Search

International audience; The genus Anaplasma (Anaplasmataceae, Rickettsiales) includes tick-transmitted bacterial species of importance to both veterinary and human medicine. Apart from the traditionally recognized six Anaplasma species (A. phagocytophilum, A. platys, A. bovis, A. ovis, A. centrale, A. marginale), novel strains and candidate species, also of relevance to veterinary and human medicine, are emerging worldwide. Although species related to the zoonotic A. platys and A. phagocytophilum have been reported in several African and European Mediterranean countries, data on the presence of these species in sub-Saharan countries are still lacking. This manuscript reports the investigation of Anaplasma strains related to zoonotic species in ruminants in Senegal by combining different molecular tests and phylogenetic approaches. The results demonstrated a recent introduction of Candidatus (Ca) Anaplasma turritanum, a species related to the pathogenic A. platys, possibly originating by founder effect. Further, novel undetected strains related to Candidatus (Ca) Anaplasma cinensis were detected in cattle. Based on groEL and gltA molecular comparisons, we propose including these latter strains into the Candidatus (Ca) Anaplasma africanum species. Finally, we also report the emergence of Candidatus (Ca) A. boleense in Senegal. Collectively, results confirm that Anaplasma species diversity is greater than expected and should be further investigated, and that Anaplasma routine diagnostic procedures and epidemiological surveillance should take into account specificity issues raised by the presence of these novel strains, suggesting the use of a One Health approach for the management of Anaplasmataceae in sub-Saharan Africa.

The genus

Cutaneous squamous cell carcinoma (cSCC) is a malignant lesion characterized by proliferation and transformation of keratinocytes in the epidermis and infiltrating derma. cSCC is reported in domestic and wild animal species, worldwide. The occurrence and development of cSCC rely on synergic multifactorial conditions, most importantly sunlight exposure and Papillomavirus (PV) infection. In sheep, the development of such lesions represents a threat both to animal welfare and milk production. Ovis aries papillomavirus 3 (OaPV3) is the main cSCC viral determinant and oncogenic properties of viral E6 and E7 proteins were preliminarily investigated. However, E6 and E7 role and mechanisms resulting in cSCC have not been fully clarified, mainly due to the lack specific immunological tools, such as antibodies for in situ detection of ovine papillomavirus. This paper reports the development of specific serological tools for the investigation of OaPV3 pathogenicity, and their preliminary use to screen 4 ovine cSSC formalin-fixed paraffin embedded tissues. Relevance of immunological tools to investigation of viral biological properties and diagnosis are also discussed.

Gastrointestinal disorders caused by enteric viruses are frequently reported in dogs worldwide, with significant mortality rates in unvaccinated individuals. This study reports the identification and molecular characterization of Canine parvovirus (CPV-2), Canine coronavirus (CcoV), Canine astrovirus (AstV), and Canine calicivirus (CcaV) in a panel of dogs showing severe enteric clinical signs sampled in a typical Mediterranean environment (Sardinia, Italy). At least one of these viral species was detected in 92.3% samples. CPV-2 was the most frequently detected virus (87.2%), followed by AsTv (20.5%), CCoV-IIa (18%), and CCoV-I (10.3%). CCoV-IIb and CaCV were not detected in any sample. Single infection was detected in 24 samples (66.7%), mainly related to CPV-2 (91.7%). Coinfections were present in 33.3% samples with constant detection of CPV-2. Canine coronavirus was present only in coinfected animals. The VP2 sequence analysis of CPV-2 positive samples confirmed the presence of all variants, with CPV-2b most frequently detected. Phylogeny based on the CcoV-IIa spike protein (S) gene allowed to identify 2 different clades among Sardinian isolates but failed to distinguish enteric from pantropic viruses. Study on presence and prevalence of enteroviruses in dogs increase our knowledge about the circulation of these pathogens in the Mediterranean area and highlight the need for dedicated routine vaccine prophylaxis. Molecular analyses of enteric viruses are fundamental to avoid failure of vaccines caused by frequent mutations observed in these enteroviruses.

Xipapillomavirus includes a group of viruses almost exclusively reported in both beef cattle and dairy breeding, in which they induce papillomatosis and occasionally malignant tumors. Bovine papillomaviruses (BPVs) infection impacts greatly on animal productions, and this is amplified by their cosmopolitan distribution. Cutaneous proliferative lesions in bovines can relate to leather depreciation and impaired milk production by giving rise to obstruction of the teat and hygiene limitations, often leading to hemorrhagic mastitis. This study reports the identification of a novel Xipapillomavirus type associated with udder papilloma in a Jersey cow in Costa Rica. Viral genome was fully sequenced and molecularly characterized. Histopathology and viral phylogeny and evolution are also presented and discussed by comparison with already described BPVs. Based on results, a novel Xipapillomavirus type, namely BPV30, is proposed. BPV30 is a typical Xipapillomavirus 2 most similar to BPV12, from which it separated roughly 18 million years ago. The absence of E6 and the presence of E10 in BPV30 confirm an E6 loss occurring along the clade leading to BPV12. The identification of this novel BPV is fundamental to the development of specific prophylactic tools, which represent the most effective weapon to fight viral circulation, to prevent infections, and eventually controlling associated proliferative lesions. Los xipapilomavirus comprenden un grupo de virus señalados casi exclusivamente en el ganado vacuno de carne y en la cría de ganado lechero, en los que inducen papilomatosis y ocasionalmente tumores malignos. La infección por los papilomavirus bovinos (BPV) tiene un gran impacto en las producciones animales, que se ve amplificado por su distribución cosmopolita. Las lesiones proliferativas cutáneas en los bovinos pueden relacionarse con la depreciación de la piel y el deterioro de la producción de leche al dar lugar a la obstrucción del pezón y a limitaciones higiénicas, lo que a menudo conduce a la mastitis hemorrágica. En este estudio se informa de la identificación de un nuevo tipo de Xipapillomavirus asociado al papiloma de la ubre en una vaca Jersey de Costa Rica. El genoma viral fue completamente secuenciado y caracterizado molecularmente. También se presentan y discuten la histopatología y la filogenia y evolución virales mediante la comparación con los BPV ya descritos. A partir de los resultados, se propone un nuevo tipo de Xipapillomavirus, el BPV30. El BPV30 es un Xipapillomavirus 2 típico muy similar al BPV12, del que se separó hace aproximadamente 18 millones de años. La ausencia de E6 y la presencia de E10 en el BPV30 confirman una pérdida de E6 a lo largo del clado que lleva al BPV12. La identificación de este nuevo BPV es fundamental para el desarrollo de herramientas profilácticas específicas, que representan el arma más eficaz para luchar contra la circulación viral, prevenir las infecciones y, eventualmente, controlar las lesiones proliferativas asociadas. Universidad Nacional, Costa Rica Escuela de Medicina Veterinaria

Circoviruses are small circular DNA viruses causing severe pig and poultry disease, recently identified in various bat species worldwide. We report the detection and full-genome molecular characterization of a novel bat-associated Circovirus identified in faecal samples of Miniopterus schreibersii bats (Schreiber's bent-winged bats) from Sardinia, Italy. Full-genomic sequencing revealed a new putative member of Circoviridae family, with a genome size of 2063 nt. Sequencing allowed the characterization of the two major ORFs, inversely arranged, encoding replicase and capsid proteins, as well as the finding of a polythymidine tract within the genome, and highlighted phylogenetic relationships of the novel virus. This is the first report of circovirus in European bats. Giving the high level of genetic diversity of bat circoviruses, it is paramount to further investigate the relationships between these viruses and bats.

Contagious agalactia represents one of the most relevant infectious diseases of dairy sheep, with Mycoplasma agalactiae being the primary etiological agent. The early, sensitive, and specific identification of infected animals, as well as the development of efficient prophylactic tools, remain challenging. Here, we present a comprehensive characterization of M. agalactiae antigens focusing on those shared among different isolates. Leveraging on previous proteomic data obtained on individual strains, we adopted a strategy entailing sample pooling to optimize the identification of conserved proteins that induce an immune response. The liposoluble proteins from previously characterized field isolates and the type strain PG2T were enriched by Triton X-114 fractionation, pooled, analysed by one-dimensional (1D) and two-dimensional (2D) electrophoresis, and subjected to western immunoblotting against sheep sera collected during natural infection with M. agalactiae. Immunodominant antigens were identified by Matrix-Assisted Laser Desorption-Time-Of-Flight-Mass Spectrometry (MALDI-TOF-MS). This combined immunoproteomic approach confirmed the role of several known immunogens, including P80, P48, and P40, and most variable surface proteins (Vpmas), and unveiled novel immunodominant, conserved antigens, including MAG_1000, MAG_2220, MAG_1980, phnD, MAG_4740, and MAG_2430. Genomic context, functional prediction, subcellular localization, and invariable expression of these proteins in all isolates suggest their possible involvement in bacterial pathogenicity and metabolism. Moreover, most of the identified antigens elicit a host humoral response since the early stages of infection, persisting for at least 270 days. The immunodominant, conserved antigen panel identified in this work supports the development of effective vaccines and diagnostic tools with higher sensitivity and specificity in all the natural infection stages.

SUMMARY African swine fever (ASF) is a notifiable infectious disease, caused by the ASF virus (ASFV), which is a DNA virus belonging to the family Asfarviridae, genus Asfivirus. This disease has gained importance in the last decade after its spread in several countries in Eastern and Central Europe, and more recently, in China. Despite the efforts made to eradicate it, ASF is still present on the Mediterranean island of Sardinia (Italy) and has been since 1978. ASF risk factors on the island have been analysed in previous studies; the role of free‐ranging pigs in virus persistence has been suggested, but has not been fully elucidated. The most recent eradication plan provides more stringent measures to combat free‐ranging pigs and any kind of illegality in the pig sector. From December 2017 to June 2018, a total of 29 depopulation actions were performed in 13 municipalities in central Sardinia, during which 2,281 free‐ranging pigs were culled and more than 50% of them were tested for ASFV and antibody presence (1,218 and 1,416, respectively). A total of 651 pigs were seropositive, with a mean seroprevalence of 53.4% (CI 95% = 50.6–56.3), and 38 were ASFV positive (virus prevalence = 2.6%; CI 95% = 2.1–3.0). To the best of our knowledge, the present study is the first to provide a complete evaluation of this millennial system of pig farming and ASFV prevalence in free‐ranging pigs. Furthermore, it has emphasised the necessity of combining the maintenance of an epidemiological surveillance program with continuous education of farmers and other people involved in pig husbandry, based on cultural and economic aspects.

Border Disease (BD) is a worldwide distributed pathology accountable for significant losses in the sheep and goat farming industry. The etiological agent is a Pestivirus within the family Flaviviridae called border disease virus (BDV). Despite the Sardinian ovine population being by far larger than any other Italian region, the prevalence and distribution of BD on the island are unknown. Here, we aim to determine the distribution of BDV in sheep flocks and to genetically characterize the circulating strains in Sardinia. The geographical distribution, antibody positivity, and viral genome presence have been analysed for 1286 sheep flocks distributed all over the island from bulk tank milk sampled between May 2014 and 2015. Of the flocks tested, 11.28% (95% CI 9.66&ndash, 13.12) resulted positive for the presence of anti-pestivirus antibodies with an uneven distribution between Sardinian provinces. In addition, using RT-PCR, nine BDV genomes were amplified from milk pellets of the seropositive samples. Phylogenetic analysis revealed that all the viruses amplified clustered in the same group classified as BDV-7. This represents the first study on the distribution of pestivirus infection and genetic characterization of BDV strains circulating in the Sardinian sheep population. Future studies are needed to clarify the origin, the evolution, and the epidemiology of BDV-7 in Sardinia.

Bats may be natural reservoirs for a large variety of emerging viruses, including mammalian coronaviruses (CoV). The recent emergence of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) in humans, with evidence that these viruses may have their ancestry in bats, highlights the importance of virus surveillance in bat populations. Here, we report the identification and molecular characterization of a bat β-Coronavirus, detected during a viral survey carried out on different bat species in the island of Sardinia (Italy). Cutaneous, oral swabs, and faecal samples were collected from 46 bats, belonging to 15 different species, and tested for viral presence. Coronavirus RNA was detected in faecal samples from three different species: the greater horseshoe bat (Rhinolophus ferrumequinum), the brown long-eared bat (Plecotus auritus), and the European free-tailed bat (Tadarida teniotis). Phylogenetic analyses based on RNA-dependent RNA polymerase (RdRp) sequences assigned the detected CoV to clade 2b within betacoronaviruses, clustering with SARS-like bat CoVs previously reported. These findings point to the need for continued surveillance of bat CoV circulating in Sardinian bats, and extend the current knowledge on CoV ecology with novel sequences detected in bat species not previously described as β-Coronavirus hosts.

Species belonging to the genus Anaplasma (Rickettsiales) include bacteria of veterinary and public health importance. Beside the zoonotic Anaplasma phagocytophilum, A. platys, the etiological agent of canine cyclic thrombocytopenia, has been sporadically reported in clinically ill human patients. The ongoing emergence of novel strains related to this species in vertebrate hosts emphasises the need for genetic comparisons among strains identified in different regions of the world. In this paper we developed a PCR test suitable for amplification of the still undescribed gltA gene of Anaplasma strains related to A. platys from Mediterranean ruminants and applied on a panel of 248 samples. gltA sequencing allowed phylogenetic comparison with strains related to A. platys recently identified in China, and strains representative of the Anaplasmataceae family. Results suggest the designation of Candidatus A. turritanum, including Mediterranean A. platys - like strains, and Candidatus A. cinensis, including strains isolated in China. Data generated in this study are a solid reference for future epidemiological studies of novel unclassified strains related to A. platys and for their diagnosis and raise concern on their potential veterinary and public health implications encouraging investigating the suspected unexplored diversity within the genus Anaplasma in animals and human.

African swine fever, a devastating disease for domestic pigs and wild boar, is currently spreading in Europe, Russia, and China, becoming a global threat with huge economic and ecological consequences. One interesting aspect of ASFV biology is the molecular mechanism leading to high virulence of some strains compared to more attenuated strains, which produce subclinical infections. In this work, we show that the presently circulating virulent Armenia/07 virus blocks the synthesis of IFN-β, a key mediator between the innate and adaptive immune response. Armenia/07 inhibits the cGAS-STING pathway by impairing STING activation during infection. In contrast, the cGAS-STING pathway is efficiently activated during NH/P68 attenuated strain infection, leading to the production of large amounts of IFN-β. Our results show for the first time the relationship between the cGAS-STING pathway and ASFV virulence, contributing to uncover the molecular mechanisms of ASFV virulence and to the rational development of ASFV vaccines., African swine fever virus (ASFV) is a complex, cytoplasmic double-stranded DNA (dsDNA) virus that is currently expanding throughout the world. Currently, circulating virulent genotype II Armenia/07-like viruses cause fatal disease in pigs and wild boar, whereas attenuated strains induce infections with various levels of chronic illness. Sensing cytosolic dsDNA, mainly by the key DNA sensor cyclic GMP-AMP synthase (cGAS), leads to the synthesis of type I interferon and involves signaling through STING, TBK1, and IRF3. After phosphorylation, STING translocates from the endoplasmic reticulum to the Golgi compartment and to the perinuclear region, acting as an indispensable adaptor connecting the cytosolic detection of DNA to the TBK1-IRF3 signaling pathway. We demonstrate here that attenuated NH/P68, but not virulent Armenia/07, activates the cGAS-STING-IRF3 cascade very early during infection, inducing STING phosphorylation and trafficking through a mechanism involving cGAMP. Both TBK1 and IRF3 are subsequently activated and, in response to this, a high level of beta interferon (IFN-β) was produced during NH/P68 infection; in contrast, Armenia/07 infection generated IFN-β levels below those of uninfected cells. Our results show that virulent Armenia/07 ASFV controls the cGAS-STING pathway, but these mechanisms are not at play when porcine macrophages are infected with attenuated NH/P68 ASFV. These findings show for the first time the involvement of the cGAS-STING-IRF3 route in ASFV infection, where IFN-β production or inhibition was found after infection by attenuated or virulent ASFV strains, respectively, thus reinforcing the idea that ASFV virulence versus attenuation may be a phenomenon grounded in ASFV-mediated innate immune modulation where the cGAS-STING pathway might play an important role. IMPORTANCE African swine fever, a devastating disease for domestic pigs and wild boar, is currently spreading in Europe, Russia, and China, becoming a global threat with huge economic and ecological consequences. One interesting aspect of ASFV biology is the molecular mechanism leading to high virulence of some strains compared to more attenuated strains, which produce subclinical infections. In this work, we show that the presently circulating virulent Armenia/07 virus blocks the synthesis of IFN-β, a key mediator between the innate and adaptive immune response. Armenia/07 inhibits the cGAS-STING pathway by impairing STING activation during infection. In contrast, the cGAS-STING pathway is efficiently activated during NH/P68 attenuated strain infection, leading to the production of large amounts of IFN-β. Our results show for the first time the relationship between the cGAS-STING pathway and ASFV virulence, contributing to uncover the molecular mechanisms of ASFV virulence and to the rational development of ASFV vaccines.

Mycoplasma lipoproteins play a relevant role in pathogenicity and directly interact with the host immune system. Among human mycoplasmas, Mycoplasma hominis is described as a commensal bacterium that can be associated with a number of genital and extragenital conditions. Mechanisms of M. hominis pathogenicity are still largely obscure, and only a limited number of proteins have been associated with virulence. The current study focused on investigating the role of MHO_0730 as a virulence factor and demonstrated that MHO_0730 is a surface lipoprotein, potentially expressed in vivo during natural infection, acting both as a nuclease with its amino acidic portion and as a potent inducer of Neutrophil extracellular trapsosis with its N-terminal lipid moiety. Evidence for M. hominis neutrophil extracellular trap escape is also presented. Results highlight the relevance of MHO_0730 in promoting infection and modulation and evasion of innate immunity and provide additional knowledge on M. hominis virulence and survival in the host.

Neutrophil granulocytes are paramount to innate responses as major effectors of acute inflammation. Among the various strategies enacted by neutrophils to eliminate microbes NETosis is a novel distinct antimicrobial activity in which an interlacement of chromatin fibres rich in granule-derived antimicrobial peptides and enzymes is extruded (NETs, neutrophils extracellular traps ). NETs contribute to the pathogenesis of acute and chronic inflammatory disorders. The interactions of mycoplasmas and innate immune cells, in particular neutrophil granulocytes, are poorly defined. Here, we describe NET formation in vivo in the mammary gland and milk of sheep naturally infected by Mycoplasma agalactiae. Also, we assess the contribution of liposoluble proteins, the most abundant component of the Mycoplasma membrane, in inducing NETosis. We demonstrate that Mycoplasma liposoluble proteins induce NET release at levels comparable to what observed with other stimuli, such as lipopolysaccharides and phorbol 12-myristate 13-acetate. Stimulation of neutrophils with synthetic diacylated lipopeptides based on the M. agalactiae P48, P80, and MAG_1000 proteins, combined in a mix or used individually, suggests that NETosis might not be dependent on a specific lipopeptide sequence. Also, NETosis is partially abolished when TLR2 is blocked with specific antibodies. The results presented in this work provide evidences for the mechanisms underlying NET activation in mycoplasma infections, and on their contribution to pathogenesis of mycoplasmosis.

The limited knowledge on Papillomavirus diversity (particularly in wild animal species) influences the accuracy of PVs phylogeny and their evolutionary history, and hinders the comprehension of PVs pathogenicity, especially the mechanism of virus - related cancer progression. This study reports the identification of Leopardus wiedii Papillomavirus type 1 (LwiePV1), the first PV type within Lambdapapillomavirus in a Leopardus host. LwiePV1 full genome sequencing allowed the investigation of its taxonomic position and phylogeny. Based on results, LwiePV1 should be assigned to a novel PV species providing evidence for a polyphyletic origin of feline lambda PVs, and representing an exception to codivergence between feline lambda PVs and their hosts. Results improve our knowledge on PV diversity and pave the way to future studies investigating biological and evolutionary features of animal PVs. El conocimiento limitado sobre la diversidad del virus del papiloma (particularmente en especies de animales salvajes) influye en la precisión de la filogenia de los PVs y su historia evolutiva, y dificulta la comprensión de la patogenicidad de los PVs, especialmente el mecanismo de progresión del cáncer relacionado con el virus. Este estudio informa la identificación del virus del papiloma de Leopardus wiedii tipo 1 (LwiePV1), el primer tipo de PV dentro del virus del papiloma de Lambda en un huésped Leopardus. La secuenciación completa del genoma de LwiePV1 permitió la investigación de su posición taxonómica y filogenia. Según los resultados, LwiePV1 debe asignarse a una nueva especie de PV que proporcione evidencia de un origen polifilético de PVs lambda felina y que represente una excepción a la codivergencia entre PVs lambda felina y sus huéspedes. Los resultados mejoran nuestro conocimiento sobre la diversidad PVs y allanan el camino para futuros estudios que investigan las características biológicas y evolutivas de los animales PVs . Universidad Nacional, Costa Rica

Poxvirus infections have been reported in domestic, captive, and wild avian hosts including many raptor species. A wild Common Buzzard ( Buteo buteo) admitted to a wildlife veterinary clinic in Sardinia, Italy, showed multiple, wart-like proliferative cutaneous lesions on both legs. Histologically, there was ballooning degeneration and large intracytoplasmic inclusion bodies consistent with avipoxvirus (APV) infection. Diagnosis was confirmed by PCR detecting APV genes: P4b (locus fpv167), P35 (locus fpv140), and partial DNA polymerase. Phylogenetic analyses were performed to compare the detected virus with a panel of selected APVs. Analyses of P4b and DNA polymerase assigned the virus to clade A (fowlpox virus), subclade A7, grouping with many other APVs previously isolated in birds of prey. Further research should highlight the diversity of avian pox viral strains circulating among Common Buzzards as well as the phylogenetic role of locus fpv140 (P35) in comparison with the more-conserved P4b and DNA polymerase genes.

An increasing number of studies suggest that cutaneous papillomaviruses (PVs) might be involved in skin carcinogenesis. However, only a few animal PVs have been investigated regard to their transformation properties. Here, we investigate and compare the oncogenic potential of 2 ovine Delta and Dyokappa PVs, isolated from ovine skin lesions, in vitro and ex vivo. We demonstrate that both OaPV4 (Delta) and OaPV3 (Dyokappa) E6 and E7 immortalize primary sheep keratinocytes and efficiently deregulate pRb pathway, although they seem unable to alter p53 activity. Moreover, OaPV3 and OaPV4-E6E7 expressing cells show different shape, doubling time, and clonogenic activities, providing evidence for a stronger transforming potential of OaPV3 respect to OaPV4. Also, similarly to high-risk mucosal and cutaneous PVs, the OaPV3-E7 protein, constantly expressed in sheep squamous cell carcinomas, binds pRb with higher affinity compared to the E7 encoded by OaPV4, a virus associated to fibropapilloma. Finally, we found that OaPV3 and OaPV4-E6E7 determine upregulation of the pro-proliferative proteins cyclin A and cdk1 in both human and ovine primary keratinocytes. Collectively, results provide evidence for implication of ovine PVs in cutaneous proliferative lesions and skin cancer progression, and indicate sheep as a possible animal model for the study of cutaneous lesions and malignancies.

Bacterial species of the genus Anaplasma are tick transmitted pathogens that negatively impact on animal productions and generate veterinary and public health concerns. This paper reports the identification, molecular characterization and phylogeny of novel unclassified A. platys-like strains in cats. Interestingly, these novel strains are closely related to conspecific strains recently identified in ruminants, and significantly differ from A. platys. A. platys-like strains in cats, unlike ruminants strains, show tropism for platelets. Results have implications in the diagnostic scenario of animal anaplasmosis and provide background for reconstructing the evolutionary history of species genetically related to A. platys.

The genus Anaplasma currently comprises 6 bacterial species mostly pathogenic to animals and/or human, including the zoonotic species Anaplasma phagocytophilum, the causative agent of tick-borne fever (TBF) of ruminants, and of granulocytic anaplasmosis of horses, dogs and human. Recently, novel potentially non-pathogenic strains related to A. phagocytophilum have been identified in Japan, China, and Tunisia. This paper reports the identification, molecular typing, and evolutionary history of novel Anaplasma strains (A. phagocytophilum-like 1 and 2), related to but distinct from A. phagocytophilum in Mediterranean area of Europe and Africa. PCR-RFLP and phylogenetic analyses based on 16S rRNA provided evidence for the circulation of A. phagocytophilum-like 1 strains in Europe. Phylogeny based on groEL gene showed the inclusion of Sardinian and Tunisian A. phagocytophilum-like 1 strains in a unique clade distinct from, but related to that of Japanese strains. Results suggest that genetic diversity within the genus Anaplasma is much greater than expected and provide information useful for the development of specific and effective diagnostic and prophylactic tools.

Recently, herpes viruses have been detected in different cetacean species from the Atlantic and in Mediterranean striped dolphins (Stenella coeruleoalba). While pathogens such as cetacean morbillivirus have been widely studied following recent epizootics, herpesvirus (HV) distribution and pathogenic effects in cetaceans are still understudied. This study reports the first molecular identification of a Gammaherpesvirus in the genital mucosa of a free-living Mediterranean bottlenose dolphin (Tursiops truncatus) stranded off the coast of central Italy. Sequenced herpesviral PCR product was closely related to other HVs recently isolated in the genital mucosa of various cetacean species.

The recent characterization of the 18S ribosomal RNA (rRNA) of a pathogenic Babesia species in a domestic sow paved the way for establishing diagnostic and epidemiological tools for porcine babesiosis. Here, we developed the first specific Babesia sp. Suis PCR, and we applied this test to a panel of samples collected from animals living in a typical Mediterranean environment (Sardinia, Italy), including domestic pigs, wild boars, and ticks. In domestic pigs, PCR coupled with sequencing revealed an estimated Babesia infection frequency of 26.2% and the presence of distinct 18S sequence types. The different distribution of sequence types in symptomatic and asymptomatic subjects might suggest the existence of phylogenetically closely related strains with variable pathogenicity in pigs. Moreover, molecular identification of tick species indicated Rhipicephalus sanguineus and Rhipicephalus bursa as candidate vectors potentially involved in the transmission of this pathogen. Collectively, the data reveal the suitability of 18S rRNA PCR/sequencing for molecular diagnosis of porcine babesiosis and for large-scale investigations on the presence and geographical distribution of Babesia sp. Suis genetic variants.

Few data are available on the prevalence and molecular typing of species belonging to the genus Anaplasma in Mediterranean ruminants. In this study, PCR analysis and sequencing of both 16S rRNA and groEL genes were combined to investigate the presence, prevalence, and molecular traits of Anaplasma spp. in ruminants sampled on the Island of Sardinia, chosen as a subtropical representative area. The results demonstrate a high prevalence of Anaplasma spp. in ruminants, with animals infected by at least four of six Anaplasma species ( Anaplasma marginale , A. bovis , A. ovis , and A. phagocytophilum ). Moreover, ruminants host a number of neutrophil-tropic strains genetically closely related to the canine pathogen A. platys . The high Anaplasma spp. prevalence and the identification of as-yet-unclassified neutrophil-tropic strains raise concerns about the specificity of serological tests routinely used in ruminants and provide additional background for reconstructing the evolutionary history of species genetically related to A. phagocytophilum .

Cathelicidins are well-characterized antimicrobial peptides (AMPs) that are present in significant amounts in mastitic milk. Neutrophils are believed to be the main producers of these AMPs, while the role of mammary epithelial cells (MECs) in their production and release is still unclear. In this work, cathelicidin production patterns were investigated in mammary tissues of ewes infected by Staphylococcus aureus, Streptococcus uberis, or Mycoplasma agalactiae, with a combined approach including immunohistochemistry, immune-colocalization, and fluorescent in situ hybridization. Our results confirm that MECs produce and release cathelicidins in response to different mastitis pathogens. As opposed to neutrophils, however, MECs do not seem to store the preformed protein precursor in their cytoplasm, but appear to synthesize and release it only upon exposure to the microorganisms. Cathelicidin production by MECs appears to occur before leukocyte influx in the milk, suggesting a role for these cells in the initial response of the mammary epithelium to microbial infection. Once in the milk, infiltrating neutrophils release massive amounts of cathelicidin by degranulation and production of neutrophil extracellular traps, acting as the main contributor for cathelicidin abundance in mastitic milk. Taken together, our results support the active contribution of MECs to cathelicidin production and release, and reinforce the value of cathelicidins as sensitive and pathogen-independent mastitis markers.

Avipoxvirus (APV) infections have been observed in a wide variety of wild, captive and domestic avian hosts, recently including a range of island endemic and endangered species. However, not enough is known about genome diversity and phylogenetic relationships of APVs, as well as their host-range specificity. A wild stone curlew (Burhinus oedicnemus) was recovered in Sardinia (Italy), showing large wart-like lesions and nodules on both legs and toes, which resulted positive to poxvirus by PCR. Histopathological examination of the lesions showed ballooning degeneration and large intracytoplasmic inclusion bodies consistent with APV infection. A multiple gene sequencing approach was applied to highlight the phylogenetic relationships of this virus with a panel of selected APVs at the clade and subclade levels. This novel isolate was characterized by sequencing partial 4b core protein, P35 (locus fpv140) and DNA polymerase genes and phylogenetic analyses assigned it to clade A, (Fowlpox virus, FWPV), subclade A2. Conservation implications of avian pox presence in Sardinian stone curlews and possibly in other island bird species are discussed.

Investigating papillomavirus (PV) diversity is crucial to fully comprehend pathogenicity, genetic features, and evolution of taxa hosted by domestic and wild animal species. This study reports the identification of OaPV4, a novel ovine PV type within Deltapapillomaviruses 3. The study of OaPV4 genomic features combined to in situ hybridization and immunohistochemistry investigations allowed extrapolating several general biological features of ovine PVs, such as their cellular tropism, pathogenicity, and evolutionary history. Based on results, ovine PVs can be grouped into a polyphyletic ancient group of viruses, which splits in two main subgroups having peculiar cellular tropism and pathogenicity. Results add up to animal PV diversity and are crucial to future studies aimed to investigate the correlation between animal PV and cutaneous benign and malign proliferations.

Mycoplasma spp. have been detected in birds of prey, but their prevalence in free living raptors and their significance to birds' health need further investigation. Molecular techniques have been increasingly used to identify mycoplasmas in various avian species, due to the fastidious nature of these pathogens hampering traditional bacteriologic tests. This study reports the identification of 23 novel mycoplasma sequences during the monitoring of 62 birds of prey on admission to wildlife centers in Sardinia, Italy. Molecular investigation performed on pharyngeal swabs revealed 26 birds positive to Mycoplasma (42%). Sequence analysis based on 16S rRNA, 16S-23S rRNA intergenic spacer, and RNA polymerase β subunit (rpoB) gene highlighted cluster assignment and phylogenetic relationships among the identified types, classified within the hominis group. Additionally, Ornithobacterium rhinotracheale , associated with respiratory disease in poultry, was identified in 17 birds (27%). Potential coinfection and mycoplasma opportunistic nature present implications for raptor species conservation.

African swine fever (ASF) is a devastating disease for which there is no vaccine available. The ASF virus (ASFV) primarily infects cells of the myeloid lineage and this tropism is thought to be crucial for disease pathogenesis. A detailed in vitro characterization of the interactions of a virulent Sardinian isolate (22653/14) and a tissue culture adapted avirulent strain (BA71V) of ASFV with porcine monocytes, un-activated (moMΦ), classically (moM1) and alternatively (moM2) activated monocyte-derived macrophages was conducted in an attempt to better understand this relationship. Using a multiplicity-of-infection (MOI) of 1, both viruses were able to infect monocytes and macrophage subsets, but BA71V presented a reduced ability to infect moM1 compared to 22653/14, with higher expression of early compared to late proteins. Using an MOI of 0.01, only 22653/14 was able to replicate in all the macrophage subsets, with initially lowest in moM1 and moM2. No differences were observed in the expression of CD163 between ASFV infected and uninfected bystander cells. ASFV down-regulated CD16 expression but did not modulate MHC class II levels in monocytes and macrophage subsets. BA71V-infected but not 22653/14-infected moMΦ and moM2 presented with a reduced expression of MHC class I compared to the mock-infected controls. Higher levels of IL-18, IL1-β and IL-1α were released from moM1 after infection with BA71V compared to 22653/14 or mock-infected control. These results revealed differences between these ASFV strains, suggesting that virulent isolates have evolved mechanisms to counteract activated macrophages responses, promoting their survival, dissemination in the host and so ASF pathogenesis.

Porcine monocyte-derived macrophages (moMΦ) have been employed as a model cell in numerous studies of the porcine immune system. However, the lack of a standardized method for moMΦ differentiation hampers the comparison of results coming from the use of different laboratory protocols. In this study we compared the use of varying concentrations of autologous plasma (10, 20 and 30% v/v) or recombinant human macrophage-colony stimulating factor (hM-CSF; 50, 100, and 200 ng/ml) to differentiate porcine monocytes into macrophages. Changes in cell morphology and surface marker expression were assessed by confocal microscopy and flow cytometry. Macrophage differentiation was evaluated by analysing TNF-α response to LPS stimulation and determining cytokine secretion patterns under both basal conditions and after classical and alternative activation. The effects of the differentiation methods on metabolic activity and susceptibility to infection with the myelotropic African swine fever virus (ASFV) were also evaluated. Monocytes cultured using the different culture conditions tested augmented in dimension and cellular complexity, but increasing porcine plasma concentrations resulted in a dose dependent enhancement in granularity and a marked pleomorphism. As expected, CD163, MHC class II DR and CD203a expression were up-regulated in both hM-CSF (M-CSF-moMΦ) and autologous plasma cultured macrophages (AP-moMΦ), although a lower percentage of CD163+ cells were found following differentiation with high percentages of porcine plasma. We observed enhanced number of viable cells using high concentration of hM-CSF compared to porcine plasma, suggesting a proliferative effect. Irrespective of differentiation conditions, monocyte differentiation into macrophages resulted in an increased susceptibility to ASFV and yielded larger amounts of LPS-induced TNF-α. AP-moMΦ showed a higher basal release of IL-1RA compared to those cultured with hM-CSF and displayed a reduced ability to respond to classical activation, suggesting that the use of high percentages of porcine plasma led to the acquisition of a M2-like phenotype. We conclude that all the protocols tested in this study can be considered as suitable to produce porcine moMΦ, although the use of hM-CSF provides high responsiveness to M1 polarization. Since a higher phenotypic and functional inter-animal variability was observed in AP-moMΦ, we propose that the use of low concentration of hM-CSF should be adopted as the method of choice to provide a better reproducibility between experiments.

Free-living and captive chelonians might suffer from upper respiratory tract disease (URTD), a pathology primarily caused by Mycoplasma agassizii. Wild tortoises can also be an important reservoir of Salmonella spp., which are commensal in the host reptile but are potential zoonotic agents. Between July 2009 and June 2010, we screened free-living European tortoises (spur-thighed tortoises Testudo graeca, Hermann's tortoises Testudo hermanni, marginated tortoises Testudo marginata) temporarily housed in a wildlife center in Italy. We molecularly characterized 13 Mycoplasma isolates detected in all Testudo spp. studied, and three PCR-positive animals showed typical URTD clinical signs at the time of sampling. Three Salmonella enterica sero-types (Abony, Potsdam, Granlo), already related to reptile-associated human infections, were also identified. These results highlight the potential role played by wildlife recovery centers in the spread and transmission of pathogens among wild chelonians and to humans.

Mycoplasmas are commensals and pathogens of various avian species, and are also regularly found in birds of prey, although their significance to birds' health remains unclear. Here we describe two novel Mycoplasma isolated from the upper respiratory tract of four Eurasian griffon vultures (Gyps fulvus) housed in a wildlife recovery centre in Sardinia (Italy). By sequencing the 16S rRNA gene and the entire 16S/23S intergenic spacer region, the new strains were classified within the Mycoplasma taxonomy at the group and cluster levels, showing that the two isolates fall into the Mycoplasma synoviae and Mycoplasma hominis clusters of the hominis group, respectively. We combined molecular tools and immunoblotting methods in order to further characterize these isolates, and antigenic analyses overall confirmed the molecular findings. Different levels of pathogenicity and prevalence of these strains might have different implications for the conservation and reintroduction of vultures. © 2010 Elsevier Ltd.

This paper reports the identification and characterisation of a 60 kDa surface protein antigen (P60) of Mycoplasma capricolum subspecies capricolum (Mcc), and describes its diagnostic application. Genomic localization and presence in P60 of conserved functional domains suggested a structural and functional relationship with the immunodominant antigen P48 of Mycoplasma agalactiae, a basic membrane protein. A rP60-ELISA was developed, and it resulted in a high specificity for Mcc infections after evaluation with 125 goat sera. The comparison with an existent ELISA based on whole Mcc cell lysates showed that the two assays have comparable sensitivities, but the rP60-ELISA has the significant advantage of a greater specificity. Results indicate that P60 is a potential marker of Mcc infection, especially useful in areas where the presence of M. capricolum subspecies capripenumoniae is also reported.

Neutrophil granulocytes are paramount to innate responses as major effectors of acute inflammation. Among the various strategies enacted by neutrophils to eliminate microbes NETosis is a novel distinct antimicrobial activity in which an interlacement of chromatin fibres rich in granule-derived antimicrobial peptides and enzymes is extruded (NETs, neutrophils extracellular traps ). NETs contribute to the pathogenesis of acute and chronic inflammatory disorders. The interactions of mycoplasmas and innate immune cells, in particular neutrophil granulocytes, are poorly defined. Here, we describe NET formation in vivo in the mammary gland and milk of sheep naturally infected by Mycoplasma agalactiae. Also, we assess the contribution of liposoluble proteins, the most abundant component of the Mycoplasma membrane, in inducing NETosis. We demonstrate that Mycoplasma liposoluble proteins induce NET release at levels comparable to what observed with other stimuli, such as lipopolysaccharides and phorbol 12-myristate 13-acetate. Stimulation of neutrophils with synthetic diacylated lipopeptides based on the M. agalactiae P48, P80, and MAG_1000 proteins, combined in a mix or used individually, suggests that NETosis might not be dependent on a specific lipopeptide sequence. Also, NETosis is partially abolished when TLR2 is blocked with specific antibodies. The results presented in this work provide evidences for the mechanisms underlying NET activation in mycoplasma infections, and on their contribution to pathogenesis of mycoplasmosis.

Robino, P., Alberti, A., Chessa, B., Pittau, M., Profiti, M. and Rosati, S., 2007. Molecular cloning and expression of a surface lipoprotein of Mycoplasma capricolum as a potential antigen for serological diagnosis. Veterinary Research Communications, 31(Suppl. 1), 257–260

The gene encoding the P48 major surface lipoprotein of M. agalactiae has been recently characterised. Since its product plays an important role in the immune response of infected animals, in this study we analysed a recombinant P48 expressed in E. coli. Multiple point mutations were introduced by site directed mutagenesis in order to convert four tryptophan TGA codons, which are a typical feature of the mycoplasma genetic code, into the standard TGG. The mutated p48 gene was subcloned into pGex-2T and expressed in fusion with glutathione-S transferase. Following purification steps, P48 was eluted from carrier protein by thrombin digestion and used in Western blot and indirect ELISA using well-characterised sheep sera. Results demonstrate that specific antibodies against P48 are detected 3 weeks after onset of clinical disease and the recombinant P48 is a diagnostically relevant marker of M. agalactiae infection.

A major surface antigenic lipoprotein of Mycoplasma agalactiae , promptly recognized by the host's immune system, was characterized. The mature product, P48, showed significant similarity and shared conserved amino acid motifs with lipoproteins or predicted lipoproteins from Mycoplasma fermentans , Mycoplasma hyorhinis , relapsing fever Borrelia spp., Bacillus subtilis , and Treponema pallidum .

Canine leproid granuloma (CLG) is a mycobacterial cutaneous disease characterised by the presence of nodular skin lesions most commonly affecting the head and the dorsal aspect of the pinna (Malik and others 1998, Conceicao and others 2011, Smits and others 2012). Affected dogs appear otherwise healthy, and in the majority of cases the lesions tend to heal spontaneously over the course of weeks to months (Malik and others 1998). CLG has a wide distribution and was first reported in Africa (Zimbabwe) in 1973. Since then, all published cases of CLG have originated in Australia, New Zealand, Brazil or the USA (Malik and others 1998, Foley and others 2002, Conceicao and others 2011, Smits and others 2012). To date, no case of this disease has been reported in Europe. The mycobacterium responsible for CLG has not yet been isolated, but molecular investigations based either on 500 bp of the 16S rRNA gene (Hughes and others 2000) or on the ITS1 region (Fyfe and others 2008) identified a mycobacterial species closely related to members of the Mycobacterium simiae clade in nodular skin lesions of dogs. This paper describes the clinical features of the first reported case of CLG in Europe (to our knowledge), and the molecular investigation of the aetiological agent. A three-year-old female German shorthaired pointer was presented to the dermatology service of the Internal Medicine Department at the University of Sassari for the evaluation of a skin nodule affecting the dorsal area of the right pinna. The skin lesion was previously treated with a topical therapy containing 1 per cent gentamycin (Gentalyn cream; Schering Plough Spa, Milan, Italy) with no signs of improvement. The dog was housed with three other dogs and lived outside all year, received regular vaccination and treatment for parasites. The owner …

We detected a novel papillomavirus (EaPV1) from healthy skin and from sun associated cutaneous lesions of an Asinara (Sardinia, Italy) white donkey reared in captivity in a wildlife recovery centre. The entire genome of EaPV1 was cloned, sequenced, and characterised. Genome is 7467 bp long, and shows some characteristic elements of horse papillomaviruses, including a small untranslated region between the early and late regions and the lack of the retinoblastoma tumour suppressor binding domain LXCXE in E7. Additionally, a typical E6 ORF is missing. EaPV1 DNA was detected in low copies in normal skin of white and grey donkeys of the Asinara Island, and does not transform rodent fibroblasts in standard transformation assays. Pairwise nucleotide alignments and phylogenetic analyses based on concatenated E1-E2-L1 amino acid sequences revealed the highest similarity with the Equine papillomavirus type 1. The discovery of EaPV1, the prototype of a novel genus and the first papillomavirus isolated in donkeys, confirms a broad diversity in Equidae papillomaviruses. Taken together, data suggest that EaPV1 is a non-malignant papillomavirus adapted to healthy skin of donkeys.

To the Editor: Anaplasma phagocytophilum (formerly Ehrlichia phagocytophila), a tick-transmitted pathogen that infects several animal species, including humans (involved as accidental "dead-end" hosts), is the causative agent of human granulocytic anaplasmosis (HGA). It is a pathogen of veterinary importance responsible for tickborne fever of ruminants and for granulocytic anaplasmosis of horses and dogs (1,2). HGA was first described in the United States in 1994 (2) and is emerging in Europe (3). Although only 2 human cases have been reported in Italy (4), serologic and molecular findings have shown A. phagocytophilum infections in dogs and Ixodes ricinus ticks (5). Incidence, prevalence, and public impact of HGA and horse granulocytic anaplasmosis are, therefore, unknown for this geographic area. From 1992 to 1996, an average rate of 13.4 cases/year/100,000 inhabitants of tick bite–related fever of unknown etiology has been reported on the island of Sardinia, Italy, which is considerably higher than the corresponding national average value of 2.1 cases/year/100,000 inhabitants. Moreover, 117 cases of tick bite–related fever, whose etiology remains obscure, have been reported from 1995 to 2002 in the central west coast area of the island. Local newspapers occasionally report deaths as a result of tick bites, although no HGA-associated deaths have been documented in Europe. This study investigated A. phagocytophilum in Sardinia. From 2002 to 2004, veterinarians based on the central west coast of the island were instructed to collect EDTA blood samples when a suspected case of tick bite–related fever was found at their clinics. A total of 70 blood samples were collected from 50 dogs and 20 horses that showed tick infestation and symptoms consistent with tickborne disease, such as fever, anorexia, jaundice (only in horses), anemia, myalgia, and reluctance to move. Genomic DNA was extracted from the buffy coat obtained by centrifugation of 2 to 4 mL of blood, as previously described (6). Furthermore, DNA was extracted from 50 Rhipicephalus sanguineus ticks removed from 30 dogs. Primers EphplgroEL(569)F (ATGGTATGCAGTTTGATCGC), EphplgroEL(1193)R (TCTACTCTGTCTTTGCGTTC), and EphgroEL(1142)R (TTGAGTACAGCAACACCACCGGAA) were designed and used in combination to generate a heminested polymerase chain reaction (PCR) for the selective amplification of 573 bp of the groEL gene of A. phagocytophilum. The final 50 μL PCR volume of the first PCR round contained 5 μL of the DNA extraction, primers EphplgroEL(569)F and EphplgroEL(1193)R, and HotMaster Taq DNA polymerase (5u/μL, Eppendorf) according to the manufacturer's basic protocol (Eppendorf AG, Hamburg, Germany). Heminested PCR was performed by using 5 μL of each of the first PCR products and primer EphgroEL(1142)R. To confirm the PCR diagnosis, amplicons were digested with the HindIII restriction endonuclease (predicted digestion pattern: 3 fragments of 525 bp, 21 bp, and 27 bp). Anaplasma phagocytophilum DNA was obtained from strain NCH-1 and used as positive control in PCR reactions. Sequences were obtained by cloning the PCR products into the pCR2.1-TOPO vector (Invitrogen S.R.L., Milan, Italy) and using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA), according to the protocols supplied by the manufacturers. Sequences ({"type":"entrez-nucleotide","attrs":{"text":"AY848751","term_id":"56463268","term_text":"AY848751"}}AY848751, {"type":"entrez-nucleotide","attrs":{"text":"AY848747","term_id":"56463260","term_text":"AY848747"}}AY848747) were aligned to the corresponding region of other species belonging to Rickettsiales by using ClustalX (7). Genetic distances among species were computed by the Kimura 2-parameters method by using MEGA, and were used to construct bootstrapped neighbor-joining trees (8). Of 120 DNA samples, 1 tick, 3 dog, and 3 horse samples generated the predicted band of 573 bp representative of the groEL gene of A. phagocytophilum. HindIII digestions confirmed PCR diagnosis (Figure A1). Two different groEL sequence types were obtained from 1 dog and 1 horse and confirmed by BLAST (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/information3.html) queries as A. phagocytophilum groEL sequences (average identity 99%; average E value = 0), indicating that sequences did not reflect contamination. Bootstrapped neighbor-joining trees confirmed the identity of the new sequences obtained, which are closely related to HGA strains isolated in Europe and the United States (Figure). The molecular approach applied in this study established A. phagocytophilum in an area of Sardinia characterized by a high prevalence of tick bite–related fever in humans and animal species. To our knowledge, this is the first evidence of A. phagocytophilum in Sardinian dogs and horses and the first documentation of infection in Italian horses caused by pathogenic strains. Therefore, these findings suggest the emergence of Anaplasma phagocytophilum in Italy. Ixodes ricinus ticks are indicated as vectors transmitting A. phagocytophilum in Europe. Although only 0.3% of 4,086 ticks collected in 72 sites of Sardinia (9) have been identified as Ixodes, other tick species are better represented on the island (Rhipicephalus, 67.2%; Haemaphysalis, 24.1%; Dermacentor, 4.9%). A. phagocytophilum in 1 Rhipicephalus sanguineus could indicate a role of this tick in the epidemiology of HGA. Finally, these data indicate the presence of a potential threat to human and animal health and suggest activation of further epidemiologic surveillance and controls. Figure Bootstrapped neighbor-joining tree of several species belonging to Rickettsiales and identification of the strains isolated during the study as Anaplasma phagocytophilum. Strains associated to Sardinian groEL variants are closely related to European and ...

In this study the enzymatic activity of Mycoplasma agalactiae MAG_5040, a magnesium-dependent nuclease homologue to the staphylococcal SNase was characterized and its antigenicity during natural infections was established. A UGA corrected version of MAG_5040, lacking the region encoding the signal peptide, was expressed in Escherichia coli as a GST fusion protein. Recombinant GST-MAG_5040 exhibits nuclease activity similar to typical sugar-nonspecific endo- and exonucleases, with DNA as the preferred substrate and optimal activity in the presence of 20 mM MgCl2 at temperatures ranging from 37 to 45°C. According to in silico analyses, the position of the gene encoding MAG_5040 is consistently located upstream an ABC transporter, in most sequenced mycoplasmas belonging to the Mycoplasma hominis group. In M. agalactiae, MAG_5040 is transcribed in a polycistronic RNA together with the ABC transporter components and with MAG_5030, which is predicted to be a sugar solute binding protein by 3D modeling and homology search. In a natural model of sheep and goats infection, anti-MAG_5040 antibodies were detected up to 9 months post infection. Taking into account its enzymatic activity, MAG_5040 could play a key role in Mycoplasma agalactiae survival into the host, contributing to host pathogenicity. The identification of MAG_5040 opens new perspectives for the development of suitable tools for the control of contagious agalactia in small ruminants. © 2013 Cacciotto et al.

Background: Visceral Leishmaniasis (VL) is a zoonotic disease caused by Leishmaniainfantum in the Mediterranean area. Dogs are the main reservoir of Leishmaniainf antum parasites. Disease management represents a serious problem, since anti-Leishmania drugs have limited efficacy in both symptomatic and asymptomatic dogs, which are infective to phlebotomine vectors. In many tropical and sub-tropical countries the development of a safe and easily-available vaccine has high priority. DNA vaccines represent one of the most recent innovations in the field of immunization. Findings: This study aimed to evaluate the effect of a DNA vaccine based on two Leishmania antigens (Cpb1, PO) in leishmaniotic dogs. Twelve leishmaniotic dogs from a Leishmaniasis-endemic area (Naples, Italy) received three consecutive injections of DNA vaccine at 15-days intervals. Another group of five leishmaniotic dogs received the same amount of pVAX-1 without the coding sequences of Leishmania antigens. Leishmania DNA load, INFγ, IL-4 mRNA expression levels and clinical parameters were tested before and after the therapy, every 3 months for a period of 12 months. Analysis of the data in the vaccinated dogs showed: i) a decrease Leishmania DNA load in lymph node samples, ii) an increase of INFγ and IL-4 mRNA expression levels in PBMC samples. All vaccinated dogs also showed an improvement in the clinical symptoms. Conclusion: Our results show that the vaccine developed in this study may represent a useful tool in the treatment of leishmaniotic dogs. However, since the duration of positive effects is limited in time, further trials are needed to evaluate the effectiveness of immunotherapy alone or in association with conventional therapy.

Porcine babesiosis is a widespread yet overlooked disease causing economic losses in many regions of the world. To date, the etiological agent of porcine babesiosis has not been molecularly characterized. Here, we provide the first molecular characterization of a piroplasm detected in a symptomatic sow, phylogenetically closely related to the Ungulibabesids. Results pave the way for future molecular epidemiology studies.

Milk fat globules (MFGs) are vesicles released in milk as fat droplets surrounded by the endoplasmic reticulum and apical cell membranes. During formation and apocrine secretion by lactocytes, various amounts of cytoplasmic crescents remain trapped within the released vesicle, making MFGs a natural sampling mechanism of the lactating cell contents. With the aim of investigating the events occurring in the mammary epithelium during bacterial infection, the MFG proteome was characterized by two-dimensional difference gel electrophoresis (2-D DIGE), SDS-PAGE followed by shotgun liquid chromatography-tandem mass spectrometry (GeLC-MS/MS), label-free quantification by the normalized spectral abundance factor (NSAF) approach, Western blotting, and pathway analysis, using sheep naturally infected by Mycoplasma agalactiae . A number of protein classes were found to increase in MFGs upon infection, including proteins involved in inflammation and host defense, cortical cytoskeleton proteins, heat shock proteins, and proteins related to oxidative stress. Conversely, a strikingly lower abundance was observed for proteins devoted to MFG metabolism and secretion. To our knowledge, this is the first report describing proteomic changes occurring in MFGs during sheep infectious mastitis. The results presented here offer new insights into the in vivo response of mammary epithelial cells to bacterial infection and open the way to the discovery of protein biomarkers for monitoring clinical and subclinical mastitis.

The domestication of livestock represented a crucial step in human history. By using endogenous retroviruses as genetic markers, we found that sheep differentiated on the basis of their "retrotype" and morphological traits dispersed across Eurasia and Africa via separate migratory episodes. Relicts of the first migrations include the Mouflon, as well as breeds previously recognized as "primitive" on the basis of their morphology, such as the Orkney, Soay, and the Nordic short-tailed sheep now confined to the periphery of northwest Europe. A later migratory episode, involving sheep with improved production traits, shaped the great majority of present-day breeds. The ability to differentiate genetically primitive sheep from more modern breeds provides valuable insights into the history of sheep domestication.

A DNA vaccine against contagious agalactia was developed for the first time, encoding the P48 of Mycoplasma agalactiae. Specific immune responses elicited in BALB/c mice were evaluated. Both total IgG and IgG1 were detected in mice vaccinated with pVAX1/P48. Proliferation of mononuclear cells of the spleen, levels of gamma interferon, interleukin-12, and interleukin-2 mRNAs were enhanced in immunized animals. Results indicate that pVAX1/P48 vaccination induced both T(h)1 and T(h)2 immune responses. Nucleic acid immunization could be a new strategy against M. agalactiae infections and may be potentially used to develop vaccines for other Mycoplasma diseases.

An unusually high incidence of infectious keratoconjunctivitis followed by pneumonia and arthritis was observed in beef calves of a managed herd. No Moraxella spp. or bacteria other than Mycoplasma spp. were obtained from conjunctival and nasal swabs. A strategy was designed for characterization of bovine mycoplasmas at species and strain level on the basis of a combination of molecular tools and the immunoblotting method. The strategy made it possible to rapidly assign the bacterium responsible for this outbreak to one of the phylogenetic clusters of bovine mycoplasmas delineated in this study and then to identify it as Mycoplasma bovis. The strain, designated Sar 1, showed a 100% 16S rDNA sequence identity with two European strains (120/81 and MC3386) isolated in Germany and Ireland, respectively, and hosts a vsp gene analog to the vspA, vsp422-4, and vsp422-8 genes of the M. bovis reference strain PG45T and of the field strain 422. The use of a cross-reactive rabbit serum developed against the Mycoplasma agalactiae immunodominant antigen P48 confirmed the molecular findings. The immunological response of calves against M. bovis was also investigated. This is the first report on the occurrence of M. bovis on the Island of Sardinia (Italy).