healthy AKR mice. Splenda promoted dysbiosis with expansion of Proteobacteria in all mice, and E. coli overgrowth with increased bacterial infiltration into the ileal lamina propria of SAMP mice. FISH showed increase malX gene–carrying bacterial clusters in the ilea of supplemented SAMP (but not AKR) mice. Conclusions Splenda promoted gut Proteobacteria, dysbiosis, and biochemical MPO reactivity in a spontaneous model of (Bacteroidetes-rich) ileal CD. Our results indicate that although Splenda may promote parallel microbiome alterations in CD-prone and healthy hosts, this did not result in elevated MPO levels in healthy mice, only CD-prone mice. The consumption of sucralose/maltodextrin-containing foods might exacerbate MPO intestinal reactivity only in individuals with a pro-inflammatory predisposition, such as CD.

542 Background: Bacterial dysbiosis accompanies carcinogenesis in malignancies such as colon, breast and pancreatic cancer. However, the role of fungal mycobiome has not been evaluated in bladder cancer. With the sexual dimorphism that exists within bladder cancer (Bca) prevalence and survival, our study aims to characterize fungal mycobiome composition in Bca. Methods: This is a single site, non-randomized, prospective study of patients with the diagnosis of muscle invasive bladder cancer (MIBC) undergoing cystectomy from September 2020 to May 2021. Stool samples were collected during surgery using aseptic technique. We utilized the ITS1 region from DNA sample extracts, which was amplified in triplicate using primers with high specificity for ascomycete fungi (fluorescently-labeled forward primer ITS1F (CTTGGTCATTTAGAGGAAGTAA) and unlabeled reverse primer ITS2 (GCTGCGTTCTTCATCGATGC). Fungal PCR products were separated on the SCE 9610 capillary DNA sequencer (Spectrumedix LLC, State College, PA) using GenoSpectrum software to convert fluorescent output into electropherograms. Hierarchical clustering by Bray-Curtis distance was performed using hclust2. Mean normalized abundance for each amplicon was calculated from the three PCR replicates of each sample, excluding means below 1%. Results: A total of 29 patients (17 males and 12 females) were enrolled. The median (IQR) age was 74 yo (63-77), males, and 68.5 yo (58-78), females. Per figure 1, Saccharomycecales dominated the fungal community at order level with mean relative abundance of 36.35% females, and 21.20%, males. (Figure 1D) Tremellales was the second most notable order, composing 8.22% and 5.13% of male and female samples. There were no differences seen in alpha and beta diversity (Figure 1C) (Figure 1A, C), notable differences were seen across orders. The greatest difference between sexes in LDA( M:F) were noted in Saccharomycecales (log change -4.686, p=0.001/ padj= 0.01), Tremellales (log change 5.119, p=0.001/padj= 0.01), and Sporidiobolales (log change 4.839, p=0.001 padj= 0.03). (Figure 1B). Female bladder cancer patients demonstrating an increase abundance of Saccharomycecale. When assessing differences in fungal composition in patients with history of neoadjuvant therapy( NAC) (receipt vs none), patients with history of NAC exhibited a 3.48 increase in Saccharomycecale (padj= 0.015 ), 4.81 increase Tremalles (padj= 0.009) and 4.37 increase Pleosporales(padj= 0.009) . Conclusions: Mycobiome is an integral part of gut microbiota, with fungal elements relatively poorly studied. Nevertheless, the association between fungal dysbiosis and carcinogenesis across multiple cancers exists. Our study is the first to characterize fungal profile in bladder cancer patients, stratified by sex and receipt of NAC, with results highlighting key fungal players: Saccharomycecale, Tremallales, Pleosoporales.

541 Background: The role of microbiome in genitourinary cancer is an emerging field, with evidence implicating the important role of microbiome as causative factors or cofactors in tumorigenesis and drug metabolism. Our study aims to characterize healthy and bladder cancer enterotypes in the gut and identify functional alterations through the use of metagenomics data. Methods: After prospective collection of 29 rectal swab samples of bladder cancer (BCa) patients undergoing cystectomy, and 32 healthy volunteers, we perform 16S rRNA amplicon sequencing on 61 samples (29 with bladder cancer, 32 without cancer). Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) was applied to infer functional categories associated with taxonomic composition. The p values were adjusted using the false discovery rate. The a- and b-diversity analyses were performed using QIIME. The Mann-Whitney U test was employed to evaluate the statistical significance of b-diversity distances within and between groups of interest. Results: Across all the bladder cancer stool samples, estimation of relative abundance revealed of the five most dominant bacterial populations was Bacteroidales ( 46.21%), Clostridiales ( 32.29%), Burkholderiales (9.07%), Erysipelotrichales (3.20%) and Lactobacillales ( 2.20%). In contrast, healthy controls exhibited an increased relative abundance of Enterobacteriales ( 10.75% vs 0.52%) and Pseudomonadales (8.33% vs 0.18%) as compared to tumor samples. The microbial diversity differences between Bca and normal samples showed no differences across alpha diversity metrics (Shannon diversity p>0.05) as compared to normal tissue. However, there was significant difference in clustering of organisms as determined by principal coordinate analysis ( PCoA) ordination of unweighted UniFrac Distances, (p=0.002). Furthermore, upon stratification of patients on smoking status (all healthy=nonsmokers), clustering persisted, albeit non smokers with bladder cancer displayed an intermediate across PCoA. Bca samples exhibited higher LDA score Campylobacterales (log change 8.0, padj adjadj adjadj=0.031) and Enterobacteriales (log change -1.54,p=0.017/ padj= 0.132). Conclusions: In conclusion, our study provides preliminary evidence that the GI microbiota is different in bladder cancer patients. Collectively, our study highlights distinct microbial overexpression of Campylobacter and Fusobacterium in Bca cohort not previously reported, both implicated in tumorigenesis, and could serve as a target that could be modulated to enhance treatment response.

Emerging data suggest healthy microbiome helps to protect against mucosal injury and inflammation. Dysbiosis results in biofilm formation in the gut which has been shown to be pro-inflammatory. MM patients potentially have significant dysbiosis result of long term corticosteroid use. Our group, previously showed that composition of microbiome presents at the pre-transplant period correlates with rate and degree of post-ASCT GI toxicities, neutropenic fever and neutrophilic engraftment among MM patients. Also, our data suggested a link between microbial communities at the count nadir and GI toxicity after high dose melphalan and ASCT. Mycobiome Supporting Diet (MSD) proposed in this study is designed to restructure the gut microbiome (both bacterial and fungal communities) and support optimal GI tract health. It combines elements from several diets (e.g., Paleo, low-carbohydrate, vegetarian, and Mediterranean) and excludes elements of these diets that have been specifically proven to increase pathogenic fungi in the human gut. Our group examined application of MSD among healthy volunteers between the ages of 30 and 70 who agreed to follow the MSD for 28 days on a prospective trial. At the end of the study period, subjects had a 1.7-fold decrease in the abundance of Proteobacteria (considered a red flag for inflammation), with levels reduced from 38.6% to 23.3% with significantly increased of beneficial species such as Faeclibacterium prausnitzii (up 35.8%) , Bifidobacterium adolescentis (up 61.6%) , Roseburia (up 57.5%) , Lactobacillus (up 77.6%) , and Bacteroides. Furthermore, Pathogenic bacteria decreased significantly, including Escherichia coli (down 74%), Bacteroides fragilis (down 45.3%), and Clostridium (down 55.7%). After the study, all participants with GI symptoms reported moderate or dramatic improvements. Two thirds of the participants who chose to track their weight lost significant weight (between two and 10 pounds) over the testing period. Thirty percent of the participants reported moderate or dramatically improved fatigue and higher energy levels. Given the association between baseline gut dysbiosis and post-transplant GI toxicities and availability of a highly curated diet to optimize the richness and diversity of gut microbiome communities, in this trial (ClinicalTrials.gov Identifier: NCT04685525) we sought to examine the feasibility of MSD diet among MM patients undergoing transplant by assessing its potential effect on decreasing post-transplant GI toxicities. Methods: The primary objective of this study is to evaluate the feasibility of MSD diet using patient's adherence to the MSD diet. The adherence will be assessed 3 times before transplant on days -21, -14 and -7. The MSD diet will deem feasible if at least 80% of patients showed adherence defined by 2 out of 3 assessment marked "more than half a time". With sample size of 40 we will be able to estimate the adherence rate of 80% with 95% confidence interval of +/- 12%. To assess impact of MSD on micro- and mycobiome, a custom pipeline based on Greengenes V13_8 and Unite database V7.2 will be designed for the taxonomic classification of 16SrRNA and ITS sequences, respectively. Downstream data analysis will be performed using Qiime software. Statistical analysis will be performed using the statistical programming language R (version 3.3.0). Change across time in phyla and genus abundance at the community level will be assessed using the non-parametric multivariate distance-based analysis of variance using BC distance for dissimilarity metric along with its standardized binary form. Diversity will be analyzed in an unbiased manner using the Shannon diversity index, a measure of abundance taking into account microbial distribution. Richness will be also assessed, reflecting the microbial counts of the bacterial and fungal communities in each sample. Longitudinal analysis will be performed using all pair wise Multiple Comparison of Mean Ranks as implemented in the PMCMR plus R package version 1.2.0, employing Kruskal & Wallis test followed by Bonferroni-Dunn post-hoc adjustment. P Figure 1 Figure 1. Disclosures Malek: Sanofi: Other: Advisory Board; Bluespark Inc.: Research Funding; Amgen: Honoraria; Cumberland Inc.: Research Funding; Medpacto Inc.: Research Funding; Janssen: Other: Advisory board ; BMS: Honoraria, Research Funding; Takeda: Honoraria. Metheny: Pharmacosmos: Honoraria; Incyte: Speakers Bureau.

// Pranab K. Mukherjee 1,* , Hannah Wang 2, 3, * , Mauricio Retuerto 1 , Huan Zhang 2, 3 , Brian Burkey 4, 7 , Mahmoud A. Ghannoum 1, 7, 8 and Charis Eng 2, 3, 4, 6, 8 1 Center for Medical Mycology, Department of Dermatology, School of Medicine, Case Western Reserve University, Cleveland, OH, USA 2 Genomic Medicine Institute, Lerner Research Institute, Cleveland Clinic, Cleveland, OH, USA 3 Cleveland Clinic Lerner College of Medicine of Case Western Reserve University, Cleveland, OH, USA 4 Taussig Cancer Institute, Cleveland Clinic, Cleveland, OH, USA 5 Section of Head and Neck Surgery and Oncology, Head and Neck Institute, Cleveland Clinic, Cleveland, OH, USA 6 Department of Genetics and Genome Sciences, Case Western Reserve University School of Medicine, Cleveland, OH, USA 7 Department of Dermatology, University Hospitals Cleveland Medical Center, Cleveland, OH, USA 8 Germline High Risk Cancer Focus Group, CASE Comprehensive Cancer Center, Case Western Reserve University School of Medicine, Cleveland, OH, USA * Contributed equally to the work and should be viewed as joint first authors Correspondence to: Charis Eng, email: engc@ccf.org Mahmoud A. Ghannoum, email: mag3@case.edu Keywords: microbiome; metagenomics; head and neck squamous cell carcinoma; lingual carcinomas Received: June 08, 2017 Accepted: September 08, 2017 Published: October 19, 2017 ABSTRACT Squamous cell carcinoma of the oral (mobile) tongue (OMTC), a non-human papilloma virus-associated oral cancer, is rapidly increasing without clear etiology. Poor oral hygiene has been associated with oral cancers, suggesting that oral bacteriome (bacterial community) and mycobiome (fungal community) could play a role. While the bacteriome is increasingly recognized as an active participant in health, the role of the mycobiome has not been studied in OMTC. Tissue DNA was extracted from 39 paired tumor and adjacent normal tissues from patients with OMTC. Microbiome profiling, principal coordinate, and dissimilarity index analyses showed bacterial diversity and richness, and fungal richness, were significantly reduced in tumor tissue (TT) compared to their matched non-tumor tissues (NTT, P

Background Metabolomics represents a promising approach for discovering novel targets and biomarkers in head and neck squamous cell carcinoma (HNSCC). Here we used metabolomics to identify oral metabolites associated with HNSCC. Methods Tumor and adjacent normal tissue from surgical resections and presurgical oral washes as well as oral washes were collected from healthy participants. Metabolites extractions of these samples were analyzed by liquid chromatography-mass spectroscopy (LC/MS), LC/MS/MS and gas chromatography-MS (GC/MS). Results Among 28 samples obtained from 7 HNSCC cases and 7 controls, 422 metabolites were detected (269 identified and 153 unidentified). Oral washes contained 12 and 23 metabolites in healthy controls and HNSCC patients, respectively, with phosphate and lactate being the most abundant. Small molecules related to energy metabolism were significantly elevated in HNSCC patients compared to controls. Levels of beta-alanine, alpha-hydroxyisovalerate, tryptophan, and hexanoylcarnitine were elevated in HNSCC oral washes compared to healthy controls (range 7.8-12.2-fold). Resection tissues contained 22 metabolites, of which eight were overproduced in tumor by 1.9- to 12-fold compared to controls. TCA cycle analogs 2-hydroxyglutarate (2-HG) and 3-GMP were detected exclusively in tumor tissues. Targeted quantification of 2-HG in a representative HNSCC patient showed increase in tumor tissue (14.7 μg/mL), but undetectable in normal tissue. Moreover, high levels of 2-HG were detected in HNSCC cell lines but not in healthy primary oral keratinocyte cultures. Conclusions Oral metabolites related to energy metabolism were elevated in HNSCC, and acylcarnitine and 2HG may have potential as non-invasive biomarkers. Further validation in clinical studies is warranted., Highlights • Metabolomics identified HNSCC-associated oral metabolites in tissues and oral wash. • Oral metabolites related to energy metabolism were elevated in HNSCC. • 2-hydroxyglutarate was detected in HNSCC tumor but not in adjacent normal tissues. • 2-hydroxyglutarate and acylcarnitine may have potential as non-invasive biomarkers.

Atopic dermatitis (AD) is associated with changes in skin bacterial microbiome. Emollient treatment induces change in bacterial microbiome in AD, but its effect on fungal microbiome ("mycobiome") and their inter-kingdom correlations is unknown. We used Ion-Torrent sequencing to characterize the mycobiome of AD patients in response to emollient treatment.Skin swabs were collected from lesional and non-lesional skin of AD patients suffering from moderate AD, after informed consent and according to GCP guidelines. Genomic DNA was extracted from each swab using the MoBio PowerSoil DNA Isolation kit and used for mycobiome sequencing analyses as described in our earlier publications. Principal coordinates analyses (PCoA), diversity, abundance, and correlations analyses were conducted in R and relevant packages using non-parametric tests (P less than .05 was significant).Swab samples from 10 patients (7 females, 3 males; mean age, 10.5 years) were analyzed. Emollient treatment induced a significant reduction of Scoring Atopic Dermatitis (SCORAD) score (P less than .001). PCoA showed pre-treatment and post-treatment samples clustered differently at all taxa levels. Six genera were detected in only non-lesional samples, while four were detected in only lesional samples. In non-lesional samples, Shannon diversity index was significantly increased after emollient treatment (P less than equal to .04), while lesional skin exhibited non-significant decrease. Ascomycota was the most abundant phylum and Dothideomycetes was the most abundant Class in most samples. Eight fungal species were either significantly different (P less than .05) or showed a strong trend (P less than .1) between pre- and post-treatment samples of lesional and non-lesional skin. In lesional skin, Gram-negative Pseudomonas spp. correlated significantly with pathogenic fungal species (Aspergillus, Candida spp.) in pre-treatment samples; these correlations were not detected in post-treatment samples. Moreover, lesional skin exhibited significant correlations between Gram-positive bacteria (Corynebacterium kroppenstedtiian and Staphylococcus pettenkoferi) and pathogenic Candida species in pre-treatment samples, but not in post- treated samples.Emollient treatment may induce beneficial microbial changes in the mycobiome and augment host-microbe balance on skin in AD. Clinical relevance of these results need to be investigated. J Drugs Dermatol. 2018;17(10):1039-1048.

We conducted a prospective study to determine the longitudinal microbial profile in patients undergoing HCT for multiple myeloma (MM), and whether changes in microbial composition correlate with HCT outcomes and/or toxicities. Samples were collected from 15 patients at baseline (T-2), during marrow aplasia (T+7) and after engraftment (T+30). Ion-Torrent PGM workflow was used. Amplicons generated from 16s rRNA and the ITS genes were sequenced for bacterial and fungal identification, respectively. Relative abundance, diversity and richness were determined at the phylum and genus levels at each time point, in oral and fecal microbiome. Diversity and richness of the oral mycobiome decreased at T+7 from baseline with further decrease noted at T+30. Fecal mycobiome diversity (T-2 vs T+7, p=0.05) and richness decreased from baseline to T+7, and richness trended towards significance (p=0.06) with further decrease at T+30. In fecal samples, lower bacterial diversity at T+7 associated with more severe diarrhea (p= 0.03). Anaerobic targeting antibiotic exposure on or before T+7 affected the bacterial genus diversity (p=0.015) and richness at T+7 (p=0.014). The bacterial genus richness at baseline (p=0.03) and the diversity/richness at T+7 (p=0.01) were associated with fever development on or after T+7. Exposure to anaerobic depleting antibiotics correlated with oral mycobiome genus richness at T+30 (p=0.04). At the bacterial phylum level, the oral community composition changed at T+30 compared to baseline (Bray-curtis p=0.046) and T+7 (Bray-curtis p=0.025). When examining the changes in the mycobiome composition, test for dissimilarity showed a significant difference in the fecal fungal genus between baseline and T+30 (BrayPA p=0.025). In fecal samples, a higher abundance of Bacteriodetes present at T+7 was associated with the severity of diarrhea experienced (p=0.03). Blautia and Ruminococcus, both belonging to the Firmicutes phylum and Clostridium Class, when detected at T+7 were associated with a higher severity of vomiting (p=0.05). In oral samples, the presence of the genus Glomerella at T+7 was negatively associated with rates of neutrophil engraftment (p=0.03). Our results show that oral and fecal microbiota undergo dynamic changes in diversity, composition and relative abundance during the course of transplantation. Bacterial and fungal microbiota present specifically at count nadir could be important players. The relative abundance of particularly the anaerobic bacterial phyla, Bacteroidetes and Firciumtes during marrow aplasia, correlated with post transplant toxicities. We identified a correlation between exposure to anaerobic organism depleting antimicrobials and changes in genus diversity and richness. Baseline microbial diversity/richness and changes coinciding with marrow aplasia correlate with the incidence and severity of post transplant toxicities.

A prospective exploratory study was conducted to characterize the oral mycobiome at baseline and determine whether changes occur after admission to the intensive care unit (ICU). We found that ICU admission is associated with alterations in the oral mycobiome, including an overall increase in Candida albicans.

We report and investigated a case of inadvertent contamination of 125 mice (housed in two germ-free positive-pressurized isolators) with emerging human and coral pathogenAspergillus sydowii. The infected mice correspond to genetic line SAMP1/YitFc, which have 100% immune predisposition to develop Crohn’s disease-like spontaneous pathologies, namely, inflammatory bowel disease (IBD). Pathogen update based on a scoping review of the literature and our clinical observations and experimentation are discussed. The unwanted infection of germ-free mice (immunologically prone to suffer chronic inflammation) with human pathogenA. sydowiiresulted in no overt signs of clinical disease over 3-week exposure period, or during DSS-induced colitis experiments. Results and observations suggest thatA. sydowiialone has limited clinical effect in immunocompromised germ-free mice or that other commensal microbial flora is required forAspergillus-associated disease to occur.

Background The effect of smoking on microbial dysbiosis and the potential consequence of such shift on markers of HIV disease is unknown. Here we assessed the relationship of microbial dysbiosis with smoking and markers of HIV disease. Methods Oral wash was collected from: (1) HIV-infected smokers (HIV-SM, n = 48), (2) HIV-infected non-smokers (HIV-NS, n = 24), or (3) HIV-uninfected smokers (UI-SM, n = 24). Microbial DNA was extracted and their bacterial and fungal microbiota (bacteriome and mycobiome, respectively) were characterized using Ion-Torrent sequencing platform. Sequencing data were compared using clustering, diversity, abundance and inter-kingdom correlations analyses. Results Bacteriome was more widely dispersed than mycobiome, there was no noticeable difference in clustering between groups. Richness of oral bacteriome in HIV-SM was significantly lower than that of UI-SM (P ≤ .03). Diversity of HIV-NS was significantly lower than that of HIV-SM or UI-SM at phylum level (P ≤ .02). Abundance of Phylum Firmicutes was significantly decreased in HIV-NS compared to HIV-SM and UI-SM (P = .007 and .027, respectively), while abundance of Proteobacteria was significantly increased in HIV-NS compared to HIV-SM and UI-SM (P = .0005 and .011, respectively). Fungal phyla did not differ significantly between the three cohorts. Cumulative smoking was positively correlated with Facklamia but negatively with Enhydrobacter, and current alcohol use was negatively correlated with Geniculata. Bacteria Facklamia exhibited weakly positive correlation with longer PI duration (r = 0.094, P = 0.012), and a negative correlation with nadir CD4 count (r = -0.345; P = 0.004), while Granulicatella was negatively correlated with nadir CD4 count (r = -0.329; P = 0.007). Fungus Stemphylium correlated negatively with nadir CD4 (r = -0.323; P = 0.008). Conclusions Dysbiosis of the oral microbiota is associated with clinical and immunologic variables in HIV-infected patients.

Candida auris , a new multidrug-resistant Candida spp. which is associated with invasive infection and high rates of mortality, has recently emerged. Here, we determined the virulence factors (germination, adherence, biofilm formation, phospholipase and proteinase production) of 16 C. auris isolates and their susceptibilities to 11 drugs belonging to different antifungal classes, including a novel orally bioavailable 1,3-β- d -glucan synthesis inhibitor (SCY-078). We also examined the effect of SCY-078 on the growth, ultrastructure, and biofilm-forming abilities of C. auris . Our data showed that while the tested strains did not germinate, they did produce phospholipase and proteinase in a strain-dependent manner and had a significantly reduced ability to adhere and form biofilms compared to that of Candida albicans ( P = 0.01). C. auris isolates demonstrated reduced susceptibility to fluconazole and amphotericin B, while, in general, they were susceptible to the remaining drugs tested. SCY-078 had an MIC 90 of 1 mg/liter against C. auris and caused complete inhibition of the growth of C. auris and C. albicans . Scanning electron microscopy analysis showed that SCY-078 interrupted C. auris cell division, with the organism forming abnormal fused fungal cells. Additionally, SCY-078 possessed potent antibiofilm activity, wherein treated biofilms demonstrated significantly reduced metabolic activity and a significantly reduced thickness compared to the untreated control ( P < 0.05 for both comparisons). Our study shows that C. auris expresses several virulence determinants (albeit to a lesser extent than C. albicans ) and is resistant to fluconazole and amphotericin B. SCY-078, the new orally bioavailable antifungal, had potent antifungal/antibiofilm activity against C. auris , indicating that further evaluation of this antifungal is warranted.

Trichophyton rubrum is the leading pathogen that causes long-lasting skin and nail dermatophyte infections. Currently, topical treatment consists of terbinafine for the skin and ciclopirox for the nails, whereas systemic agents, such as oral terbinafine and itraconazole, are also prescribed. These systemic drugs have severe side effects, including liver toxicity. Topical therapies, however, are sometimes ineffective. This led us to investigate alternative treatment options, such as photodynamic therapy (PDT). Although PDT is traditionally recognized as a therapeutic option for treating a wide range of medical conditions, including age-related macular degeneration and malignant cancers, its antimicrobial properties have also received considerable attention. However, the mechanism(s) underlying the susceptibility of dermatophytic fungi to PDT is relatively unknown. As a noninvasive treatment, PDT uses a photosensitizing drug and light, which, in the presence of oxygen, results in cellular destruction. In this study, we investigated the mechanism of cytotoxicity of PDT in vitro using the silicon phthalocyanine (Pc) 4 [SiPc(OSi(CH 3 ) 2 (CH 2 ) 3 N(CH 3 ) 2 )(OH)] in T. rubrum . Confocal microscopy revealed that Pc 4 binds to cytoplasmic organelles, and upon irradiation, reactive oxygen species (ROS) are generated. The impairment of fungal metabolic activities as measured by an XTT (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxyanilide inner salt) assay indicated that 1.0 μM Pc 4 followed by 670 to 675 nm light at 2.0 J/cm 2 reduced the overall cell survival rate, which was substantiated by a dry weight assay. In addition, we found that this therapeutic approach is effective against terbinafine-sensitive (24602) and terbinafine-resistant (MRL666) strains. These data suggest that Pc 4-PDT may have utility as a treatment for dermatophytosis.

Crohn’s disease (CD) results from a complex interplay between host genetic factors and endogenous microbial communities. In the current study, we used Ion Torrent sequencing to characterize the gut bacterial microbiota (bacteriome) and fungal community (mycobiome) in patients with CD and their nondiseased first-degree relatives (NCDR) in 9 familial clusters living in northern France-Belgium and in healthy individuals from 4 families living in the same area (non-CD unrelated [NCDU]). Principal component, diversity, and abundance analyses were conducted, and CD-associated inter- and intrakingdom microbial correlations were determined. Significant microbial interactions were identified and validated using single- and mixed-species biofilms. CD and NCDR groups clustered together in the mycobiome but not in the bacteriome. Microbiotas of familial (CD and NCDR) samples were distinct from those of nonfamilial (NCDU) samples. The abundance of Serratia marcescens and Escherichia coli was elevated in CD patients, while that of beneficial bacteria was decreased. The abundance of the fungus Candida tropicalis was significantly higher in CD than in NCDR (P = 0.003) samples and positively correlated with levels of anti-Saccharomyces cerevisiae antibodies (ASCA). The abundance of C. tropicalis was positively correlated with S. marcescens and E. coli, suggesting that these organisms interact in the gut. The mass and thickness of triple-species (C. tropicalis plus S. marcescens plus E. coli) biofilm were significantly greater than those of single- and double-species biofilms. C. tropicalis biofilms comprised blastospores, while double- and triple-species biofilms were enriched in hyphae. S. marcescens used fimbriae to coaggregate or attach with C. tropicalis/E. coli, while E. coli was closely apposed with C. tropicalis. Specific interkingdom microbial interactions may be key determinants in CD., IMPORTANCE Here, we characterized the gut bacterial microbiota (bacteriome) and fungal community (mycobiome) in multiplex families with CD and healthy relatives and defined the microbial interactions leading to dysbiosis in CD. We identified fungal (Candida tropicalis) and bacterial (Serratia marcescens and Escherichia coli) species that are associated with CD dysbiosis. Additionally, we found that the level of anti-Saccharomyces cerevisiae antibodies (ASCA; a known CD biomarker) was associated with the abundance of C. tropicalis. We also identified positive interkingdom correlations between C. tropicalis, E. coli, and S. marcescens in CD patients and validated these correlations using in vitro biofilms. These results provide insight into the roles of bacteria and fungi in CD and may lead to the development of novel treatment approaches and diagnostic assays.

Background The human microbiome has been associated with allogeneic hematopoietic cell transplantation (HCT) outcomes, namely infections, graft-versus-host disease and relapse. There are no studies describing the longitudinal changes in the oral or gastrointestinal microbiome in the setting of autologous HCT. We conducted a prospective study to describe the changes in microbial diversity in patients undergoing HCT for multiple myeloma (MM), and whether these correlate with HCT outcomes and/or toxicities. Methods Samples were collected from 15 MM patients on admission (baseline, T-2), during marrow aplasia (T+7) and after engraftment (T+30) (Table 1- summarizes baseline characteristics). We evaluated the bacterial and fungal microbiome of 15 patients using Ion-Torrent PGM workflow. The amplicons generated from the 16s rRNA and the ITS genes were sequenced for bacterial and fungal identification, respectively. Sequencing reads were clustered into operational taxonomic units (OTUs, 3% distance) and taxonomically classified via Qiime bioinformatics pipeline. Diversity was calculated using Shannon diversity index and richness using the R package 'vegan'. Longitudinal analysis was performed using all pairwise Multiple Comparison of Mean Ranks as implemented PMCMR plus R package, employing Kruskal & Wallis test followed by Bonferroni-Dunn post-hoc adjustment. Results Diversity and richness of the oral mycobiome decreased at T+7 compared to pre-transplant levels with further decrease noted at T+30, without reaching significance. Fecal mycobiome diversity and richness decreased from baseline to T+7 meeting statistical significance for diversity (T-2 vs T+7, p=0.05) and richness trended towards significance (p=0.06) with a further decrease noted at T+30. The temporal changes in bacterial diversity and richness in both oral and fecal samples did not reach statistical significance. (Figure1- Box and whisker plots of diversity and richness of the bacteriome and mycobiome at the genus levels from oral rinse and fecal samples) In fecal samples, bacterial diversity noted at T+7 during count nadir was associated with the severity of diarrhea experienced after myeloablation, with lower diversity correlating with more severe diarrhea (p= 0.03). Anaerobic targeting antibiotic exposure on or before T+7 affected both the genus diversity and richness at T+7 (p=0.015 and p=0.014, respectively). The bacterial genus richness at baseline (p=0.03) as well as the diversity and richness noted at T+7 (p=0.01) was associated with the development of fever on or after T+7. For the oral mycobiome, exposure to anaerobic depleting antibiotics correlated with genus richness in T+30 samples (p=0.04). There was a trend towards significance between the diversity of fecal samples at baseline and the development of nausea post transplant, such that higher diversity was associated with lower incidence/severity of nausea (p=0.06). Conclusion and Future Directions While acknowledging the limitation inherent in the small sample size of this pilot study, our results highlight several aspects of the longitudinal changes in the microbiome during HCT. Oral and lower gastrointestinal microbial diversity and richness is altered during HCT with trends significantly different between the oral and fecal bacteriome and mycobiome. This change is likely multifactorial owing to the conditioning regimen, antimicrobial exposure and immune dysregulation. Our data suggest a possible correlation between exposure to anaerobic organism depleting antimicrobials and these changes in microbial diversity and richness at the genus level. Baseline microbial diversity and richness as well as changes coinciding with marrow aplasia could correlate with the incidence and severity of transplant related toxicities. Amifostine was used as a cytoprotectant before high dose melphalan for our patients. The effect of this organic thiophosphate on the microbiota is unclear and it would be of interest to compare matched patient samples to explore the effect of this cytoprotectant on the microbiota. Further studies conducted on a larger scale and incorporating metabolomics and proteomics will help elucidate the interactions between the host and the microbiome and their effect on short term and long term transplantation outcomes as well as toxicities. Disclosures Lazarus: Pluristem Ltd.: Consultancy. Caimi:Celgene: Speakers Bureau; Kite Pharma: Other: Advisory Board Participation; Kite Pharma: Other: Advisory Board Participation; Genentech: Other: Advisory Board PArticipation, Research Funding. Malek:Janssen: Consultancy, Speakers Bureau; Amgen: Consultancy, Speakers Bureau; Takeda: Consultancy, Speakers Bureau; Celgene: Consultancy, Speakers Bureau; Sanofi: Consultancy, Speakers Bureau.

Background The human microbiome has been associated with allogeneic hematopoietic cell transplantation (HCT) outcomes. To date, there are no studies describing the longitudinal changes in the oral or gastrointestinal microbiome in the setting of autologous HCT. We conducted a prospective study to determine the longitudinal microbial profile in patients undergoing HCT for multiple myeloma (MM), and whether changes in microbial abundance correlate with HCT outcomes and/or toxicities. Methods Samples were collected from 15 MM patients on admission (baseline, T-2), during marrow aplasia (T+7) and after engraftment (T+30) (Table 1- summarizes baseline characteristics). We evaluated the bacterial and fungal microbiome of 15 patients using Ion-Torrent PGM workflow. The amplicons generated from the 16s rRNA and the ITS genes were sequenced for bacterial and fungal identification, respectively. Sequencing reads were clustered into operational taxonomic units (OTUs, 3% distance) and taxonomically classified via Qiime bioinformatics pipeline. Statistical analysis was performed using the statistical programming language R. Multivariate distance based association between communities and outcome was performed using the Adonis function as implemented in the R package vegan using Bray-curtis dissimilarities distances with and without presence/absence standardization (BrayPA). Non-parametric Spearman correlation and wilcoxon rank-sum test were used for association with continuous outcome and binary outcome respectively. Results Relative abundance was determined at the phylum and genus levels across each time point, in the oral and fecal microbiome, both bacterial and fungal. At the bacterial phylum level, the oral bacterial community composition significantly changed at T+30 compared to baseline (Bray-curtis, p=0.046) and T+7 (Bray-curtis, p=0.025). When examining the changes in the mycobiome composition, test for dissimilarity showed a significant difference in the fecal fungal genus between baseline and T+30 (BrayPA, p=0.025). No other statistically significant differences were noted. Next, we correlated the microbial community (Table 2) and individual composition with outcome and transplant related toxicity, the later will be reported here. In fecal samples, the bacterial phylum Bacteriodetes present at T+7 was associated with the development and severity of diarrhea, such that patients with higher abundance of Bacteroidetes experienced lower gastrointestinal toxicity (pAdj=0.03). Additionally, the 2 genera Blautia and Ruminococcus, both belonging to the Firmicutes phylum and Clostridium Class, when detected at T+7 were associated with a higher development and severity of vomiting after exposure to high dose melphan (pAdj=0.05 for both respectively). In oral samples, the presence of the genus Glomerella at T+7 was negatively associated with rates of neutrophil engraftment (pAdj=0.03). Conclusion and Future Directions While acknowledging the limitation inherent in the small sample size, our results show that oral and fecal microbiota undergo dynamic changes in their diversity (Abstract ID 120038), composition and relative abundance during the course of transplantation. This change is likely multifactorial owing to the conditioning regimen, antimicrobial exposure and immune dysregulation. Our data suggest the bacterial and fungal microbiota present specifically at count nadir could be important players in this population of patients. Interestingly, the relative abundance of particularly the anaerobic bacterial phyla, Bacteroidetes and Firciumtes (Blautia and Ruminococcus) during marrow aplasia, correlated with transplant related toxicities in our cohort. This could further contribute to our knowledge of the role anaerobic organisms play in HCT outcomes, in accordance to what has been described in the allogeneic HCT literature. Amifostine was used as a cytoprotectant before high dose melphalan for our patients. The effect of this organic thiophosphate on the microbiota is unclear and warrants future investigations. Further studies conducted on a larger scale and incorporating metabolomics and proteomics will help elucidate the interactions between the host and the microbiome and their effect on short term and long term transplantation outcomes as well as toxicities. Disclosures Lazarus: Pluristem Ltd.: Consultancy. Malek:Amgen: Consultancy, Speakers Bureau; Takeda: Consultancy, Speakers Bureau; Sanofi: Consultancy, Speakers Bureau; Celgene: Consultancy, Speakers Bureau; Janssen: Consultancy, Speakers Bureau.

Organisms residing in the oral cavity (oral microbiota) contribute to health and disease, and influence diseases like gingivitis, periodontitis, and oral candidiasis (the most common oral complication of HIV-infection). These organisms are also associated with cancer and other systemic diseases including upper respiratory infections. There is limited knowledge regarding how oral microbes interact together and influence the host immune system. Characterizing the oral microbial community (oral microbiota) in health and disease represents a critical step in gaining insight into various members of this community. While most of the studies characterizing oral microbiota have focused on bacterial community, there are few encouraging studies characterizing the oral mycobiome (the fungal component of the oral microbiota). Our group recently characterized the oral mycobiome in health and disease focusing on HIV. In this chapter we will describe the methods used by our group for characterization of the oral mycobiome.

Oral microbiota contribute to health and disease, and their disruption may influence the course of oral diseases. Here, we used pyrosequencing to characterize the oral bacteriome and mycobiome of 12 HIV-infected patients and matched 12 uninfected controls. The number of bacterial and fungal genera in individuals ranged between 8–14 and 1–9, among uninfected and HIV-infected participants, respectively. The core oral bacteriome (COB) comprised 14 genera, of which 13 were common between the two groups. In contrast, the core oral mycobiome (COM) differed between HIV-infected and uninfected individuals, with Candida being the predominant fungus in both groups. Among Candida species, C. albicans was the most common (58% in uninfected and 83% in HIV-infected participants). Furthermore, 15 and 12 bacteria-fungi pairs were correlated significantly within uninfected and HIV-infected groups, respectively. Increase in Candida colonization was associated with a concomitant decrease in the abundance of Pichia, suggesting antagonism. We found that Pichia spent medium (PSM) inhibited growth of Candida, Aspergillus and Fusarium. Moreover, Pichia cells and PSM inhibited Candida biofilms (P = .002 and .02, respectively, compared to untreated controls). The mechanism by which Pichia inhibited Candida involved nutrient limitation, and modulation of growth and virulence factors. Finally, in an experimental murine model of oral candidiasis, we demonstrated that mice treated with PSM exhibited significantly lower infection score (P = .011) and fungal burden (P = .04) compared to untreated mice. Moreover, tongues of PSM-treated mice had few hyphae and intact epithelium, while vehicle- and nystatin-treated mice exhibited extensive fungal invasion of tissue with epithelial disruption. These results showed that PSM was efficacious against oral candidiasis in vitro and in vivo. The inhibitory activity of PSM was associated with secretory protein/s. Our findings provide the first evidence of interaction among members of the oral mycobiota, and identifies a potential novel antifungal., Author Summary Oral microbiota contribute to health and disease, and their disruption may influence the course of oral diseases like oral candidiasis. Here we identify the core oral mycobiome (COM) and core oral bacteriome (COB) in HIV-infected and uninfected individuals, and demonstrate that the COM differs between these two groups. Decrease in abundance of Pichia (a resident oral fungus) in uninfected individuals coincided with increase in abundance of Candida, suggesting an antagonistic relationship. In vitro testing showed that Pichia spent medium (PSM) inhibits growth of pathogenic fungi; these findings were validated in an experimental mouse modal of oral candidiasis. The mechanism by which Pichia antagonizes Candida involves nutrient competition and secretory factor/s that inhibit the latter's ability to adhere, germinate, and form biofilms. This study is the first to characterize the mycobiome and the bacteriome in the oral cavity of HIV infected patients, and provides the first evidence that a fungus present in the same host microenvironment antagonizes Candida and identifies potential novel antifungal approach.

The objective of the current study was to characterize the profile of oral metabolites in HIV-infected patients using metabolomics. Oral wash samples were collected from 12 HIV-infected and 12 healthy individuals (matched for age, sex, and ethnicity), processed, and analyzed by metabolomics. We detected 198 identifiable and 85 nonidentifiable metabolites; 27 identifiable metabolites were differentially present (12 increased, 15 decreased) in HIV-infected patients. Elevated metabolites included p-cresol sulfate, nucleotides (e.g., allantoin), and amino acids (e.g., phenylalanine, tryptophan), whereas decreased oral metabolites included fucose, fumarate, and N-acetylglucosamine. Pathway network analysis revealed the largest multinode network in healthy versus HIV-infected patients to involve carbohydrate biosynthesis and degradation. HIV-infected patients on antiretroviral therapy (ART) showed the largest number (12) of statistically significant metabolite correlation differences compared with healthy controls. Interestingly, the oral phenlyalanine:tyrosine ratio increased in ART-naive HIV-infected patients (mean ± SEM = 2.58 ± 0.87) compared with healthy individuals (1.33 ± 0.10, p = 0.062) or ART-experienced patients (1.78 ± 0.30, p = 0.441). This is the first study to reveal differential levels of oral metabolites in HIV-infected patients compared withj healthy volunteers, and that oral phenlyalanine:tyrosine ratio may be a useful marker for noninvasive monitoring of the immune status during HIV infection.

Purpose. The aim of this study is to assess the effect of lens wear on the formation of soft contact lens-associated Fusarium biofilms and to determine the efficacy of marketed contact lens care products against such biofilms. Methods. Using an established in vitro soft contact lens-Fusarium biofilm model, two clinical Fusarium isolates (F. solani B6914 and F. oxysporum B8996) were incubated with three different types (lotrafilcon A, etafilcon A, and balafilcon A) of worn contact lenses under conditions that facilitate biofilm formation. Unworn lenses were used as internal controls for biofilm formation. Biofilm was quantified using a tetrazolium XTT (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2Htetrazolium-5-carboxanilide) assay. In addition, susceptibilities of the fungal biofilm growth phases to the five most common multipurpose contact lens care solutions available at the time of study (three polymeric biguanide-preserved and two polyquaternium-preserved) and two hydrogen peroxide care solutions were assessed. Results. Both Fusarium strains formed dense biofilms on each of the contact lens types tested. Worn lenses showed no differences in the ability of biofilm to form compared with unworn lenses except worn etafilcon A lenses which formed more biofilm with F. oxyspourm B8996 compared with unworn controls. Lens material did not influence biofilm formation. The biofilms of F. solani on all three lens types were consistently susceptible to both hydrogen peroxide care systems (growth reduction of 84 to 97%, p 0.001) and two of the five multipurpose solutions (MPSs) (growth reduction of 62 to 85% for a biguanide-preserved MPS, p 0.05; growth reduction of 92 to 96% for a polyquaterniummyristamidopropyl dimethylamine preserved MPS, p 0.001). The biofilms of F. oxysporum on all three lens types were consistently susceptible to both hydrogen peroxide care systems (growth reduction of 79 to 99%, p 0.001) and one of the five MPSs (growth reduction of 93 to 96% for a polyquaternium-myristamidopropyl dimethylamine preserved MPS, p 0.001). Conclusions. F. solani and F. oxysporum form biofilms on lotrafilcon A, etafilcon A, and balafilcon A worn contact lenses, which are resistant to the antifungal activity of several soft contact lens care products. Only the hydrogen peroxide care systems and one polyquaternium-myristamidopropyl dimethylamine-preserved solution consistently demonstrated effective antifungal activity against both Fusarium strains on all three lens types. (Optom Vis Sci 2012;89:382–391)