Search

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Mushrooms possess various bioactivities and are used as nutritional supplements and medicinal products. Twenty-nine bioactive components have been extracted recently from mushrooms grown in Nepal. In this study, we evaluated the ability of these mushroom extracts to augment SIRT1, a mammalian SIR2 homologue localized in cytosol and nuclei. We established a system for screening food ingredients that augment the SIRT1 promoter in HaCaT cells, and identified a SIRT1-augmenting mushroom extract (number 28, Trametes versicolor). UVB irradiation induced cellular senescence in HaCaT cells, as evidenced by increased activity and expression of cellular senescence markers including senescence-associated β-galactosidase, p21, p16, phosphorylated p38, and γH2AX. Results clearly showed that the mushroom extract (No. 28) suppressed the ultraviolet B irradiation-induced cellular senescence in HaCaT cells possibly through augmenting SIRT1 expression.

Purpose: To review the outcomes of 53 patients who underwent minimally invasive plate osteosynthesis (MIPO) for distal tibial fractures., Methods: Medical records of 31 men and 22 women aged 22 to 78 (mean, 51) years who underwent MIPO using a locking compression plate for distal tibial fractures of the left (n=28) and right (n=25) legs with or without intra-articular extension were reviewed., Results: Patients were followed up for a mean of 26 (range, 24-38) months. The mean time from injury to surgery was 9 (range, 3-12) days. The mean operating time was 105 (range, 75-180) minutes. The mean hospital stay was 16 (range, 8-25) days. Non-weight bearing walking with a crutch was started after a mean of 5.7 (range, 3-9) days. The mean time to callus formation was 12 (range, 8-15) weeks. The mean time to full weight bearing was 15 (range, 8-22) weeks. The mean time to bone union was 25 (range, 20-30) weeks. All except 2 fractures united anatomically. At 10 months, the range of motion of the ankle joint in all patients was similar to the contralateral side. Two patients had malunion but this was not clinically significant. Five patients had superficial infection, and 2 patients had persistent pain., Conclusion: MIPO is effective for closed, unstable fractures of the distal tibia. It reduces surgical trauma and preserves fracture haematoma.

Background: Proximal tibia fractures are difficult to treat especially when soft tissues are compromised by conventional open reduction and internal fixation with high complication rates. Many methods have been tried to manage these fractures. Less invasive stabilization system (LISS) is the latest technology applied for these injuries. This report presents clinical results of the LISS for the treatment of complex proximal tibia fractures., Materials and Methods: From June 2007 to May 2010, total of 35 cases of the proximal tibia fractures (19 AO type 41A, 11 type 41B and five AO type 41C) were treated with the LISS technique. Clinical and radiological evaluation was done at 6, 10, 14, 20, 24 weeks and 9, 12, 18 and 24 months, respectively., Results: The mean age of the patients was 50.17 years (range 20-73 years); male patients were 21 and female 14. The mean follow-up time was 31.42 months (range 21-42 months). The patients were evaluated using Knee Society scores, and the mean score was 92.11 (range 84-100); the mean full weight bearing time was 15.8 weeks (range 12-22), and union time was 25.17 weeks (range 20-29). Superficial infections and slight mal-alignment were seen on five patients each., Conclusion: The less invasive stabilization internal fixator system can be used successfully to treat complex proximal tibia fractures with minimal complications. It can be an alternative method for the treatment of the proximal tibia fractures.

Twenty-nine mushrooms collected in the mountainous areas of Nepal were analyzed for antioxidant activity by different methods, including Folin-Ciocalteu, ORAC, ABTS, and DPPH assays. Intracellular H2O2-scavenging activity was also performed on HaCaT cells. The results showed that phenolic compounds are the main antioxidant of the mushrooms. Among studied samples, Inonotus andersonii, and Phellinus gilvus exhibited very high antioxidant activity with the phenolic contents up to 310.8 and 258.7 mg GAE/g extracts, respectively. The H2O2-scavenging assay on cells also revealed the potential of these mushrooms in the prevention of oxidative stress. In term of ACE-inhibition, results showed that Phlebia tremellosa would be a novel and promising candidate for antihypertensive studies. This mushroom exhibited even higher in vitro ACE-inhibition activity than Ganoderma lingzhi, with the IC50 values of the two mushrooms being 32  μ g/mL and 2  μ g/mL, respectively. This is the first time biological activities of mushrooms collected in Nepal were reported. Information from this study should be a valuable reference for future studies on antioxidant and ACE-inhibitory activities of mushrooms.

Black rot caused by Xanthomonas campestris pv. campestris was found in 28 sampled cabbage fields in five major cabbage-growing districts in Nepal in 2001 and in four cauliflower fields in two districts and a leaf mustard seed bed in 2003. Pathogenic X. campestris pv. campestris strains were obtained from 39 cabbage plants, 4 cauliflower plants, and 1 leaf mustard plant with typical lesions. Repetitive DNA polymerase chain reaction-based fingerprinting (rep-PCR) using repetitive extragenic palindromic, enterobacterial repetitive intergenic consensus, and BOX primers was used to assess the genetic diversity. Strains were also race typed using a differential series of Brassica spp. Cabbage strains belonged to five races (races 1, 4, 5, 6, and 7), with races 4, 1, and 6 the most common. All cauliflower strains were race 4 and the leaf mustard strain was race 6. A dendrogram derived from the combined rep-PCR profiles showed that the Nepalese X. campestris pv. campestris strains clustered separately from other Xanthomonas spp. and pathovars. Race 1 strains clustered together and strains of races 4, 5, and 6 were each split into at least two clusters. The presence of different races and the genetic variability of the pathogen should be considered when resistant cultivars are bred and introduced into regions in Nepal to control black rot of brassicas.

A survey of entomopathogenic nematodes (EPN) was conducted for the first time in Nepal during June-December 2007. EPN were recovered from 29 of the 276 soil samples (10.50%). Molecular and morphological tools were used to identify the isolates. Among 29 positive samples, seven samples (24.14%) yielded heterorhabditids (Heterorhabditis indica) and 22 samples (75.86%) contained steinernematids. Among steinernematids, seven isolates were identified as one of four described species (Steinernema abbasi, S. cholashanense, S. feltiae and S. siamkayai) whereas 15 isolates did not fit any description. H. indica was recovered from diverse habitats. Distribution of steinernematids has followed ecological niches and localized areas.

The fungus Fusarium graminearum (sexual stage Gibberella zeae) causes ear rot of maize (Zea mays) and contamination with the 8-ketotrichothecenes nivalenol (1) or 4-deoxynivalenol (2), depending on diversity of the fungal population for the 4-oxygenase gene (TRI13). To determine the importance of 1 and 2 in maize ear rot, a survey of naturally contaminated maize in Nepal was combined with experiments in the field and in a plant growth room. In the survey, 1 contamination was 4-fold more frequent than 2 contamination and 1-producers (TRI13) were isolated more than twice as frequently as 2-producers (Psi TRI13). In maize ear rot experiments, genetically diverse 1-producers and 2-producers caused ear rot and trichothecene contamination. Among strains with the same genetic background, however, 1-producers caused less ear rot and trichothecene contamination than did 2-producers. The high frequency of 1 contamination and the high virulence of many 1-producers are of concern because maize is a staple food of rural populations in Nepal and because 1 has proven to be more toxic than 2 to animals.

Infection of cereal grains with Fusarium species can cause contamination with mycotoxins that affect human and animal health. To determine the potential for mycotoxin contamination, we isolated Fusarium species from samples of rice seeds that were collected in 1997 on farms in the foothills of the Nepal Himalaya. The predominant Fusarium species in surface-disinfested seeds with husks were species of the Gibberella fujikuroi complex, including G. fujikuroi mating population A (anamorph, Fusarium verticillioides), G. fujikuroi mating population C (anamorph, Fusarium fujikuroi), and G. fujikuroi mating population D (anamorph, Fusarium proliferatum). The widespread occurrence of mating population D suggests that its role in the complex symptoms of bakanae disease of rice may be significant. Other common species were Gibberella zeae (anamorph, Fusarium graminearum) and Fusarium semitectum, with Fusarium acuminatum, Fusarium anguioides, Fusarium avenaceum, Fusarium chlamydosporum, Fusarium equiseti, and Fusarium oxysporum occasionally present. Strains of mating population C produced beauvericin, moniliformin, and gibberellic acid, but little or no fumonisin, whereas strains of mating population D produced beauvericin, fumonisin, and, usually, moniliformin, but no gibberellic acid. Some strains of G. zeae produced the 8-ketotrichothecene nivalenol, whereas others produced deoxynivalenol. Despite the occurrence of fumonisin-producing strains of mating population D, and of 8-ketotrichothecene-producing strains of G. zeae, Nepalese rice showed no detectable contamination with these mycotoxins. Effective traditional practices for grain drying and storage may prevent contamination of Nepalese rice with Fusarium mycotoxins.

Seedborne infection of rice by Pyricularia oryzae and its transmission to seedlings were studied quantitatively with naturally infected seeds of three rice cultivars collected from three locations in Nepal. A linear relationship on a logistic scale was found between panicle symptoms and seed infection, i.e., the more symptoms the higher seed infection. However, healthy-looking panicles and branches of panicles could also yield infected seeds. Postharvest measures such as winnowing and sun-drying significantly reduced seed infection by P. oryzae and filled grains had a lower degree of infection than unfilled grains. Sporulation of P. oryzae was most often confined to the embryonal end of germinating seeds. In contrast, most of the nongerminating seeds had sporulation all over the seed surface. Transmission of P. oryzae from seeds to seedlings, studied under various seeding conditions, showed that the transmission rate was always low. Thus, a seed sample with 21% seed infection resulted in less than 4% seedlings with blast lesions. Seed transmission was found for light covering of the seeds with soil or for moist seeding without covering. Transmission was rarely found when seeds were completely covered, and never in seedlings raised under water seeding conditions. Lower infection frequency was observed in seedlings raised in unsterilized soil than in seedlings raised in sterilized soil. Also, percent recovery of P. oryzae from infected seeds was higher in sterilized soil than in unsterilized soil and declined with time. Seedlings grown under low temperature (15 to 20°C) conditions did not develop blast lesions but when the same plants were transferred to high temperature (25 to 30°C) conditions, blast lesions were detected. This confirmed the latent infection in seedlings by P. oryzae grown under low temperature conditions.

ABSTRACT Avirulent isolates of Pyricularia oryzae and isolates of Bipolaris sorokiniana, a nonrice pathogen, were used to suppress rice blast caused by P. oryzae. In greenhouse experiments, both fungi substantially reduced leaf blast when applied 24 h or more before the pathogen. B. sorokiniana, but not avirulent isolates of P. oryzae, systemically reduced disease in leaf 5 when applied to whole plants at the four-leaf stage. In field experiments, both fungi were able to reduce neck blast significantly. No increase in grain yield was obtained by using avirulent isolates of P. oryzae, whereas five sprays with B. sorokiniana from seedling to heading stages increased the grain yield in two of three experiments conducted at two locations in Nepal. The significant increase in yield was observed under high inoculum pressure of P. oryzae. Induced resistance is suggested to be involved in the suppression of disease.