Search

Your search keyword '"Ma, Hai-bo"' showing total 31 results
Start Over Author "Ma, Hai-bo"
31 results on '"Ma, Hai-bo"'

8. Real-time water wave simulation algorithm by polynomial function

Author

王志强 Wang Zhi-qiang and 马海波 Ma Hai-bo

Subjects
Polynomial, Polynomial and rational function modeling, Simulation algorithm, Mathematical analysis, Applied mathematics, Function (mathematics), Atomic and Molecular Physics, and Optics, Electronic, Optical and Magnetic Materials, Wilkinson's polynomial, Mathematics
Published
2017

9. Evaluating first-order molecular properties of delocalized ionic or excited states in molecular aggregates by renormalized excitonic method†.

Author

Liu, Yun-hao, Wang, Ke, and Ma, Hai-bo

Subjects
RENORMALIZATION group, WAVE functions, EXCITED states, MOLECULAR dynamics, HAMILTONIAN systems
Abstract

In the past few years, the renormalized excitonic model (REM) approach was developed as an efficient low-scaling ab initio excited state method, which assumes the low-lying excited states of the whole system are a linear combination of various single monomer excitations and utilizes the effective Hamiltonian theory to derive their couplings. In this work, we further extend the REM calculations for the evaluations of first-order molecular properties (e.g. charge population and transition dipole moment) of delocalized ionic or excited states in molecular aggregates, through generalizing the effective Hamiltonian theory to effective operator representation. Results from the test calculations for four different kinds of one dimensional (1D) molecular aggregates (ammonia, formaldehyde, ethylene and pyrrole) indicate that our new scheme can efficiently describe not only the energies but also wavefunction properties of the low-lying delocalized electronic states in large systems. [ABSTRACT FROM AUTHOR]

Published
2021
Full Text
View/download PDF

13. Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect

Author

Gao, Tai-Bao, Zhang, Jing-Jing, Wen, Jing, Yang, Xue-Xiao, Ma, Hai-bo, Cao, Deng-Ke, and Jiang, Dechen

Abstract

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6(1·PF6, PF6–= hexafluorophosphate) in which two {Ir(dfppy)2}+units are bridged by an imiphenH–ligand. The ECL intensity from complex 1·PF6is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2and 3·PF6, respectively. Theoretical calculation reveals that the S0to S1excitation is a local excitation in 1·PF6with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Published
2020
Full Text
View/download PDF

31. [Structures of leucogen and its related substances in solution state].

Author

Zheng XW, Qian W, Hang TJ, Ma HB, and Zhang ZX

Subjects
Chromatography, Liquid, Magnetic Resonance Spectroscopy, Molecular Structure, Solutions, Spectrometry, Mass, Electrospray Ionization, Stereoisomerism, Thiazolidines analysis, Quantum Theory, Thiazolidines chemistry
Abstract

Aim: To study the four diastereomers of leucogen and structure of the related substances., Methods: LC-DAD, LC-MS/MS and LC- 1H NMR were used. LC was carried out with a Phenomnex Luna C18 (250 mm x 4.60 mm ID, 5 microm) column and a mobile phase of water-acetonitrile-glacial acetic acid (58:42: 0.3)., Results: The structures of leucogen and its related substances were identified. Leucogen and the related substances were found to have four diastereomers in solution state separately. The stability and transformation of the four diastereomers were analyzed and 3R4S5R was found to be more stable than the others according to quantum calculations., Conclusion: Leucogen have four diastereomers in solution state and it can transform from one diastereomer to the others, and the 3R4S5R is more stable than the others.

Published
2006

Catalog

Books, media, physical & digital resources
See catalog results