Search

Wheat (Triticum aestivum L.) and rice (Oryza sativa L.) are the two most important food grain crops cultivated worldwide. In present scenario of climate change as well as changing cropping system, the spot blotch of wheat caused by Bipolaris sorokiniana and brown spot of rice caused by Bipolaris oryzae have resulted in great losses to food grain yield in all parts of the country especially in regions where rice–wheat cropping system is pre-dominant. The objectives were to determine the cross infection pattern of Bipolaris spp. prevalent in rice–wheat cropping system regions and their relatedness to alternative host as well as host preference. When twenty isolates each of B. oryzae and B. sorokiniana were subjected for their pathogenicity on susceptible variety of rice (PB-1121) and wheat (Sonalika) respectively, BO-1 and BS-112 were found to be most virulent isolates with 83% and 89% disease index on their own hosts respectively. Cross infection study under artificial conditions with most virulent isolate revealed that when inoculation of BS-112 on wheat and rice was done, infection index of 89% and 80% was obtained, while BO-1 inoculation showed infection index of 85% and 78% on rice and wheat respectively. Cross infectivity was confirmed by PCR using species specific markers developed in the laboratory. Synergism between two pathogens revealed infection index of 94% on wheat and 92% on rice, which was more than individual inoculations. Cross infectivity was also identified under natural condition for both B. sorokiniana and B. oryzae on rice and wheat at certain places.

Molecular markers are fast, reliable and robust for early detection of pathogens. They need unique stable regions specific to pathogens for developing good diagnostics. The multiple sequence alignment and phylogenetic studies of conserved loci such as Internal Transcribed Spacer (ITS), Translation elongation factor 1α (TEF-1α), β-tubulin gene and glyceraldehyde 3-phosphate dehydrogenase gene (GAPDH) of wheat pathogens identified intergeneric (5–30%) and intrageneric (2–24%) variability with multiple sequence polymorphism (5–250 bp) for selection of pathogen-specific regions. ITS region precisely showed specificity for Tilletia indica and storage pathogens (Aspergillus spp., Penicillium spp. and Fusarium spp.), while TEF-1α gene distinctly differentiated 5 Fusarium species with high potential (10%) and found highly suitable for developing qPCR or LAMP assays for detection of Fusaruim head blight disease. β-tubulin gene showed, enormous variabilities among species of Puccinia (15%) and Aspergillus (23%) for developing their diagnostics. GAPDH gene with the highest intergenic sequence variability (> 30%) found suitable for developing markers at generic level. Further, it has differentiated different species of Aspergilli and Bipolaris. The variability among different pathogens enabled the selection and development of appropriate diagnostic marker such as, PCR, qPCR, RPA, LAMP assay, macro- or micro-array. As a proof of concept, a PCR-based diagnostics (MN754026) for Tilletia indica was developed, which amplified a band of 148 bp only in Tilletia indica and detected as little as 10 pg of DNA. Developed maker has tremendous potential for timely management of this quarantined pathogen.

Spot blotch disease of wheat caused by Bipolaris sorokiniana Boerma (Sacc.) is an emerging problem in South Asian countries. Whole genome of a highly virulent isolate of B. sorokiniana BS112 (BHU, Uttar Pradesh; Accession no. GCA_004329375.1) was sequenced using a hybrid assembly approach. Secreted proteins, virulence gene(s), pathogenicity-related gene(s) were identified and the role of ToxA gene present in this genome, in the development of disease was recognized. ToxA gene (535 bp) was analyzed and identified in the genome of B. sorokiniana (BS112) which revealed 100% homology with the ToxA gene of Pyrenophora tritici repentis (Accession no. MH017419). Furthermore, ToxA gene was amplified, sequenced and validated in 39 isolates of B. sorokiniana which confirmed the presence of ToxA gene in all the isolates taken for this study. All ToxA sequences were submitted in NCBI database (MN601358-MN601396). As ToxA gene interacts with Tsn1 gene of host, 13 wheat genotypes were evaluated out of which 5 genotypes (38.4%) were found to be Tsn1 positive with more severe necrotic lesions compared to Tsn1-negative wheat genotypes. In vitro expression analysis of ToxA gene in the pathogen B. sorokiniana using qPCR revealed maximum upregulation (14.67 fold) at 1st day after inoculation (DAI) in the medium. Furthermore, in planta expression analysis of ToxA gene in Tsn1-positive and Tsn1-negative genotypes, revealed maximum expression (7.89-fold) in Tsn1-positive genotype, Agra local at 5th DAI compared to Tsn1-negative genotype Chiriya 7 showing minimum expression (0.048-fold) at 5th DAI. In planta ToxA–Tsn1 interaction studies suggested that spot blotch disease is more severe in Tsn1-positive genotypes, which will be helpful in better understanding and management of spot blotch disease of wheat. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s13205-022-03213-3.

During 2019-20 crop season, India harvested record wheat production of 107.19 mt from an area of 30.5 mha thereby registering an all-time high productivity. The most serious fungal diseases which affect wheat production are rusts, spot blotch, Karnal bunt, head scab, powdery mildew, flag smut and loose smut. Recently outbreaks of Fusarium head blight (FHB) or head scab of wheat caused by Fusarium spp., has been reported from Canada, Europe, Asia, Australia and South America. In India, the disease can cause significant yield loss if rain occurs during mid anthesis in the foot hills of Punjab, Himachal Pradesh, Uttarakhand and hilly areas in Tamil Nadu. The Fusarium diseases are likely to increase under the impact of global warming and the fast adoption of reduced tillage practices in the main wheat belt, the north west plains of India. Fusarium graminearum is known to produce mycotoxins which affect human and animal health. Extensive disease surveys undertaken in Himachal Pradesh and Tamil Nadu (Wellington) during 2010–20 revealed the dominance of F. graminearum causing head blight of wheat in India. Pathogenic variation among Fusarium spp./isolates has been studied by inoculating on a set of wheat varieties under artificially inoculated conditions. These studies helped in identifying virulent F. graminearum isolates and their use in evaluating a large number of wheat genotypes for identifying sources of resistance. Genetic variation among F. graminearum isolates have been detected with molecular markers. Since most of the popular cultivars grown in India are susceptible to head scab, there is a need to evaluate a greater number of indigenous and exotic wheat lines for incorporating head scab resistance in popular wheat cultivars. This review provides an overview of the variation in pathogens associated with the disease and resistant sources available for breeding durable FHB resistant wheat varieties.

India’s wheat production has reached 107.19 million tonnes during 2019–2020. Now country is in a position to export wheat to other countries. However, Karnal bunt disease is a major constraint in wheat export and causes huge monetary loss to wheat trade. The disease is caused by a typical basidiomycetes fungus Tilletia indica. It is an important quarantined fungus which affects wheat trade and causes economic loss under changing climatic scenarios. The pathogen was first reported from India then intercepted in other countries. Currently, 77 countries have restricted the import of wheat from the areas where the disease occurs. Recently, the disease has become more severe in the north-western plains zone of India. The pathogen is seed, soil and air-borne in nature. The pathogen has complex genetics, its genetic recombination or mating behaviour between two compatible allantoid sporidia just before infection. We illustrated briefly the complex biology of the pathogen, high genetic variability, detection, genomics, and pathogenesis-related genes in T. indica.

A rapid and efficient loop-mediated isothermal amplification (LAMP) method was developed for the detection of Fusarium graminearum, predominant Fusarium spp. for causing head blight of wheat in many wheat growing countries including India. The four LAMP primers were designed from partial sequence of Fusarium graminearum chromosome 1, complete genome (accession No. HG970332.2 using region (GenBank Accession No. AY937106.1), unique to F. graminearum. The reaction temperature and ratio of outer/inner primers and optimal Mg2 + concentration for reaction efficiency were standardized. Colorimetric detection of LAMP assay showed the presence of blue colour in F. graminearum, while violet color was observed in negative reaction after adding hydroxyl napthol blue (HNB) dye. Likewise, adding 0.6 mg of ethidium bromide/ml to LAMP products showed full brightness only in positive reactions. Further, a ladder like banding pattern confirms the positive reactions on agarose gel electrophoresis whereas no patterns were observed in negative reactions. Upon amplification in the LAMP assay, only three samples out of eight tested positive by showing blue color and fluorescent signal. The assay has been optimized for speed, sensitivity, and specificity and it can detect less than 100 fg of target DNA template per reaction within 60 min. This could detect latent infection in both wheat inflorescence and seeds. Our results indicated that LAMP offers an excellent method to detect F. graminearum and it can be used as a point of care device for seed quarantine of F. graminearum and providing authentic information for disease management.

Karnal bunt of wheat is an internationally quarantined disease caused by Tilletia indica. The disease is important in North-western plain zone of India. Till date no reference or complete genome of Tilletia indica is available and reported genomes are variable in size ranging from 26.7 to 43.7 Mb. Recently whole genome of Tilletia indica RAKB_UP_1 (GCA_002220835.1, IARI, New Delhi) has been sequenced. In present study, the genomes of seven isolates of T. indica viz.. DAOM_236416 (GCA_001645015.1), PSWKBGD_1_3 (GCA_001689965.1), PSWKBGH_1 (GCA_001689995.1), PSWKBGH_2 (GCA_001689945.1), RAKB_UP_1 (GCA_002220835.1), TiK_1 (GCA_002997305.1) and Tik (GCA_003054935.1) were compared. For genome mapping, all the genome assemblies were aligned against RAKB_UP_1 genome using minimap2 wherein 86–100% similarity was observed with the reference genome. Tik_1 mapped 100%. Further, comparative genome analysis was done by identification of SNPs, In-Dels, segmental duplicates, LTR and CNV. It revealed that variable number of SNPs were ranging from 1380 (Tik_1) to 160966 (Tik) and 82 (PSWKBGH_1) to 3309 (PSWKBGD_1_3) In-Dels. The maximum number of segmental duplications (SDs) were identified in TiK_1 isolate (60632 regions) while least in DAOM_236416 isolate (2082 regions). LTR retrotransposon regions were found as 307 (DAOM_236416)–833 (PSWKBGH_2). The copy number variations including duplications and deletions have also been identified and Tik had shown highest number of duplications count (100) while no duplication was found in Tik_1 which was expected also because of 100% mapping with the reference genome. In case of deletion counts, highest (37) deletion were detected in DAOM_236416. This first study revealed that T. indica genome showed high genomic variation and can be used to devise the novel management strategies against Karnal bunt of wheat.

Wheat (Triticum aestivum L.) is a major cereal crop cultivated all over the world. Karnal bunt disease is an internationally quarantined disease caused by Tilletia indica. In modern resistance breeding, effectors have been efficiently used to identify, functionally characterize and deploy resistance genes. The present study was carried out to identify the genes related to pathogenicity in T. indica by mining whole genome sequence and transcriptome data. The secretory proteins were identified using bioinformatics tools. In total, 1337 unique proteins having secretory signatures were predicted in T. indica genome. Out of 192 genes related to host-pathogen interaction (PHI database), 7 pathogenicity-related genes were selected for relative expression analysis at different time points under in vitro and in planta conditions using qPCR. Under in vitro, maximum expression of genes was up to 3 fold on amendment with spike tissue extract from susceptible host. Under in planta, three genes (Ti2035, Ti2347 and Ti3774) showed the maximum expression at 3 days post inoculation (dpi). Further two genes (Ti57 and Ti198) showed the maximum up-regulation at 3 dpi followed by 10 dpi and 15 dpi. Two genes (Ti10340 and Ti12741) were up regulated at later stages at 10 dpi and 15 dpi only in susceptible genotype. Ti2035, Ti2347 and Ti3774 genes might have role in penetration, Ti57 and Ti198 genes may be related to penetration & infection, Ti10340 and Ti12741 genes may have role in sporulation when co-related with earlier reported histo-pathological studies. This study could be utilized to understand the mechanism(s) of pathogenesis through functional genomics for developing strategies for management of Karnal bunt of wheat.

Background: Spot blotch disease of wheat caused by Bipolaris sorokiniana Boerma (Sacc.) is an emerging problem in South Asian countries. In this study, whole genome of highly virulent isolate of Bipolaris sorokiniana (BS112) was sequenced, pathogenicity related gene(s) were identified and role of ToxA gene in spot blotch disease development was established.Results: Bipolaris sorokiniana isolate BS112 infecting wheat was sequenced using hybrid assembly approach. The assembly size of the genome was 35.64Mb (GenBank accession number RCTM00000000) with GC content of 50.2%, providing coverage of 97.6% on reference ND90Pr genome. Average gene density predicted was 250-300 genes/Mb. A total of 235 scaffolds were obtained using pyScaf assembler with N50 of 16,54,800 bp. In addition, 152 transcription factors involved in various biological processes were identified and a total of 682 secretory proteins were predicted using secretome analysis. ToxA gene (535bp) was analyzed and identified in the genome of B. sorokiniana which revealed 100% homology with ToxA gene of Pyrenophora tritici repentis. Further, ToxA gene was amplified, sequenced and validated in the 39 isolates of B. sorokiniana which confirmed the presence of ToxA gene in all the isolates of B. sorokiniana. All these ToxA sequences were submitted in NCBI database (MN601358-MN601396). As ToxA gene interacts with Tsn1 gene of host, 13 wheat genotypes were evaluated for the Tsn1 gene and five genotypes (38.4%) were found to be Tsn1 positive with more severe necrotic lesions compared to Tsn1 negative wheat genotypes. In vitro expression analysis of ToxA gene in B. sorokiniana isolate (BS112) using qPCR revealed maximum upregulation (14.67 fold) at 1st day after inoculation (DAI). Further, in planta expression analysis of ToxA gene in Tsn1 positive and Tsn1 negative genotypes, Agra local and Chiriya 7 respectively was also conducted. Results revealed maximum expression (7.89 fold) of ToxA gene in Tsn1 positive genotype, Agra local at 5th DAI compared to Tsn1 negative genotype Chiriya 7 which showed minimum expression (0.048 fold) at 5th DAI. Conclusions: Full genome of B. sorokiniana was sequenced; secreted proteins and virulence genes were identified in the genome. ToxA gene was validated in thirty nine isolates of B. sorokiniana. In planta ToxA-Tsn1 interaction studies established that spot blotch disease is more severe in Tsn1 positive genotypes. This genomic resource will provide a new insight into better understanding and management of spot blotch disease and B. sorokiniana of wheat.

Karnal bunt of wheat is an internationally quarantined disease affecting trade, quality, and production of wheat. During 2015–2016, a severe outbreak of Karnal bunt disease occurred in north-western plain zone of India. The present study was undertaken to decipher genetic variations in Indian isolates of Tilletia indica collected from different locations. Seven multilocus sequence fragments were selected to differentiate and characterize these T. indica isolates. A phylogenetic tree constructed based on pooled sequences of actin-related protein 2 (ARP2), β-tubulin (TUB), eukaryotic translation initiation factor 3 subunit A (EIF3A), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), histone 2B (H2B), phosphoglycerate kinase (PGK), and serine/threonine-protein kinase (STPK) showed that isolate KB-11 (Kaithal, Haryana) was highly conserved as it was located in cluster 1 and has the maximum sequence similarity with the reference strain. Other isolates in cluster 1 included KB-16 and KB-17, both from Uttar Pradesh, and KB-19 from Haryana. Isolates KB-07 (Jind, Haryana) and KB-18 (Mujaffar Nagar, Uttar Pradesh) were the most diverse and grouped in a subgroup of cluster 2. Maximum numbers of single nucleotide polymorphisms (SNPs) (675) were in the PGK gene across the T. indica isolates. The minimum numbers of SNPs (67) were in KB-11 (Kaithal, Haryana), while the maximum number of SNPs (165) was identified in KB-18, followed by 164 SNPs in KB-14. KB-18 isolate was found to be the most diverse amongst all T. indica isolates. This first study on multilocus sequence typing (MLST) revealed that the population of T. indica was highly diverse.

Chaetomium globosum Kunze is recognized as a potential biocontrol fungus against spot blotch of wheat caused by Bipolaris sorokiniana. Its molecular mechanism of biocontrol activity and the biosynthetic pathways involved have not been yet elucidated. Here, global transcriptome profiling of C. globosum strain Cg2 during interaction with B. sorokiniana isolate BS112 using RNA-seq was performed in order to gain insights into the potential mechanisms of antagonism. The Illumina HiSeq platform (2 × 150 bp) yielded an average of 20–22 million reads with 50–58% GC. De novo assembly generated 45,582 transcripts with 27,957 unigenes. Transcriptome analysis displayed distinct expression profiles in the interaction (Cg2–BS112), out of which 6,109 unique differentially expressed genes were present. The predominant transcripts classified as genes involved in “catalytic activity” constituted 45.06%, of which 10.02% were associated with “hydrolytic activity” (GO:0008152), and similarly, in the biological process, 29.18% of transcripts were involved in “metabolic activity” (GO:0004096 and GO:0006979). Heat map and cluster categorization suggested an increase in the expression levels of genes encoding secondary metabolites like polyketide synthase (GO:0009058), S-hydroxymethyl glutathione dehydrogenase (GO:0006069), terpene cyclase (EC 4.2.3.-), aminotran_1_2 domain-containing protein (GO:0009058), and other hydrolytic CAZYmes such as the glycosyl hydrolase (GH) family (GH 13, GH 2, GH 31, and GH 81; GO:0005975), cellulase domain-containing protein, chitinases, β-1, 3-glucanases (GO:0004565), glucan endo-1,3-beta-glucanase (GO:0052861), and proteases (GO:0004177). The obtained RNA-seq data were validated by RT-qPCR using 20 randomly chosen genes, showing consistency with the RNA-seq results. The present work is worldwide the first effort to unravel the biocontrol mechanism of C. globosum against B. sorokiniana. It generated a novel dataset for further studies and facilitated improvement of the gene annotation models in the C. globosum draft genome.

Seeds are the basic input for crop production. Infected or contaminated seed is the primary source of inoculum for a large number of destructive diseases of important food, fodder and fibre crops. In this context, seed health tests have become a major component towards sustainable crop production and crop productivity. Apart from seed health testing, the seed certification for a crop comprises legal norms to be qualified for ensuring genetic identity, physical purity, germinability and freedom from seed-transmitted pathogens and weeds. Mainly different types of conventional methods followed by molecular methods are employed for seed health testing. Conventional methods include visual inspection of seeds, washing test, seed soak method and incubation methods, while serological assay and nucleic acid-based techniques are the most accurate and least time-consuming which comes under molecular method of seed health testing. The conventional methods are mostly based on interpretation of visual symptoms, culturing and laboratory identification. Thus, it is almost difficult to interpret results with hidden symptoms. However, among all techniques available, nucleic acid-based techniques are the most accurate and least time-consuming.

Food losses due to crop infections caused by different pathogens such as bacteria, viruses and fungi are persistent issues in agriculture for centuries across the globe. The timely detection and appropriate identification of casual agents associated with diseases of crop plants or seeds are considered to be the most important issue in formulating the management strategies. Seed health testing to detect seed-borne pathogens is an important step in the management of crop diseases. Specificity, sensitivity, speed, simplicity, cost-effectiveness and reliability are the main requirements for the selection of seed health test methods. Examples of frequently used seed assays include visual examination, selective media, seedling grow-out and serological assays which, while appropriate for some pathogens, often display inadequate levels of sensitivity, specificity and accuracy. Polymerase chain reaction (PCR) has emerged as a tool for the detection of microorganisms from diverse environments. Thus far, it is clear that nucleic acid-based detection protocols exhibit higher level of sensitivity than conventional methods. Unfortunately, PCR-based seed tests require the extraction of PCR-quality DNA from target pathogens in backgrounds of saprophytic organisms and inhibitory seed-derived compounds. The inability to efficiently extract PCR-quality DNA from seeds has restricted the acceptance and application of PCR for the detection of seed-borne pathogens. To overcome these limitations, several modified PCR protocols have been developed including selective target colony enrichment followed by PCR (Bio-PCR). These techniques seek to selectively concentrate or increase target organism populations to enhance detection and have been successfully applied for detecting fungi in seed. Ultimately, improved protocols based upon PCR, ELISA, etc. will be available for the detection of all seed-borne pathogens and may supersede conventional detection methods. This chapter provides a comprehensive overview of conventional and modern tools used for the early detection and identification of seed-borne fungal pathogens.

Late blight of potato is a major disease of potato in north eastern Himalayan region of India. An experiment was carried out at Central Potato Research Station, Shillong, Meghalaya (India) during the years 2012, 2013 and 2014. Different fungicide treatments combinations were applied in potato crop at 7 days intervals. Pooled data of disease severity in cultivar Kufri Jyoti showed that first prophylactic spray with mancozeb (0.2%), second spray with dimethomorph (0.2%) + mancozeb (0.3%) and third spray with mancozeb (0.2%) was found significantly superior to reduce blight severity (39.44%) after 35 days after appearance of disease. Other fungicide treatments combinations (contact and systemic) were found significant as compared to control in Kufri Jyoti. In Pooled analysis, highest yield (35.51 t/ha) was recorded in treatment (T5; mancozeb, diemthomorph + mancozeb, mancozeb) of Kufri Jyoti. Kufri Giridhari did not respond to the fungicides significantly. Analysis of variance (ANOVA) of yield revealed that interaction between fungicides and varieties were found significant during the 2013 and 2014. All the three environments i.e. years form a single mega-environment which showed that there were significant differences in environments but not extreme differences and the order of the treatments was same across all the environments. In conclusion, newly developed fungicides spray schedule will be helpful to manage the late blight of potato and increase the potato yield in north eastern Himalayan region of India.

Tilletia indica is an important quarantined fungal pathogen inciting Karnal bunt disease of wheat. In fungal pathogens, the Hog1-type MAPK is involved in response to various stresses and virulence. In the present study,we identified, characterized and analyzed functional expression of the TiHog1-type gene. As HOG1 homologous genes are salt-inducible, the TiHOG1 gene (1104 bp) was amplified in 1 M NaCl stressed condition in T. indica; cloned in pJET2.0 cloning vector. The TiHOG1 gene was subcloned in expression vector (pRS426Gpd plasmid) and sequences were analyzed. The TiHOG1 in pRS426GPD (pRS426GPD-TiHOG1) was expressed functionally in heterologous system (Saccaromyces cerevisiae). TiHOG1 protein exhibits high amino acid similarity with the homologous protein sequences in Tilletia caries, Ustilago maydis and Puccinia graminis f. sp. tritici. Functional expression of TiHOG1 in S. cerevisiae ∆hog1 mutant showed that TiHOG1 was restored salinity stress tolerance up to 1 M NaCl, 1 M KCl, 0.25 CsCl2, 0.5 M MgCl2 and 0.5 M CaCl2 and osmostress tolerance up to 1 M sorbitol and 1 M sucrose. The expression of TiHOG1 was elicited up to 19.81-fold in response to a susceptible host, whereas resistant host factors showed 9.65-fold transcripts. This first study revealed involvement of a TiHOG1 gene in stress tolerance and may have a role in pathogenesis of T. indica (Karnal bunt of wheat).

Spot blotch caused by Bipolaris sorokiniana, is one of the major diseases of wheat in the humid and warmer wheat growing areas of India. Among the eight wheat genotypes that were evaluated with diverse ten B. sorokiniana isolates, Chirya 7 was found highly resistant to spot blotch and BS-112 was most aggressive isolate in comparison to other isolates. Relative expression analysis showed that eight defense-related genes (chitinase, glucanase, PR-1, Lipid transfer protein, Serine palmitoyl transferase, UDP-glycosyl transferase, Translationally controlled tumor protein, dnaJ-like) in wheat were highly expressed in resistant genotype (Chirya 7) as compared to susceptible cultivar, Sonalika. Furthermore, chitinase gene was up regulated to maximum level (12.42 fold) at 72 hai (hours after inoculation) in the resistant genotype, Chirya 7. Similarly, pathogenesis related-1 protein gene was showed up regulation (8.31 fold) at 24 hai; and predicted dnaJ homolog subfamily C member 8-like gene showed high up regulation at 48 hai; UDP-glycosyltransferase (UGTs) gene was highly expressed at 24 hai and predicted serine palmitoyl transferase gene showed early expression (9.22 fold) in resistant genotype. Translationally controlled tumor protein (TCTP) gene was also highly expressed at early stage. Overall, Chirya 7 genotype had shown highest transcripts during host–pathogen interaction as compared to Sonalika against most virulent isolate of BS-112, thereby indicating that resistant genotype Chirya 7 was having various defense-related genes and could serve as potential donor for spot blotch resistance breeding in wheat.

Karnal bunt of wheat (Tilletia indica) is an important internationally quarantined disease from food security point of view. For understanding host specificity and host-pathogen interaction, putative pathogenicity-related genes were analysed in Tilletia indica in response to host factor at different time points. Highest radial mycelia growth (3.4 cm) was recorded in media amended with susceptible host factor followed by resistant host (2.6 cm) and control (2.0 cm) at 30 days after incubation significantly. Fourteen homologous sequences of putative pathogenicity-related genes, viz. TiPmk1, TiKss1, TiHog1, TiHsp70, TiKpp2, TiCts1, TiHos2, TiChs1, TiPrf1, TiSid1, TiSsp1, TiSte20, TiUbc4 and TiUkc1, were identified in T. indica by in silico analysis. Some of the pathogenicity-related genes were highly expressed significantly in T. indica in response to susceptible host factor as compared to resistant host factor. TiPmk1, TiHog1, TiKss1 were found highly upregulated up to 26-fold (3 days), 20-fold (3 days) and 18-fold (4 days), respectively, significantly in presence of susceptible host factor. The TiCts1 and TiChs1 showed transcripts up to 26-fold (4 days) and 20-fold (3 days) in the presence of susceptible host factor. Further, the TiUbc4 and TiUkc1 were found upregulated up to 20-fold and 7-fold at 8 days and 3 days post incubation. This study provided the insight on expression of putative pathogenicity-related genes in T. indica which will help in understanding the infection mechanism and basis for further functional genomics approach.

Bipolaris sorokiniana is a devastating fungal pathogen causing spot blotch of wheat. We report here the first draft genome of Bipolaris sorokiniana strain BS_112 from India using sequence reads from the Ion Torrent, Illumina HiSeq, and Nanopore platforms. The genome size was estimated at 35.64 Mb with an average G+C content of 50.20%.

Bipolaris sorokiniana is a devastating fungal pathogen causing spot blotch of wheat. We report here the first draft genome of Bipolaris sorokiniana strain BS_112 from India using sequence reads from the Ion Torrent, Illumina HiSeq, and Nanopore platforms. The genome size was estimated at 35.64 Mb with an average G+C content of 50.20%.

Tilletia indica is an internationally quarantined fungal pathogen causing Karnal bunt of wheat. The present study carried out that the whole genome of T. indica was sequenced and identified transposable elements, pathogenicity-related genes using a comparative genomics approach. The T. indica genome assembly size of 33.7 MB was generated using Illumina and Pac Bio platforms with GC content of 55.0%. A total of 1737 scaffolds were obtained with N50 of 58,667 bp. The ab initio gene prediction was performed using Ustilago maydis as the reference species. A total number of 10,113 genes were predicted with an average gene size of 1945 bp out of which functionally annotated genes were 7262. A total number of 3216 protein-coding genes were assigned in different categories. Out of a total number of 1877 transposable elements, gypsy had the highest count (573). Total 5772 simple sequence repeats were identified in the genome assembly, and the most abundant simple sequence repeat type was trinucleotide having 42% of total SSRs. The comparative genome analysis suggested 3751 proteins of T. indica had orthologs in five fungi, whereas 126 proteins were unique to T. indica. Secretome analysis revealed the presence of 1014 secretory proteins and few carbohydrate-active enzymes in the genome. Some putative candidate pathogenicity-related genes were identified in the genome. The whole genome of T. indica will provide a window to understand the pathogenesis mechanism, fungal life cycle, survival of teliospores, and novel strategies for management of Karnal bunt disease of wheat.

Tilletia indica is an internationally quarantined fungal pathogen causing Karnal bunt of wheat. The present study carried out that the whole genome of T. indica was sequenced and identified transposable elements, pathogenicity-related genes using a comparative genomics approach. The T. indica genome assembly size of 33.7 MB was generated using Illumina and Pac Bio platforms with GC content of 55.0%. A total of 1737 scaffolds were obtained with N(50) of 58,667 bp. The ab initio gene prediction was performed using Ustilago maydis as the reference species. A total number of 10,113 genes were predicted with an average gene size of 1945 bp out of which functionally annotated genes were 7262. A total number of 3216 protein-coding genes were assigned in different categories. Out of a total number of 1877 transposable elements, gypsy had the highest count (573). Total 5772 simple sequence repeats were identified in the genome assembly, and the most abundant simple sequence repeat type was trinucleotide having 42% of total SSRs. The comparative genome analysis suggested 3751 proteins of T. indica had orthologs in five fungi, whereas 126 proteins were unique to T. indica. Secretome analysis revealed the presence of 1014 secretory proteins and few carbohydrate-active enzymes in the genome. Some putative candidate pathogenicity-related genes were identified in the genome. The whole genome of T. indica will provide a window to understand the pathogenesis mechanism, fungal life cycle, survival of teliospores, and novel strategies for management of Karnal bunt disease of wheat. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s13205-019-1743-3) contains supplementary material, which is available to authorized users.

The overzealous and indiscriminate use of most of the synthetic fungicides has created different types of environmental and toxicological problems. Recently, in different parts of the world, attention has been paid towards exploitation of higher plant products as novel chemotherapeutants in plant protection. The popularity of botanical pesticides is once again increasing and some plant products are being used globally as green pesticides. Pyrethroids and neem products are well established commercially as botanical pesticides and recently some essential oils of higher plants have also been used as antimicrobials against storage pests because of their relatively safe status and wide acceptance by the consumers. Some of the volatile oils, which often contain the principal aromatic and flavouring components of herbs and spices, have been recommended as plant based antimicrobials to retard microbial contamination and reduction in spoilage of food commodities. In the context of agricultural pest management, botanical pesticides are best suited for use in organic food production in industrialized countries but can play a much greater role in the production and post harvest protection of food products in developing countries.

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs') are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5'GTGTGCGATCAGTTGCTGGG3') amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.

Karnal bunt of wheat is an internationally quarantined disease. One of the major constraints in exporting wheat is prevalence of Karnal bunt (KB). It is caused by Tilletia indica which is a heterothallic fungus and requires fusion of different mating types for causing infection. The growth efficiency and aggressiveness of plant pathogens are often associated with their carbohydrate active enzymes (CAZymes). The present study was undertaken to identify the CAZymes in whole genome sequence of Tilletia indica, and conduct sporulation analysis. Total 315 predicted secretory proteins were annotated with the CAZyme database (dbCAN). The secreted carbohydrates active enzymes were identified as 105 glycosylhydrolases (GH), 85 glycosyltransferases (GT), 83 carbohydrate esterases (CE), 8 carbohydrate binding modules (CBM), 30 auxiliary activities (AA) and 4 polysaccharide lyases (PL). Based on sporulation analysis of T. indica isolates, KB1 and KB2 isolates were most sporulative among all the isolates of T. indica. These carbohydrate active enzymes can help to understand the pathogenesis mechanism(s) of Karnal bunt using functional genomics approach.