Search

Zhi-Jun Dai,1,* Jie Gao,2,* Hua-Feng Kang,1,* Yu-Guang Ma,1 Xiao-Bin Ma,1 Wang-Feng Lu,1 Shuai Lin,1 Hong-Bing Ma,1 Xi-Jing Wang,1 Wen-Ying Wu3 1Department of Oncology, 2Department of Nephrology, 3Department of Pharmacology, Second Affiliated Hospital, Medical School of Xi'an Jiaotong University, Xi'an, People's Republic of China*These authors contributed equally to this work Abstract: The mammalian target of rapamycin (mTOR) is a protein kinase that regulates protein translation, cell growth, and apoptosis. Rapamycin (RPM), a specific inhibitor of mTOR, exhibits potent and broad in vitro and in vivo antitumor activity against leukemia, breast cancer, and melanoma. Recent studies showing that RPM sensitizes cancers to chemotherapy and radiation therapy have attracted considerable attention. This study aimed to examine the radiosensitizing effect of RPM in vitro, as well as its mechanism of action. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and colony formation assay showed that 10 nmol/L to 15 nmol/L of RPM had a radiosensitizing effects on pancreatic carcinoma cells in vitro. Furthermore, a low dose of RPM induced autophagy and reduced the number of S-phase cells. When radiation treatment was combined with RPM, the PC-2 cell cycle arrested in the G2/M phase of the cell cycle. Complementary DNA (cDNA) microarray and reverse transcription polymerase chain reaction (RT-PCR) revealed that the expression of DDB1, RAD51, and XRCC5 were downregulated, whereas the expression of PCNA and ABCC4 were upregulated in PC-2 cells. The results demonstrated that RPM effectively enhanced the radiosensitivity of pancreatic carcinoma cells. Keywords: radiation; pancreatic carcinoma; mTOR; rapamycin

Background: Multiple drug resistance protein 1 (MRP1), lung resistance protein (LRP), topoisomerase IIβ (TOPOIIβ) and B-cell lymphoma 2 (BCL2) are well known in the development of drug resistance in cancer cells. The aim of this study was to evaluate the relationship between them and the clinicopathological features, their expression differences between tumor tissue and experimental drug-resistant model in tongue carcinoma.Materials and Methods: Multiple drug resistance protein 1, LRP, TOPOIIβ, and BCL2 expression was examined by immunohistochemistry in specimens from radical surgeries of 65 patients with tongue carcinoma. A cisplatin-resistance cell line, SCC-15/cisplatin, was established from a cisplatin-sensitive cell line, SCC-15. A MTT-based method was used to analyze drug potencies. Immunofluorescence was used to detect protein expression in both cell lines. Western blot was used to compare the protein expressions in specimens and SCC-15/cisplatin cells.Results: We found higher expression of MRP1, LRP, and BCL2 and lower expression of TOPOIIβ in tongue carcinoma compared with adjacent non-neoplastic tongue tissues (P < 0.05). In addition, MRP1 and TopoIIβ expression were significantly associated with clinical stage, lymph node metastasis and histologic grade, and LRP was significantly associated with histologic grade in the samples (P < 0.05). Finally, Western blot showed that higher expressions of MRP1, LRP, and BCL2 and lower expression of TopoIIβ were observed in SCC-15/cisplatin cells than in clinical samples.Conclusion: Our results suggest that the high expressions of MRP1, LRP, and BCL2 and low expression of TOPOIIβ in patients with tongue carcinoma indicates that intrinsic drug resistance may exist in tongue carcinoma, and is associated with tumor differentiation and cisplatin resistance in tongue carcinoma. [ABSTRACT FROM AUTHOR]

Most patients diagnosed with pancreatic cancer are initially at an advanced stage, and radiotherapy resistance impact the effectiveness of treatment. This study aims to investigate the effects of endocrine disruptor Di-(2-ethylhexyl) phthalate (DEHP) on various biological behaviors and the radiotherapy sensitivity of pancreatic cancer cells, as well as its potential mechanisms. Our findings indicate that exposure to DEHP promotes the proliferation of various cancer cells, including those from the lung, breast, pancreas, and liver, in a time- and concentration-dependent manner. Furthermore, DEHP exposure could influence several biological behaviors of pancreatic cancer cells in vivo and vitro. These effects include reducing cell apoptosis, causing G0/G1 phase arrest, increasing migration capacity, enhancing tumorigenicity, elevating the proportion of cancer stem cells (CSCs), and upregulating expression levels of CSCs markers such as CD133 and BMI1. DEHP exposure can also increase radiation resistance, which can be reversed by downregulating BMI1 expression. In summary our research suggests that DEHP exposure can lead to pancreatic cancer progression and radiotherapy resistance, and the mechanism may be related to the upregulation of BMI1 expression, which leads to the increase of CSCs properties., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

This study mitigated the challenge of head and neck CT angiography by IPA-based time-resolved imaging of contrast kinetics. To this end, 627 cerebral hemorrhage patients with dizziness, brain aneurysm, stroke, or hemorrhagic stroke diagnosis were randomly categorized into three groups, namely, the original dataset (450), verification group (112), and in vivo testified group (65), in the Affiliated BenQ Hospital of Nanjing Medical University. In the first stage, seven risk factors were assigned: age, CTA tube voltage, body surface area, heart rate per minute, cardiac output blood per minute, the actual injected amount of contrast media, and CTA delayed trigger timing. The expectation value of the semi-empirical formula was the CTA number of the patient's left artery (LA). Accordingly, 29 items of the first-order nonlinear equation were calculated via the inverse problem analysis (IPA) technique run in the STATISTICA 7.0 program, yielding a loss function and variance of 3.1837 and 0.8892, respectively. A dimensionless AT was proposed to imply the coincidence, with a lower AT indicating a smaller deviation between theoretical and practical values. The derived formula was confirmed for the verification group of 112 patients, reaching high coincidence, with average AT avg and standard deviation values of 3.57% and 3.06%, respectively. In the second stage, the formula was refined to find the optimal amount of contrast media for the CTA number of LA approaching 400. Finally, the above procedure was applied to head and neck CTA images of the third group of 65 patients, reaching an average CTA number of LA of 407.8 ± 16.2 and finding no significant fluctuations.

Background: The role of carbohydrate antigen 19-9 (CA 19-9) in response assessment among patients with intrahepatic cholangiocarcinoma (iCCA) remains unknown. The authors studied the association of the CA 19-9 response (defined as a reduction >50% from baseline) with the radiologic response and the outcome in patients with unresectable iCCA., Methods: A prospective cohort of 422 patients who were initially diagnosed with unresectable iCCA, had baseline CA 19-9 levels ≥100 U/mL, and received treatment with systemic therapies at the authors' institution between January 2017 and December 2021 were enrolled in this study. The radiologic response was assessed using the Response Evaluation Criteria in Solid Tumors version 1.1. A landmark assessment of the CA 19-9 response and the radiologic response was performed. The associations between CA 19-9 response and imaging response, progression-free survival (PFS), and overall survival (OS) were analyzed., Results: Two hundred sixty-seven patients (63.3%) had a CA 19-9 response. A CA 19-9 response was observed in 123 of 132 (93.2%) radiologic responders and in 144 of 290 (49.7%) radiologic nonresponders (p < .001). CA 19-9 responders outperformed nonresponders in median PFS (10.6 vs. 3.6 months; hazard ratio [HR], 4.8 months; 95% confidence interval [CI], 3.8-6.0 months; p < .001) and OS (21.4 vs. 6.3 months; HR, 5.3 months; 95% CI, 4.2-6.7 months; p < .001). The common independent predictors of both OS and PFS included metastasis, CA 19-9 nonresponder status, and radiologic nonresponder status in multivariable analysis., Conclusions: CA 19-9 response is a valuable addition to assess tumor response and is associated with improved outcomes in patients with iCCA. Achieving a CA 19-9 response should be one of the therapeutic objectives of patients with iCCA after systemic therapies., Plain Language Summary: A decline in carbohydrate antigen 19-9 levels from elevated baseline levels should be one of the therapeutic aims of patients with intrahepatic cholangiocarcinoma who are managed with systemic therapies., (© 2023 American Cancer Society.)

Objective: To investigate the clinical characteristics, cytogenetics, molecular biology, treatment, and prognosis of patients with therapy-related myelodysplastic syndrome and acute myeloid leukemia (t-MDS/AML) secondary to malignancies. Methods: The clinical data of 86 patients with t-MDS/AML in West China Hospital of Sichuan University between January 2010 and April 2023 were retrospectively analyzed. The clinical characteristics, primary tumor types, and tumor-related therapies were analyzed. Results: The study enrolled a total of 86 patients with t-MDS/AML, including 67 patients with t-AML, including 1 patient with M(0), 6 with M(1), 27 with M(2), 9 with M(3), 12 with M(4), 10 with M(5), 1 with M(6), and 1 with M(7). Sixty-two patients could be genetically stratified, with a median overall survival (OS) of 36 (95% CI 22-52) months for 20 (29.9%) patients in the low-risk group and 6 (95% CI 3-9) months for 10 (14.9%) in the intermediate-risk group. The median OS time was 8 (95% CI 1-15) months in 32 (47.8%) patients in the high-risk group. For patients with non-acute promyelocytic leukemia (APL) and AML, the median OS of the low-risk group was 27 (95% CI 18-36) months, which was significantly longer than that of the non-low-risk group ( χ (2)=5.534, P =0.019). All 9 APL cases were treated according to the initial treatment, and the median OS was not reached, and the 1-, 2-, and 3-year OS rates were 100.0%, (75.0±6.2) %, and (75.0±6.2) % respectively. Of the 58 patients with non-APL t-AML (89.7%), 52 received chemotherapy, and 16 achieved complete remission (30.8%) after the first induction chemotherapy. The 1-, 2-, and 3-year OS rates of the non-APL t-AML group were (42.0 ± 6.6) %, (22.9±5.7) %, and (13.4±4.7) %, respectively. The median OS of patients who achieved remission was 24 (95% CI 18-30) months, and the median OS of those who did not achieve remission was 6 (95% CI 3-9) months ( χ (2)=10.170, P =0.001). Bone marrow CR was achieved in 7 (53.8%) of 13 patients treated with vineclar-containing chemotherapy, with a median OS of 12 (95% CI 9-15) months, which was not significantly different from that of vineclar-containing chemotherapy ( χ (2)=0.600, P =0.437). In 19 patients with t-MDS, the 1-, 2-, and 3-year OS rates were (46.8±11.6) %, (17.5±9.1) %, and (11.7±9.1) % with a median OS of 12 (95% CI 7-17) months, which was not significantly different from that in t-AML ( χ (2)=0.232, P =0.630) . Conclusions: Breast cancer, bowel cancer, and other primary tumors are common in patients with t-MDS/AML, which have a higher risk of adverse genetics. Patients with APL had a high induction remission rate and a good long-term prognosis, whereas patients without APL had a low remission rate and a poor long-term prognosis.

Chemical investigation of the deep-sea-derived fungus Hypocrea sp. ZEN14 afforded a new 3α-hydroxy steroidal lactone, hyposterolactone A (1) and 25 known secondary metabolites (2-26). The structure of the new compound was established by detailed spectroscopic analysis, electronic circular dichroism (ECD) calculation as well as a J-based configuration analysis. Compound 10 showed potent cytotoxicity against Huh7 and Jurkat cells with IC 50 values of 1.4 μM and 6.7 μM, respectively., (© 2023 Wiley-VHCA AG, Zurich, Switzerland.)

Background: For patients with advanced non-small-cell lung cancer (NSCLC) with EGFR mutations, the suggested course of action is epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs). Even with a high disease control rate, a majority of patients develop acquired EGFR-TKIs resistance and eventually advance. To increase the benefits of treatment, clinical trials are increasingly exploring the value of EGFR-TKIs combined with angiogenesis inhibitors as a first-line treatment in advanced NSCLC carrying EGFR mutations., Method: Using PubMed, EMBASE and Cochrane Library, to locate published full-text articles in print or online, a thorough literature search was done from the database's inception to February 2021. Additionally, oral presentation RCTs from ESMO and ASCO were obtained. We sifted out RCTs that used EGFR-TKIs along with angiogenesis inhibitors as first-line therapy for advanced EGFR-mutant NSCLC. ORR, AEs, OS, and PFS were the endpoints. Review Manager version 5.4.1 was used for data analysis., Results: One thousand eight hundred twenty-one patients were involved in 9 RCTs. According to the results, combining EGFR-TKIs with angiogenesis inhibitors therapy prolonged PFS of advanced EGFR-mutation NSCLC patients on the whole [HR:0.65 (95%CI: 0.59~0.73, P<0.00001)]. No significant statistical difference was identified between the combination group and single drug group in OS(P=0.20) and ORR (P=0.11). There are more adverse effects when EGFR-TKIs are used in combination with angiogenesis inhibitors than when used alone., Conclusion: The combination of EGFR-TKIs and angiogenesis inhibitors prolonged PFS in patients with EGFR-mutant advanced NSCLC, but the OS and ORR benefit was not significant, and the risk of adverse events was higher, more pronounced with hypertension and proteinuria; PFS in subgroups suggested that the combination was associated with better PFS in the smoking, liver metastasis, and no brain metastasis groups, and the included studies suggested that the smoking group , liver metastasis group, and brain metastasis group may have a potential OS benefit., (© 2023. The Author(s).)

Two new xanthones ( 1 and 2 ) were isolated from the deep-sea-derived fungus Penicillium sp. MCCC 3A00126 along with 34 known compounds ( 3 - 36 ). The structures of the new compounds were established by spectroscopic data. The absolute configuration of 1 was validated by comparison of experimental and calculated ECD spectra. All isolated compounds were evaluated for cytotoxicity and ferroptosis inhibitory activities. Compounds 14 and 15 exerted potent cytotoxicity against CCRF-CEM cells, with IC 50 values of 5.5 and 3.5 μM, respectively, whereas 26 , 28 , 33 , and 34 significantly inhibited RSL3-induced ferroptosis, with EC 50 values of 11.6, 7.2, 11.8, and 2.2 μM, respectively.

Background: The role of chemoradiotherapy in unresectable locally advanced pancreatic cancer is still unclear., Methods: Data from patients with unresectable locally advanced pancreatic cancer were extracted from the Surveillance, Epidemiology, and End Results Program database. Univariate and multivariate Cox regression analyses were conducted to identify the independent prognostic factors of survival. Propensity score matching was carried out to minimize the interference of confounding factors. Subgroup analysis was performed to screen the characteristics of patients who would benefit from chemoradiotherapy., Results: A total of 5002 patients with unresectable locally advanced pancreatic cancer were included. Among them, 2423 (48.4%) received chemotherapy, and 2579 (51.6%) received chemoradiotherapy. The median overall survival of all patients was 11 months. Multivariate Cox analysis showed that age (p < 0.001), marital status (p < 0.001), tumor size (p = 0.001), N stage (p = 0.015) and radiotherapy (p < 0.001) were independent prognostic factors of survival. Both before (HR, 0.817; 95% CI, 0.769-0.868; p < 0.001) and after (HR, 0.904; 95% CI, 0.876-0.933; p < 0.001) propensity score matching, chemoradiotherapy significantly improved the median overall survival of patients from 10 to 12 months. Subgroup analysis showed that chemoradiotherapy was significantly associated with improved survival regardless of sex, primary site or N stage. In addition, the following subgroups all significantly benefited from chemoradiotherapy: age ≥ 50 years, not divorced, grade 2-4, tumor size > 2 cm, adenocarcinoma, mucinous adenocarcinoma and white race., Conclusions: Chemoradiotherapy is highly recommended for patients with unresectable locally advanced pancreatic cancer., (© 2023. The Author(s).)

A NiH-catalyzed polarity-reversed hydroamination of β,γ-, γ,δ- and δ,ε-unsaturated alkenes with electrophilic anthranils was developed. This reaction proceeds in a highly regio- and chemoselective manner to afford γ, δ and ε-arylamines bearing a carbonyl or alcohol functionality with 100% atom efficiency. Preliminary mechanistic studies indicate that the chemoselectivity is controlled by the base and the alcohol product is derived from the base-catalyzed hydrosilylation of the CO bond.

Purpose: As a non-invasive treatment, stereotactic body radiation therapy (SBRT) has been an emerging and effective option for patients with unresectable intrahepatic cholangiocarcinoma (ICC). The Cyber Knife has an SBRT system, which can realize real-time tracking of tumors during treatment. It can protect the surrounding normal liver tissue while the tumor gets the therapeutic dose. The purpose of this study was to evaluate the factors affecting the local control rate for patients after SBRT treatment, and to predict the factors affecting survival rates, then to report the 3-year actual survival rates after treatment and identify the influencing factors of 3-year survival rate., Materials and Methods: We conducted a long-term follow-up of 43 patients with unresectable intrahepatic cholangiocarcinoma who underwent Cyber Knife in our hospital from January 2016 to December 2018. Regular medical check-ups were performed every 2-3 months after SBRT to evaluated the effect of treatment., Results: The median follow-up time was 15 months (4-78 months), and the median progression-free survival (PFS) was 6 months (95% CI, 2.788-9.212) and the median overall survival (OS) was 12 months (95% CI, 3.434-20.566), respectively. Based on modified Response Evaluation and Criteria in Solid Tumor (mRECIST), response rate (RR) and disease control rate (DCR) of SBRT in unresectable ICC were 55.2% and 86%. The 1-, 2- and 3-years OS rate were 51.2%, 32.6% and 23.3%. Multivariate analysis based on competing risk survival analysis identified that patients with multiple nodules, large diameter, high level of CA199 and CEA, poor ECOG performance status had worse overall survival (p < 0.05). Patients who survived ≥3 years had significantly lower levels of CEA, CA199, smaller tumor diameters and lower number of lesions (p < 0.05)., Conclusion: The SBRT might be a candidate option for patients who unable to perform surgery. The rate of 3-year survival after SBRT for unresectable ICC can be expected with 23.3%., (© 2022. The Author(s), under exclusive licence to Federación de Sociedades Españolas de Oncología (FESEO).)

Background: Polycystic ovary syndrome (PCOS) is one of the most common reproductive metabolic disorders in women, significantly affecting the biological functionalities of ovaries. This disease has garnered enormous interest from researchers. However, there is a lack of a comprehensive research concerning assessing the current status and future trends in PCOS field. This study uses bibliometric tools to comprehensively analyze the PCOS-related research progress based on the literature in the past decade., Methods: The reported PCOS literature in the past decade is downloaded from the Web of Science database. The bibliometric software is applied to analyze the co-authorship, co-citation, and co-occurrence status., Results: A total of 9936 publications imported into bibliometric tools for analysis show a sharp increase in the annual citations. The USA is dominant in terms of contribution in the field of PCOS, while China is making a significant contribution to the advancement of this field. Monash University is the most prolific institution with the highest H-index value. The contribution of University of Adelaide must be acknowledged. Legro RS and Teede HJ are the most active and influential authors in recent times, while Azziz R is the most contributed pioneer in this field. The Journal of Clinical Endocrinology & Metabolism is the most active journal with the highest number of publications and citations. The pathogenesis of PCOS had been a long-term forefront of research. In recent years, the health management in PCOS prevention and long-term complications was attracting more and more attention. The keywords like "gut microbiota", "microRNAs", "apoptosis", "Myo-inositol", "TNF-alpha", "androgen receptor", and "Vitamin D-deficient" are considered the latest research topics., Conclusion: The study comprehensively analyzes the current status and global trends in the PCOS field, providing a significant reference for researchers to explore this field effectively., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Shi and Ma.)

To reveal the distribution and transmission pathway of Paulownia witches'-broom (PaWB) disease, which is caused by phytoplasmas related to genetic variation, and the adaptability to the hosts and environments of the pathogenic population in different geographical regions in China, in this study, we used ten housekeeping gene fragments, including rp , fusA , secY , tuf , secA , dnaK , rpoB , pyrG , gyrB , and ipt , for multilocus sequence typing (MLST). A total of 142 PaWB phytoplasma strains were collected from 18 provinces or municipalities. The results showed that the genetic diversity was comparatively higher among the PaWB phytoplasma strains, and substantially different from that of the other 16SrI subgroup strains. The number of gene variation sites for different housekeeping genes in the PaWB phytoplasma strains ranged from 1 to 14 SNPs. Among them, rpoB (1.47%) and dnaK (1.12%) had higher genetic variation, and rp (0.20%) had the least genetic variation. The tuf and rpoB genes showed the fixation of positively selected beneficial mutations in the PaWB phytoplasma populations, and all housekeeping genes except tuf followed the neutral evolutionary model. We found an absence of recombination among PaWB phytoplasma sequence types (STs) for each housekeeping gene except dnaK , and no evidence for such recombination events for concatenated sequences of PaWB phytoplasma strains. The 22 sequence types were identified among the concatenated sequences of seven housekeeping genes ( rp , fusA , secY , secA , tuf , dnaK , and rpoB ) from 105 representative strains. We analyzed all 22 STs by goeBURST algorithm, forming two clonal complexes (CCs) and three singletons. Among them, ST1, as the primary founder of CC1, had the widest geographical distribution, accounting for 72.38% of all strains, with a high frequency of shared sequence type. The results of phylogenetic analysis of the concatenated sequences further revealed that the 105 strains were clustered into two representative lineages of PaWB phytoplasma, with obvious geographical differentiation. The ST1 strains of highly homogeneous lineage-1 were a widespread and predominant population in diseased areas. Lineage-2 contained strains from Jiangxi, Fujian, and Shaanxi provinces, highlighting the close genetic relatedness of the strains in these regions, which was also consistent with the results of most single-gene phylogenetic analysis of each gene. We also found that the variability in the northwest China population was higher than in other geographical populations; the range of genetic differentiation between the south of the Yangtze River population and the Huang-huai-hai Plain (or southwest China) population was relatively large. The achieved diversity and evolution data, as well as the MLST technique, are helpful for epidemiological studies and guiding PaWB disease control decisions., Competing Interests: The authors declare no conflict of interest.

Ningxia is an important agriculture-pastoral area in China. Research on the temporal and spatial variations of net primary productivity (NPP) in this area and its driving factors would help understand the trends and leading factors of NPP variations, and reveal vegetation restoration status and causes. Based on the NPP data of MODIS, we used Theil-Sen Median trend analysis, correlation analysis, overlay analysis and other methods to analyze the spatiotemporal variations and driving factors of NPP in Ningxia. The results showed that NPP of Ningxia vegetation showed a fluctuating upward trend during 2000-2019, with a linear growth rate of 5.46 g C·m -2 ·a -1 . The NPP presented a spatial characteristics of "two high and two low", with the highest in the southern mountain area, followed by the Yellow River irrigation area, and the lowest in the hilly area of the central arid zone and Helan Mountain. 84.2% of the NPP in the study area was under significant restoration, mainly distributed in the central and southern mountainous and hilly areas. The NPP varied significantly with altitude and was significantly affected by the terrain. NPP center of gravity had generally moved to the south, with the increase and growth rate of NPP of vegetation in the south being greater than that in the north. The annual precipitation in Ningxia had shown an increasing trend, while the average annual temperature had slightly decreased. The NPP was significantly affec-ted by precipitation ( R 2 =0.291), whereas the correlation between mean annual temperature and NPP was weak. 96.9% of the study area was at a state of vegetation restoration, which was promoted by both climate change and human activities.

From the deep-sea-derived Fusarium sp. ZEN-48, four known compounds were obtained. Their structures were established by extensive analyses of the NMR, HR-ESI-MS, and the X-ray crystallographic data as brefeldin A (BFA, 1), brevianamide F (2), N-acetyltryptamine (3), and (+)-diaporthin (4). Although BFA was extensively investigated for its potent bioactivities, its role on TNFα-induced necroptosis was incompletely understood. In this study, BFA showed significant inhibition on TNFα-induced necroptosis by disrupting the necrosome formation and suppressing the phosphorylation of RIPK3 and MLKL (IC 50 =0.5 μM). While, it had no effect on TNFα-induced NF-κB/MAPKs activation and apoptosis. The finding raised significant implications of BFA for necroptosis-related inflammatory disease therapy and new drug development from marine fungi., (© 2022 Wiley-VHCA AG, Zurich, Switzerland.)

Scientific irrigation is of great significance to plant seed production. With two excellent native plant species in desert steppe, Agropyron mongolicum and Lespedeza potaninii , as the objects, and full irrigation as the control, we explored the effects of deficit irrigation in different growth stages on the seed production and water use efficiency (WUE) of those two species. The results showed that, compared with the control, soil water content of both species decreased under deficit irrigation. The decrease of soil water content of A. mongolicum mainly occurred in the 0-60 cm soil layer, while there was no obvious stratification for the reduction of soil water content of L. potaninii . There were significant differences in the yield components of A. mongolica under deficit irrigation. The seed yield of deficit irrigation at the flowering stage was the highest. There were significant differences in the numbers of fertile tillers, florets and pods of L. potaninii among treatments, but no significant difference in seed yield. There were positive correlations between seed yield of A. mongolicum and the numbers of fertile tillers ( r =0.776) and spikelets ( r =0.717). The racemes of L. potaninii was significantly negatively correlated with the number of fertile tillers ( r =-0.685), and positively correlated with the number of florets ( r =0.412). Compared with full irrigation, water consumption of seed production of the two native plant species was reduced under deficit irrigation, but water use efficiency was improved, with the strongest improvement at the flowering stage of A. mongolicum (32.9%) and at the branching stage of L. potaninii (27.4%). Therefore, proper deficit irrigation could improve water use efficiency of both plant species. From the perspective of water use efficiency and seed yield, deficit irrigation could be used for artificial breeding of A. mongolicum and L. potaninii seeds in arid area, with the suitable growth stage for deficit being the flowering and the branching stages, respectively.

To enhance the fluorescence efficiency of semiconductor nanocrystal quantum dots (QDs), strategies via enhancing photo-absorption and eliminating non-radiative relaxation have been proposed. In this study, we demonstrate that fluorescence efficiency of molybdenum disulfide quantum dots (MoS 2 QDs) can be enhanced by single-atom metal (Au, Ag, Pt, Cu) modification. Four-fold enhancement of the fluorescence emission of MoS 2 QDs is observed with single-atom Au modification. The underlying mechanism is ascribed to the passivation of non-radiative surface states owing to the new defect energy level of Au in the forbidden band that can trap excess electrons in n-type MoS 2 , increasing the recombination probability of conduction band electrons with valence band holes of MoS 2 . Our results open an avenue for enhancing the fluorescence efficiency of QDs via the modification of atomically dispersed metals, and extend their scopes and potentials in a fundamental way for economic efficiency and stability of single-atom metals., (© 2022 Wiley-VCH GmbH.)

Background: Research into acupuncture and moxibustion and their application for chronic fatigue syndrome (CFS) has been growing, but the findings have been inconsistent., Objective: To evaluate the existing randomized clinical trials (RCTs), compare the efficacy of acupuncture, moxibustion and other traditional Chinese medicine (TCM) treatments., Data Sources: Three English-language databases (PubMed, Embase, Web of Science, and The Cochrane Library) and 4 Chinese-language biomedical databases (Chinese Biomedical Literature Database, VIP Database for Chinese Technical Periodicals, China National Knowledge Infrastructure, and Wanfang) were searched for RCTs published from database inception through August 2021., Study Selection: RCTs include acupuncture, moxibustion, traditional Chinese herbal medicine, western medicine and no control., Data Extraction and Synthesis: Data were screened and extracted independently using predesigned forms. The quality of RCTs was appraised with the Cochrane Collaboration risk of bias tool. We conducted a random-effects network meta-analysis within a frequentist framework. We assessed the certainty of evidence contributing to network estimates of the main outcomes with the Grading of Recommendations Assessment, Development and Evaluation (GRADE) framework., Main Outcomes and Measures: The primary outcomes were the overall response rate and FS-14 scale., Results: A total of 51 randomized controlled trials involving 3473 patients with CFS were included in this review. Forty one studies indicate low risk or unknown risk, and the GRADE scores of the combined results show low levels. Among the main indicators, traditional Chinese medicine therapies have excellent performance. However, the overall response rate is slightly different from the results obtained from the Fatigue Scale-14 total score. Moxibustion and traditional Chinese medicine (Odds ratios 48, 95% CrI 15-150) perform better in the total effective rate, while moxibustion plus acupuncture (MD 4.5, 95% CrI 3.0-5.9) is better in the FS-14 total score., Conclusions: The effect of acupuncture and moxibustion in the treatment of CFS was significantly higher than that of other treatments. Traditional Chinese medicine should be used more widely in the treatment of CFS., Competing Interests: The authors have no funding and conflicts of interests to disclose., (Copyright © 2022 the Author(s). Published by Wolters Kluwer Health, Inc.)

Plant functional traits is connected with vegetation adaptability to the environment. The trade-off between plant functional traits reflects resource reintegration and acquisition under grazing pressures. We summarized the differences of plant functional traits under grazing disturbance, focused on the linkages between grazing disturbance and plant functional traits. We introduced that the variation of plant functional traits resulted from the coordination between plant genetic characteristics and environmental filtration, summarized the effects of grazing on nutritional and reproductive traits, and noted that plants could use survival and reproductive strategies to adapt to the grazing disturbance. We mainly focused on the effects of grazing on plant population, community and ecosystem. The expression of plant functional traits was different under grazing disturbance. Therefore, plant functional traits could be used as indicators to explain population growth and reproduction, community assembly, and ecosystem function. In order to better serve the ecological environment of grassland with plant functional traits, reasonable grazing resis-tant species could be screened according to plant functional traits. Based on life history characteristics of grassland plant population, the scientific grazing mechanism should be formulated, and the responses of plant functional traits and resource allocation to grazing disturbance should be conducted from the perspective of individual-based level in the future.

Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph+ ALL) is triggered by breakpoint cluster region-abelson leukemia virus (BCR/ABL) kinase. Targeting BCR/ABL kinase with tyrosine kinase inhibitors combined with chemotherapy is the standard first-line therapy for Ph+ ALL. Imatinib and dasatinib are the preferred agents for the treatment of Ph+ ALL. Dasatinib treatment can induce a faster and deeper remission than imatinib treatment; however, the side effects of dasatinib, especially the cardiovascular side effects, are markedly greater than those of imatinib. Patients will benefit from treatments that improve the efficacy of imatinib without increasing its side effects. The present study revealed that tanshinone IIA markedly potentiated the cytotoxic and apoptotic induction effects of imatinib by regulating the AKT-MDM2-P53 signaling pathway and inhibiting the anti-apoptotic proteins BCL2 and MCL1 apoptosis regulator, BCL2 family member in Ph+ ALL cell lines. In vitro studies, MTT assay, flow cytometry, western blotting and reverse transcription-quantitative PCR were performed in the present study to detect cell viability, cell apoptosis, protein expression and gene expression, respectively. In a Ph+ ALL mouse model, imatinib combined with tanshinone IIA also exhibited a synergistic effect on the reduction in leukemia burden without increasing the toxic side effects of imatinib. These results demonstrated that imatinib combined with tanshinone IIA might be a promising treatment strategy for patients with Ph+ ALL., Competing Interests: The authors declare that they have no competing interests., (Copyright: © Guo et al.)

Lead (Pb) as a hazardous air pollutant has raised widespread concerns due to its adverse and toxic effects on the ecological environment and human health. Here we integrated the multi-regional input-output (MRIO) model and an atmospheric transport model to examine regional environmental inequality (REI) index induced by Pb emission transfers, and to evaluate the impacts of interprovincial trade on regional atmospheric Pb concentrations and dry deposition fluxes in China in 2012. In 2012, approximately 57.4% ~ 72.6% of Pb emissions in well-developed eastern regions (Beijing-Tianjin, Yangtze River Delta (YRD)) and the southern seaboard of China were embodied in other regions in China subject to the demands from these well-developed regions to industrial products and services. Our results, based on the net virtual flows of Pb emission and value-added, indicate that most provinces in the eastern seaboard of China outsource Pb emission and benefit from the interprovincial trade by reducing their Pb emissions. REI indexes show that the well-developed Guangdong province outsources its Pb emission but has low economic gains. Many less-developed provinces in central China enhance virtual Pb emission inflow but have high economic gains. Whereas, inland provinces in western China not only experience Pb emission increase, but also suffer from indirect economic loss due to trade with well-developed provinces to meet their increasing demands to Pb emission abundant industrial products from these provinces in eastern China which are mostly provided by less-developed but energy and mineral product abundant provinces in western China. For example, the province pair with highest REI index was Jiangsu-Inner Mongolia (REI = 2.47), which revealed that Jiangsu was the largest beneficiary which exported 37.2 t of net Pb emission and gained value-added of 521.4 billion RMB through trade with Inner Mongolia which suffered from both virtual Pb inflow and economic loss in 2012. As a result of interprovincial trade, Pb dry deposition in central and eastern China was decreased but increased in western China. Overall, interprovincial trade reduced 17.6% of atmospheric Pb dry deposition in China., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2021 Elsevier B.V. All rights reserved.)

As a member of the signal transducer and activator of transcription (STAT) family, STAT3 plays a critical role in several biological pathways such as cell proliferation, migration, survival, and differentiation. Due to abnormal continuous activation in tumors, inhibition of STAT3 has emerged as an attractive approach for the treatment of various cancer cells. Herein, we report a series of novel STAT3 inhibitors based on benzo[b]thiophene 1,1-dioxide scaffold and evaluated their anticancer potency. Among them, compound 8b exhibited the best activity against cancer cells. Compound 8b induced apoptosis and blocked the cell cycle. Meanwhile, 8b reduced intracellular ROS content and caused the loss of mitochondrial membrane potential. Further research revealed that 8b significantly blocked STAT3 phosphorylation and STAT3-dependent dual-luciferase reporter gene experiments showed that compound 8b has a marked inhibition of STAT3-mediated Firefly luciferase activity. Molecular modeling studies revealed compound 8b occupied the pocket well with the SH2 domain in a favorable conformation., (© 2021 John Wiley & Sons Ltd.)

Increasing evidence has shown that the resting state brain connectivity of default mode network (DMN) which are important for social cognition are disrupted in autism spectrum disorder (ASD). However, previous neuroimaging studies did not present consistent results. Therefore, we performed a meta-analysis of resting-state functional connectivity (rsFC) studies of DMN in the individuals with ASD and healthy controls (HCs) to provide a new perspective for investigating the pathophysiology of ASD. We carried out a search using the terms: ("ASD" OR "Autism") AND ("resting state" OR "rest") AND ("DMN" OR "default mode network") in PubMed, Web of Science and Embase to identify the researches published before January 2020. Ten resting state datasets including 203 patients and 208 HCs were included. Anisotropic Effect Size version of Signed Differential Mapping (AES-SDM) method was applied to identify group differences. In comparison with the HCs, the patients with ASD showed increased connectivity in cerebellum, right middle temporal gyrus, superior occipital gyrus, right supramarginal gyrus, supplementary motor area and putamen. Decreased connectivity was discovered in some nodes of DMN, such as medial prefrontal cortex, precuneus and angular gyrus. These results may help us to further clarify the neurobiological mechanisms in patients with ASD., (© 2021. The Author(s), under exclusive licence to Springer Science+Business Media, LLC part of Springer Nature.)

Renal tubular cell (RTC) death and inflammation contribute to the progression of obstructive nephropathy, but its underlying mechanisms have not been fully elucidated. Here, we showed that Gasdermin E (GSDME) expression level and GSDME-N domain generation determined the RTC fate response to TNFα under the condition of oxygen-glucose-serum deprivation. Deletion of Caspase-3 (Casp3) or Gsdme alleviated renal tubule damage and inflammation and finally prevented the development of hydronephrosis and kidney fibrosis after ureteral obstruction. Using bone marrow transplantation and cell type-specific Casp3 knockout mice, we demonstrated that Casp3/GSDME-mediated pyroptosis in renal parenchymal cells, but not in hematopoietic cells, played predominant roles in this process. We further showed that HMGB1 released from pyroptotic RTCs amplified inflammatory responses, which critically contributed to renal fibrogenesis. Specific deletion of Hmgb1 in RTCs alleviated caspase11 and IL-1β activation in macrophages. Collectively, our results uncovered that TNFα/Casp3/GSDME-mediated pyroptosis is responsible for the initiation of ureteral obstruction-induced renal tubule injury, which subsequentially contributes to the late-stage progression of hydronephrosis, inflammation, and fibrosis. This novel mechanism will provide valuable therapeutic insights for the treatment of obstructive nephropathy., (© 2021. The Author(s), under exclusive licence to ADMC Associazione Differenziamento e Morte Cellulare.)

Objective: To compare the efficacy and safety of different doses of daunorubicin combined with a standard dose of cytarabine as induction chemotherapy in newly diagnosed primary acute myeloid leukemia (AML) patients., Methods: The clinical data and outcome were retrospectively analyzed in 86 newly diagnosed primary AML patients who were under 65 years old and treated with daunorubicin combined with cytarabine (DA regimen) at West China Hospital of Sichuan University from January 2017 to June 2019. Patients were divided into 2 groups based on the dose of daunorubicin they received, 35 cases in the escalated-dose group ［75 mg/(m 2 ·d)］ and 51 cases in the standard-dose group ［60 mg/(m 2 ·d)］. And then the effects of different doses of daunorubicin on complete remission (CR) rate, minimal residual disease (MRD) - negative CR rate, relapse-free survival (RFS), overall survival (OS), and adverse events were analyzed., Results: Median follow-up time of all the patients was 15 months. The CR rate and MRD - CR rate of the escalated-dose group was 88.5% and 71.4%, respectively, which were higher than 64.7% and 41.2% of the standard-dose group (P=0.029, P=0.008). The estimated 2-year RFS of the escalated-dose group was 68.4%, which was higher than 38.5% of the standard-dose group (P=0.015), but estimated 2-year OS showed no statistically significant difference (77.1% vs 66.7%, P=0.059), as well as grade 3－4 adverse events. The escalated dose of daunorubicin had prolonged RFS (13 months vs not reached, P=0.022) and OS (23 months vs not reached, P=0.029) in the FLT3-ITD－ AML patients., Conclusion: The escalated dose of daunorubicin can induce higher complete remission rate, deeper remission and longer duration of remission without increasing adverse events in newly diagnosed primary AML patients.

Exploring the characteristics of soil seed bank under seasonal grazing plays an important role in the reasonable use of desert steppe. We examined seed bank species composition, density, vertical distribution, diversity in the soil of 0-5, 5-10, 10-15 cm soil layers and the relationship with vegetation and soil environmental factors in Ningxia desert steppe. The treatments included enclosure (FY), traditional time rotation grazing (FG), delayed to start rotation grazing (YG), early to end rotation grazing (TG), delayed to start and early to end rotation grazing (YT) and free grazing (ZY). The results showed that there were nine families and 21 species in the soil seed bank in the study area. The species composition of soil seed bank in TG seed bank with 13 species was the largest, while FY and ZY soil seed banks had the least, with 8 species, respectively. The den-sity of ZY soil seed bank was significantly higher than that of FY, YG, TG and YT. The number of perennial species seeds in the soil seed bank of FY was the largest, reaching 32.0%, while that in the ZY was the least, only 12.4%, mainly with sexually reproduced annual weeds. Soil seed bank was mainly concentrated in the 0-5 cm surface layer. With increasing soil depth, the size of soil seed bank decreased. The dominance and diversity of soil seed bank were the highest in FY, while the dominance, diversity and uniformity were the lowest in ZY. The similarity between soil seed bank and aboveground vegetation was generally low. In contrast, the FG and ZY seed banks had higher similarity with vegetation, and the FY was the lowest. Soil moisture, organic matter, total nitrogen concentration, total phosphorus concentration, and soil bulk density were the main soil factors affecting soil seed bank. Compared with traditional whole year free grazing, seasonal four-zone rotation grazing could increase species richness and abundance of perennial plants in soil seed bank of desert steppe, as well as the total species richness, diversity and uniformity of the seed bank. Although the effect sof seasonal four-zone rotation grazing on seed bank was not as good as the long-term enclosure grassland, it was of great significance to the utilization and protection of desert steppe.

Autism spectrum disorder (ASD) patients are often reported altered patterns of functional connectivity (FC) on resting-state functional magnetic resonance imaging (rsfMRI) scans. However, the results in similar brain regions were inconsistent. In this study, we first investigated statistical differences in large-scale resting-state networks (RSNs) on 192 healthy controls (HCs) and 103 ASD patients by using independent component analysis (ICA). Second, an image-based meta-analysis (IBMA) was applied to discover the consistency of spatial patterns from different sites. Last, utilizing these patterns as features, we used Support Vector Machine (SVM) classifier to identify whether a subject was suffering from ASD or not. As a result, six RSNs were obtained with ICA. In each RSN, we identified altered functional connectivity between ASD and HC across the multi-site data. We calculated the area under the receiver operating characteristic curve plots (AUC) to determine the classification performance. The AUC value of classification reaches 0.988. In conclusion, the present study indicates that intrinsic connectivity patterns produced from rsfMRI data could yield a possible biomarker of ASD and contributed to the neurobiology of ASD., (Copyright © 2021 Elsevier B.V. All rights reserved.)

The utility of endovascular thrombectomy for acute occlusion of the distal intracranial artery (A2/A3/M2/M3/P2/P3) is unclear, and aspiration and stent thrombectomy are associated with risk of bleeding. We analyzed patients with acute occlusion of the distal intracranial artery to assess the safety and efficacy of microcatheter-based tirofiban infusion.We retrospectively reviewed data of the endovascular thrombectomy registry of our center between January 2018 and June 2019. Patients with distal intracranial artery occlusion who underwent endovascular thrombectomy with microcatheter-based infusion of tirofiban were recruited.Of 13 patients included, 1 presented with anterior cerebral artery occlusion, 2 with posterior cerebral artery occlusion, 2 with posterior inferior cerebellar artery occlusion, and 7 with middle cerebral artery M2 occlusion. The mean National Institute of Health Stroke scale score was 10.1 (3-19). Three patients (23.1%) underwent bridging treatment of intravenous thrombolysis with recombinant plasminogen activator and endovascular thrombectomy. The arithmetic mean onset-to-recanalization time was 696.3 minutes (140-1440) and average operating time was 47.1 minutes (30-80). After treatment, 10 patients (76.9%) underwent revascularization. No operative complications were observed in any case. All patients underwent angiography and were reviewed 7 to 14 days after surgery. Imaging revealed significant improvements in recanalization compared with the immediate postoperative period, with no reoccurrence of occlusion. The mean modified Rankin scale score at the 3-month follow-up was 0.54 (0-2).Microcatheter-based infusion of bolus-dose tirofiban can result in safe and effective recanalization of acute occlusion of the distal artery in the case of a relatively light thrombotic load.

Introduction: Repetitive transcranial magnetic stimulation (rTMS) over the primary motor cortex (M1) can modulate brain activity both in the stimulated site and remote brain areas of the sensorimotor network. However, the modulatory effects of rTMS at different frequencies remain unclear. Here, we employed finger-tapping task-based fMRI to investigate alterations in activation of the sensorimotor network after the application of rTMS over the left M1 at different frequencies., Materials and Methods: Forty-five right-handed healthy participants were randomly divided into three groups by rTMS frequency (HF, high-frequency, 3 Hz; LF, low-frequency, 1 Hz; and SHAM) and underwent two task-fMRI sessions (RH, finger-tapping with right index finger; LH, finger-tapping with left index finger) before and after applying rTMS over the left M1. We defined regions of interest (ROIs) in the sensorimotor network based on group-level activation maps (pre-rTMS) from RH and LH tasks and calculated the percentage signal change (PSC) for each ROI. We then assessed the differences of PSC within HF or LF groups and between groups., Results: Application of rTMS at different frequencies resulted in a change in activation of several areas of the sensorimotor network. We observed the increased PSC in M1 after high-frequency stimulation, while we detected the reduced PSC in the primary sensory cortex (S1), ventral premotor cortex (PMv), supplementary motor cortex (SMA), and putamen after low-frequency stimulation. Moreover, the PSC in the SMA, dorsal premotor cortex (PMd), and putamen in the HF group was higher than in the LF group after stimulation., Conclusion: Our findings suggested that activation alterations within sensorimotor network are dependent on the frequency of rTMS. Therefore, our findings contribute to understanding the effects of rTMS on brain activation in healthy individuals and ultimately may further help to suggest mechanisms of how rTMS could be employed as a therapeutic tool., (© 2020 The Authors. Brain and Behavior published by Wiley Periodicals LLC.)

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir 2 (dfppy) 4 (imiphenH)]PF 6 ( 1 ·PF 6 , PF 6 - = hexafluorophosphate) in which two {Ir(dfppy) 2 } + units are bridged by an imiphenH - ligand. The ECL intensity from complex 1 ·PF 6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3 ·PF 6 , respectively. Theoretical calculation reveals that the S 0 to S 1 excitation is a local excitation in 1 ·PF 6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1 ·PF 6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Fencing for grazing exclusion has been widely found to have an impact on grassland soil organic carbon (SOC) and total nitrogen (TN), but little is known about the impact of fenced grassland on the changes in deep soil carbon (C) and nitrogen (N) stocks in temperate grasslands. We studied the influence of 30 years fencing on vegetation and deep soil characteristics (0-500 cm) in the semi-arid grasslands of northern China. The results showed that fencing significantly increased the aboveground biomass (AGB), litter biomass (LB), total biomass, vegetation coverage and height, and soil water content and the SOC and TN in the deep soil. The belowground biomass (BGB) did not significantly differ between the fenced and grazed grassland. However, fencing significantly decreased the root/shoot ratio, forbs biomass, pH, and soil bulk density. Meanwhile, fencing has significantly increased the C and N stocks in the AGB and LB but not in the BGB. After 30 years of fencing, the C and N stocks significantly increased in the 0-500 cm soil layer. The accumulation of SOC mainly occurred in the deep layers (30-180 cm), and the accumulation of TN occurred in the soil layers of 0 to 60 cm and 160 to 500 cm. Our results indicate that fencing is an effective way to improve deep soil C and N stocks in temperate grassland of northwest China. There were large C and N stocks in the soil layers of 100 to 500 cm in the fenced grasslands, and their dynamics should not be ignored.

Reasonable rotation is of great significance to grassland management. We examined the distribution characteristics, stability, organic carbon content and contribution rate of 0-30 cm soil aggregates in the forbidding grazing, continuous grazing, and rotation in the two-paddock, four-paddock and six-paddock rotational districts in a desert steppe in Ningxia. The results showed that except for the forbidding grazing grassland that was dominated by mechanically stable large aggrega-tes, other water-stable aggregates were mainly composed of microaggregates. Increasing the rotational grazing zoning was conducive to maintain the content of water-stable aggregates in the surface soil and increase the content of large aggregates. The mechanical stability aggregate fractal dimension was the largest in continuous grazing, increased the fractal dimension of the rotation and shepherd partition to reduce the trend, but the fractal dimension of water-stable aggregates did not change. The average weight diameter (MWD) and geometric mean diameter (GMD) of the aggregates were the largest in the pastoral grassland and increased with the increases of the rotational grassland partition. MWD and GMD were negatively correlated with the microaggregate content. The organic carbon content in water-stable large aggregate was higher in the six-paddock rotational district and forbidding grazing, and the two-paddock rotational grazing and continuous grazing were lower. The contribution rate of micro-aggregates organic carbon to soil organic carbon content was higher in this region. In the 0-20 cm soil layer, the contribution rate of organic carbon in large aggregates increased with the increases of rotation. Considering the characteristics of soil aggregates and their organic carbon, the rotation of six-paddock was the most suitable method for rotational grazing in the desert steppe of the study area.

In an effort to provide visualization and understanding to the electronic "push effect" of axial ligands on the catalytic activity of cobalt macrocyclic molecules, we design a simple model system involving an [5,10,15,20-tetrakis(4-methoxyphenyl)porphyrin]cobalt(II) (TMMPCo) monolayer axially-coordinated on thiol ligand modified Au electrode and explore the activity of the axial-ligand coordinated TMPPCo toward oxygen reduction reaction (ORR) in acidic medium. Three different ligands, with a decreasing order of coordinating ability as: 4-mercaptopyridine (MPy) > 4-aminothiolphenol (APT) > 4-mercaptobenzonitrile (MBN) are used and a maximum difference in ORR onset potential of 80 mV is observed between the MPy (highest onset potential) and MBN systems (lowest onset potential). The ORR activity of TMPPCo increases with the increase in binding strength of the axial ligand. A detailed mechanism study reveals that ORR on the three ligand coordinated TMPPCo systems shares the same 2-electron mechanism with H 2 O 2 as the terminal product. Theoretical calculation into the structure of the ligand coordinated cobalt porphyrins uncovers the variation in atomic charge of the Co(II) center and altered frontier molecular orbital distribution among the three ligand systems. Both properties have great influence on the back-bonding formation between the Co(II) center and O 2 molecules, which has been suggested to be critical toward the O 2 adsorption and subsequent activation process., (Copyright © 2019 Science China Press. Published by Elsevier B.V. All rights reserved.)

Radiotherapy for liver cancer can affect the level of autophagy in cells, and effective autophagy regulation can increase the radiosensitivity of liver cancer cells.Saikosaponin-d (SSd) is an effective active ingredient extracted from traditional Chinese medicine Bupleurum. We have confirmed previously in vitro and in vitro experiments that SSd can significantly induce apoptosis of liver cancer cells, increase the radiosensitivity of liver cancer cells.This study explored the role of autophagy in SSd-mediated radiosensitivity of liver cancer cells. MTT and clone formation experiments showed that radiation can inhibit the proliferation of hepatoma cells and reduce the colony formation of hepatoma cells. After the addition of SSd, the inhibitory effect of radiation on the proliferation and clonal formation of hepatoma cells was further enhanced. However, the addition of the autophagy inhibitor chloroquine or mTOR agonist can partially reverse the inhibitory effect of the combined treatment of SSd with radiation on the proliferation of hepatoma cells. Similarly, transmission electron microscopy and laser confocal microscopy showed that after the addition of SSd, the number of radiation-induced autophagosomes increased significantly in hepatoma cells and the intervention of mTOR agonist can reduce the formation of autophagosomes in hepatoma cells.In addition,Western blot analysis presented that radiation significantly increased LC3-II levels. Especially when SSd is added, LC3-II levels is further increased. Our data indicate that SSd can inhibit the growth of liver cancer cells and enhance cell radiosensitivity by inducing autophagy formation., Competing Interests: Competing Interests: The authors have declared that no competing interest exists., (© The author(s).)

P53 dysfunction has been associated with various malignant tumors, including acute leukemia. The overexpression of mouse double minute 2 (MDM2) causes the inactivation of p53 in acute leukemia. MDM2 inhibitors that activate p53 and induce apoptosis are currently being developed for potential treatment of acute leukemia. However, MDM2 inhibitors alone have limited efficacy in acute leukemia therapeutics. Combining other drugs to enhance the efficacy of MDM2 inhibitors is the thus considered as a potential treatment scheme. Here, we report that the combination of Nutlin-3 and Tanshinone IIA synergistically induces cytotoxicity, cell cycle arrest, apoptosis, and autophagic cell death, thereby imparting anti-leukemia effect in an acute leukemia cell line with wild-type p53 by effectively activating p53, inhibiting the AKT/mTOR pathway, and activating the RAF/MEK pathway. Using primary samples from acute leukemia patients, we show that the combination of Nutlin-3 plus Tanshinone IIA synergistically induces cytotoxicity by activating p53 and inhibiting the AKT/mTOR pathway. This specific combination of Nutlin-3 and Tanshinone IIA is also effective in preventing the recurrence of refractory leukemia, such as Ph+ ALL with the ABL kinase T315I mutation and AML with the FLT3-ITD mutation. Taken together, the results of this study demonstrate that the Nutlin-3 plus Tanshinone IIA combination exerts synergistic anti-leukemia effects by regulating the p53 and AKT/mTOR pathways, although further investigation is warranted. Small-molecule MDM2 antagonists plus Tanshinone IIA may thus be a promising strategy for the treatment of acute leukemia., (Copyright © 2018 Elsevier Ltd. All rights reserved.)

Circular RNAs (circRNAs) are key regulators in the development and progression of human cancers, however its role in cervical cancer tumorigenesis is not well understood. The present study aims to investigate the expression profiles and potential modulation of circRNA on cervical cancer carcinogenesis. Human circRNA microarray was performed to screen for abnormally expressed circRNA in cervical cancer cells and circRNA-000284 was identified as one circRNA significantly upregulated in cervical cancer cells. Subsequent mechanistic investigations suggested that knockdown of circRNA-000284 suppressed cell proliferation and invasion, and caused G0/G1 phase cell cycle arrest. By performing anti-AGO2 RNA precipitation and luciferase reporter assay, we identified miR-506 as the circRNA-000284-associated miRNA. Furthermore, Snail-2 was identified as a direct target of miR-506, and circRNA-000284 could positively regulate the expression of Snail-2. Finally, the tumor promoting effect of circRNA-000284 was abolished by co-expression of miR-506 mimics or Snail-2 silencing vector. In conclusion, circRNA-000284 promotes cell proliferation and invasion in cervical cancer, and may serve as a promising therapeutic target for cervical cancer patients. Therefore, silence of circRNA-000284 could be a future direction to develop a novel treatment strategy., Competing Interests: None.

Background and Objectives: Obesity is linked to metabolic diseases characterized by insulin resistance, such as diabetes and cardiovascular disease. In this study, we investigated the metabolic disorders of uncomplicated obesity to identify early alterations in biological systems., Methods and Study Design: Metabolic differences between overweight/obese (n=36) and normal-weight (n=35) young Chinese men without known metabolic disorders were assessed. Metabolic profiling of the serum and urine was performed using ultra-performance liquidchromatography quadrupole-time-of-flight mass spectrometry (UPLC-Q-TOF-MS). Partial least squares discriminant analysis (PLS-DA) was undertaken to reveal and classify the differences between the two groups., Results: Compared to normal-weight men, obese men had higher levels of the serum metabolites phenylalanine, Phe-Phe, and L-tryptophan, whereas those of p-cresol sulfate and p-cresol were less in obesity. Urinary metabolites phenylacetamide, L-glutamine, phenylacetylglutamine, indoxyl sulfate, p-cresol, and p-cresol sulfate were greater in obese men., Conclusions: These findings indicate that disorders involving aromatic amino acids and the tricarboxylic acid cycle (TCA) have microbiomic involvement in the uncomplicated phase of obesity.

Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph+ ALL) is triggered by BCR/ABL kinase. Recent efforts focused on the development of more potent tyrosine kinase inhibitors (TKIs) that also inhibit mutant tyrosine kinases such as nilotinib and dasatinib. Although major advances in the treatment of this aggressive disease with potent inhibitors of the BCR/ABL kinases, patients in remission frequently relapse due to drug resistance possibly mediated, at least in part, by compensatory activation of growth-signaling pathways and protective feedback signaling of leukemia cells in response to TKI treatment. Continuous activation of AKT/mTOR signaling and inactivation of p53 pathway were two mechanisms of TKI resistance. Here, we reported that nutlin-3 plus tanshinone IIA significantly potentiated the cytotoxic and apoptotic induction effects of imatinib by down-regulation of the AKT/mTOR pathway and reactivating the p53 pathway deeply in Ph+ ALL cell line. In primary samples from Ph+ ALL patients, nutlin-3 plus tanshinone IIA also exhibited synergetic cytotoxic effects with imatinib. Of note, three samples from Ph+ ALL patients harboring T315I mutation also showed sensitivity to the combined treatment of imatinib, nutlin-3 plus tanshinone IIA. In Ph+ ALL mouse models, imatinib combined with nutlin-3 plus tanshinone IIA also exhibited synergetic effects on reduction in leukemia burden. These results demonstrated that nutlin-3 plus tanshinone IIA combined TKI might be a promising treatment strategy for Ph+ ALL patients., (© 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.)

Cisplatin is a chemotherapeutic drug for treatment of many solid tumors. It has been shown to induce apoptosis and/or necrosis in different types of cancer cells. However, the underlying mechanisms remain elusive. In this study, we provide evidences that cisplatin induces necroptosis in receptor-interacting protein 3 (RIP3)-expressing cell lines, but not in cell lines lacking RIP3 protein expression. Deficiency of core components of necroptotic pathway, RIP1, RIP3, or mixed lineage kinase domain-like protein (MLKL) blocked cisplatin-induced cell death in L929 cells. This phenomenon is dependent on RIP1/RIP3/MLKL necrosome formation and translocation to mitochondria-associated membrane (MAM), but only partially via autocrine production of tumor necrosis factor α (TNFα). Moreover, we demonstrate that the mitochondrial permeability transition pore opening (mPTP) opening and reactive oxygen species (ROS) generation is a critical downstream event of the formation of necrosome in cisplatin-induced necroptosis, which is TNFα independent. Deficiency of cyclophilin-D (CypD) partially reduced cisplatin-induced cell death, indicating CypD mediated-mPTP opening plays an important role during cisplatin-induced necroptosis. Both deletion of CypD and TNFα completely blocked cisplatin-induced cell death, suggesting that cisplatin could induce necroptosis through TNFα dependent and independent pathway. These findings provide new insight into the molecular mechanisms underlying cisplatin-induced necroptosis., (Copyright © 2017 Elsevier Inc. All rights reserved.)

Objective: To investigate the anti-prostate cancer (PCa) effect of roemerine in vitro and in vivo in the mouse model of PCa., Methods: We detected the effects of roemerine on the proliferation, apoptosis and migration of PCa cells DU145, LNCaP, PC-3 and 22RV1, screened out the sensitive cell line and constructed a tumor-bearing model in mice for verification of the antitumor efficacy of roemerine in vivo., Results: Roemerine inhibited the proliferation and migration of the DU145, LNCaP, PC-3 and 22RV1 cells and induced their apoptosis in different degrees, particularly those of the LNCaP cells. The average tumor weight was less in the roemerine intervention group (［1.99±0.95］ g) than in the control (［2.95±1.04］ g), the least in the high-dose roemerine (30 mg/kg) plus paclitaxel intervention group (［0.90±0.16］ g). The mean heart, liver, and kidney indexes were markedly lower in the roemerine (0.58±0.06, 6.20±0.42 and 1.49±0.33) than in the paclitaxel group (0.66±0.04, 6.99±0.72 and 1.95±0.34), while the mean spleen and thymus indexes were remarkably higher in the former (0.54±0.11 and 0.06±0.01) than in the latter (0.41±0.09 and 0.05±0.01). Pathological staining showed a lower degree of malignancy and metastasis in both the roemerine and the roemerine + paclitaxel intervention group than in the control, as well as a lower degree of visceral injury in the roemerine and roemerine + paclitaxel groups than in the paclitaxel group., Conclusions: Roemerine has some anti-PCa effect and alleviates adverse reactions in paclitaxel combination administration.

microRNAs (miRNAs) act as a major regulator of acquired chemo-resistance in various types of cancer therapeutics. This study investigated the contribution of miRNAs in influencing multiple drug resistance in esophageal squamous cell carcinoma (ESCC). The sensitivity of four ESCC cell lines (EC109, EC9706, TE-1 and KYSE-150) to 5-fluorouracil (5-FU) and oxaliplatin (OX) was determined by MTT assay. A 5-FU and OX-resistant subline, EC9706R, was established by continuous exposure to stepwise increasing concentration of 5-FU and OX. Microarray technology was used to compare the differential expression of miRNAs between resistant cells and parental cells. Chemo-sensitivity assay was performed to evaluate drug response in EC9706R cells transfected with miRNA mimic or inhibitor. The direct targets of miRNA were identified by employing pathway analysis and then confirmed with luciferase assay. Sixty ESCC tissue samples and their paired adjacent normal tissues were collected to validate the expression of identified miRNA. Mouse models were further utilized to investigate the function of miRNA on acquired chemo-resistance. MicroRNA panel results indicated that a total of 12 miRNAs were differentially expressed and miR-141-3p was highly over expressed in resistant cells. Inhibition of miR-141-3p reversed acquired chemo-resistance in EC9706R cells by stimulating apoptosis. The expression of miR-141-3p was significantly increased in ESCC tissue samples compared to their matched distant normal tissues. In addition, the elevated miR-141-3p expression was found to be associated with ESCC differentiation status and TNM stage. Moreover, Phosphatase and tensin homolog (PTEN) was identified as direct target of miR-141-3p. Western blot exhibited altered protein levels of PTEN, Akt, and PI3k with miR-141-3p inhibitor. An inverse correlation between PTEN expression and miR-141-3p expression was also observed in tissue samples. EC9706R xenograft mouse model became sensitized to 5-FU and OX treatment following miR-141-3p inhibitor transfection in vivo. Our study demonstrated that miR-141-3p contributed to an acquired chemo-resistance through PTEN modulation both in vitro and in vivo.

Objective: To evaluate the efficacy of gemcitabine, asparaginase , ifosfamide, dexamethasone and etoposide (GLIDE) combination for patients with newly diagnosed advanced-stage or relapsed/refractory extranodal natural killer cell lymphoma (ENKL). Methods: Fourty-two newly diagnosed advanced-stage or relapsed/refractory ENKL were enrolled from March 2010 to March 2016. Patients were treated with GLIDE for median 3 (2-6) cycles. Complete response (CR) rate, early CR (after 2 cycles) rate were evaluated after all treatment finished. Progression free survival (PFS) and overall survival (OS) were analyzed by Kaplan-Meier method and multivariate by Cox proportional hazards models. Results: Thirty-one (73.8%) patients achieved CR with 22 (52.4%) in early CR after 2 cycles of GLIDE, and 14 underwent autologous stem cell transplantation (ASCT) after achieved CR. One year PFS and OS were 65.6% and 82.7%, 4 year PFS and OS were 48.2% and 63.1%, respectively, with a median PFS of 30.5 months. Multivariate analysis indicated ECOG score 0-1 and ASCT after CR were independent prognostic factors for less relapse and longer survival. Conclusion: GLIDE is an effective regiment for newly diagnosed advanced-stage and relapsed/refractory ENKL.

Although radiation resistance is a common challenge in the clinical treatment of esophageal squamous cell carcinoma (ESCC), an effective treatment strategy has yet to be developed. Aberrant expression of microRNAs (miRNAs) is responsible for cancer sensitivity to radiation. In this study, we aimed to identify the miRNAs that are associated with radioresistance in ESCC. We used a miRNA microarray to perform a comparison of miRNA expression in both ESCC parental and acquired radioresistance cell lines. qRT-PCR was used to confirm the alterations. Cell radiosensitivity was determined with a survival fraction assay. Functional analyses of the identified miRNA in ESCC cells with regard to metastasis and apoptosis were performed by transwell assays and flow cytometry. The miRNA targets were identified with pathway analysis and confirmed with a luciferase assay. miR-98 was recognized as the most downregulated miRNA in established radioresistant cell line. AmiR-98 mimic enforced the expression of miRNA-98 and made ESCC cells sensitive to radiotherapy, while anti-miR-98 reversed this process. Optimal results were achieved by decreasing cellular proliferation, decreasing cell migration and inducing apoptosis. The luciferase target gene analysis results showed that the overexpression of miRNA-98 inhibited tumor growth and resistance tolerance by directly binding to the BCL-2 gene. Our study indicated that increasing miRNA-98 expression can be used as a potential radiosensitive therapeutic strategy for treating esophageal cancer cells., (© The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.)

The aims of the present study were to investigate the effect of overexpressed exogenous glutathione S-transferase π 1 ( GSTP1 ) gene on the radiosensitivity of the HeLa human cervical cancer cell line and conduct a preliminarily investigation into the underlying mechanisms of the effect. The full-length sequence of human GSTP1 was obtained by performing a polymerase chain reaction (PCR) using primers based on the GenBank sequence of GSTP1. Subsequently, the gene was cloned into a recombinant eukaryotic expression plasmid, and the resulting construct was confirmed by restriction analysis and DNA sequencing. A HeLa cell line that was stably expressing high levels of GSTP1 was obtained through stable transfection of the constructed plasmids using lipofectamine and screening for G418 resistance, as demonstrated by reverse transcription-PCR. Using the transfected HeLa cells, a colony formation assay was conducted to detect the influence of GSTP1 overexpression on the cell radiosensitivity. Furthermore, flow cytometry was used to investigate the effect of GSTP1 overexpression on cell cycle progression, with the protein expression levels of the cell cycle regulating factor cyclin B1 detected using western blot analysis. Colony formation and G 2 /M phase arrest in the GSTP1 -expressing cells were significantly increased compared with the control group (P<0.01). In addition, the expression of cyclin B1 was significantly reduced in the GSTP1 -expressing cells. These results demonstrated that increased expression of GSTP1 inhibits radiosensitivity in HeLa cells. The mechanism underlying this effect may be associated with the ability of the GSTP1 protein to reduce cyclin B1 expression, resulting in significant G 2 /M phase arrest.