Search

The improved recombinant form of the death ligand Apo2L/TRAIL (Apo2L/TRAIL.0) is not cytotoxic for normal human cells and is a good candidate for the therapy of multiple myeloma (MM), a B-cell neoplasia that remains incurable. We have analyzed the molecular determinants of myeloma sensitivity to Apo2L/TRAIL.0 in a number of MM cell lines, the mechanisms of resistance and a possible way of overcoming it. Expression of one death receptor for Apo2L/TRAIL (DR4 or DR5) is sufficient to transduce death signals, though DR5 was more efficient when both receptors were present. Membrane expression of decoy receptors (DcR1, DcR2) and intracellular levels of c-FLIP(L), XIAP and Mcl-1 were not predictive of resistance to Apo2L/TRAIL. Inhibition of Mcl-1 degradation did not prevent Apo2L/TRAIL-induced apoptosis. In IM-9 cells, resistance was associated to a reduced caspase-8 expression. U266 cells, though expressing significant levels of DR4 and caspase-8, were nevertheless resistant to Apo2L/TRAIL. This resistance could be overcome by co-treatment with valproic acid (VPA), a histone deacetylase inhibitor. VPA caused the redistribution of DR4 to plasma membrane lipid rafts and restored DR4 signaling. Overexpression of Mcl-1 in U266 cells did not prevent Apo2L/TRAIL cytotoxicity in VPA-sensitized cells. These results, taken together, support the possible use of Apo2L/TRAIL.0 in the treatment of MM.

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

Apo2L/TRAIL is a member of the TNF family, with its receptors DR4 and DR5 containing a death domain. Multiple tumors are sensitive to Apo2L/TRAIL-induced apoptosis, while normal cells are not, so it constitutes a promising new antitumoral therapy. In this review we deal rather with the physiological role of Apo2L/TRAIL, which, in one hand, is clearly related with immune antitumoral surveillance. However, a role of Apo2L/TRAIL as a fine-tuning regulator of the immune system, especially in the regulation of CD8+ T cell activation and memory, has been also demonstrated. In fact, Apo2L/TRAIL can be considered as an additional mechanism needed to prevent the development of autoimmune disease. Indeed, recent developments indicate that Apo2L/TRAIL can be also useful as a treatment against certain chronic autoimmune diseases.

Apoptosis induced by effector cells of the immune system or by cytotoxic drugs is a main mechanism mediating the prevention or elimination of tumoral cells. For instance, the human T-cell leukemia Jurkat is sensitive to Fas-induced apoptosis and to activation-induced cell death (AICD), and the promonocytic leukemia U937 is sensitive to Fas- and TNF-induced apoptosis. In this work, we have analyzed the mechanisms of resistance to physiological or pharmacological apoptosis in human leukemia by generating highly proliferative (hp) sub-lines derived from Jurkat and U937 cells. These hp sub-lines were resistant to Fas- and TNF-induced apoptosis, as well as to AICD. This was due to the complete loss of Fas and TNFR surface expression and, in the case of Jurkat-derived sub-lines, also of CD3, CD2 and CD59 molecules. The sub-lines also completely lacked the expression of the apoptotic protease CPP32, present in parental cells. Moreover, these sub-lines were no longer sensitive to doxorubicin-induced apoptosis, which was efficiently blocked by the general caspase inhibitor Z-VAD-fmk in the parental cell lines. These data suggest a molecular mechanism for the development of resistance of leukemic cells to physiological and pharmacological apoptosis inducers, giving rise to highly proliferative tumoral phenotypes. These results also indicate that Fas and CPP32 could be useful prognostic markers for the progression and/or therapy outcome of human leukemias.

It has recently been proposed that doxorubicin (DOX) can induce apoptosis in human T-leukemia cells via the Fas/FasL system in an autocrine/paracrine way. We show here that treatment of Jurkat cells with either anti-Fas antibodies, anthracyclin drugs or actinomycin D induces the activation of CPP32 (caspase-3) and apoptosis. However, DOX treatment did not induce the expression of membrane FasL or the release of soluble FasL and co-incubation with blocking anti-Fas antibodies prevented Fas-induced but not DOX-induced apoptosis. All the morphological and biochemical signs of apoptosis induced by anti-Fas or DOX can be prevented by Z-VAD-fmk, a general caspase inhibitor. DEVD-cho, a specific inhibitor of CPP32-like caspases which completely blocks Fas-mediated apoptosis, prevented drug-induced nuclear apoptosis but not cell death. We conclude that: (i) DOX-induced apoptosis in human T-leukemia/lymphoma is Fas-independent and (ii) caspase-3 is responsible of DOX-induced nuclear apoptosis but other Z-VAD-sensitive caspases are implicated in cell death.