Search

The house fly, Musca domestica L., is a significant human and livestock pest. Experiments used female adult house flies glued onto toothpicks for controlled exposure of their tarsi alone (tarsal assay) or their tarsi and proboscis (proboscis assay) with a sucrose solution containing imidacloprid at either a low (10 µg/mL) or high (4000 µg/mL) concentration. Proboscis extension response (PER) assays were used to characterize the response of imidacloprid-susceptible and behaviorally resistant house fly strains to contact with sucrose solutions containing either a low or high concentration of imidacloprid. In each assay, 150 female flies from each fly strain were individually exposed to sucrose solutions containing either a low or high concentration of imidacloprid by deliberate contact of the fly tarsi to the test solution. The PER for each fly was subsequently recorded at 0, 2, and 10 s following the initial tarsal contact. A significant and rapid reduction in PER was observed only for the behaviorally resistant fly strain and only following contact by the flies proboscis with the sucrose solution containing the high imidacloprid concentration. The results suggest that chemoreceptors on the fly labellum or internally on the pharyngeal taste organs are involved in the detection of imidacloprid and discrimination of the concentration, resulting in an avoidance behavior (proboscis retraction) only when imidacloprid is at sufficient concentration. Further research is needed to identify the specific receptor(s) responsible for imidacloprid detection.

Some insect species have been proposed as a sustainable alternative to traditional animal‐based food and feed sources. Optimisation of insect production can generally be achieved using two main approaches: optimising environmental conditions and improving traits of interest through selective breeding. These avenues are not inseparable as performance of a genotype might differ between environments due to phenotypic plasticity and because genotypes can respond differently to environmental changes, that is genotype‐by‐environment interactions (G × E). In insect production, diets can be of variable quality and consist of waste‐ and by‐products of low nutritional value, which might result in decreased performance and/or increased trait variability within a population. Therefore, it is of interest to investigate how genotypes perform across various diets. Here, we investigated plasticity and G × E for mean performance and trait variation, which we define as the ability of a genotype to produce consistent phenotypes within and across environments. We did this by rearing 190 full‐sib families of house fly larvae, Musca domestica L. (Diptera: Muscidae), on two diets based on either alfalfa, Medicago sativa L. (Fabales: Fabaceae), or deproteinated grass. Four larval traits were assessed: egg‐to‐larva viability, surface area, dry weight and relative lipid content. Reaction norms were used to investigate the effects of diet on full‐sib family mean and trait variation within and across environments. We found that families reared on the grass‐based diet had higher performance across all investigated traits than families reared on the alfalfa‐based diet. For both mean performance and trait variation, we found G × E for all investigated traits. These findings suggest that there is genetic variation for plasticity (slope of reaction norms) for both trait mean and trait variation, and thus that there is a potential to breed for genotypes with high performance as well as for genotypes with low trait variation within and across diets. [ABSTRACT FROM AUTHOR]

Predation exerts a profound influence on the evolution of camouflage and detection abilities in both predators and prey. For instance, flower‐visiting spiders need to ensure their concealment when ambushing on flowers, which compels pollinators to check any spider cues cautiously before landing. Although numerous studies have examined the visual camouflage of spiders deceiving bees, little is known regarding whether spiders also employ olfactory camouflage. Additionally, the detection of spiders by dipteran insects is often overlooked, despite them being major non‐bee pollinators. Here, we explored the detection ability of dipteran pollinators and the crypsis skill of spiders from both olfactory and vision perspectives using the housefly Musca domestica L. (Diptera: Muscidae) as prey, the crab spider Ebrechtella tricuspidata (Fabricius) (Araneae: Thomisidae) as predators and chamomile Matricaria recutita L. (Asteraceae) as substrates. Our olfactory experiments revealed that experienced houseflies could respond to and avoid spider odour. However, this response did not appear to be innate, as naive individuals showed no aversion. Moreover, experienced houseflies did not have any avoidance behaviours to the mixed odours of spider and flower, indicating that spiders achieved olfactory crypsis utilizing floral scent. Our vision experiments and visual modelling demonstrated that houseflies could detect spiders positioned on flower. Surprisingly, instead of avoiding them, houseflies exhibited a preference for flowers occupied by female spiders, suggesting the attractive nature of female spider colouration. This paper provides evidence for the first time that crab spiders use floral scent to achieve olfactory crypsis and proposes a potential yellow‐signalling mechanism for crab spiders to attract insects. [ABSTRACT FROM AUTHOR]

Background: Single-domain von Willebrand factor type C (SVWC) constitute a protein family predominantly identified in arthropods, characterized by a SVWC domain and involved in diverse physiological processes such as host defense, stress resistance, and nutrient metabolism. Nevertheless, the physiological mechanisms underlying these functions remain inadequately comprehended. Results: A massive expansion of the SVWC gene family in Musca domestica (MdSVWC) was discovered, with a count of 35. MdSVWC1 was selected as the representative of the SVWC family for functional analysis, which led to the identification of the immune function of MdSVWC1 as a novel pattern recognition receptor. MdSVWC1 is highly expressed in both the fat body and intestines and displays acute induction upon bacterial infection. Recombinant MdSVWC1 binds to surfaces of both bacteria and yeast through the recognition of multiple pathogen-associated molecular patterns and exhibits Ca2+-dependent agglutination activity. MdSVWC1 mutant flies exhibited elevated mortality and hindered bacterial elimination following bacterial infection as a result of reduced hemocyte phagocytic capability and weakened expression of antimicrobial peptide (AMP) genes. In contrast, administration of recombinant MdSVWC1 provided protection to flies from bacterial challenges by promoting phagocytosis and AMP genes expression, thereby preventing bacterial colonization. MdSPN16, a serine protease inhibitor, was identified as a target protein of MdSVWC1. It was postulated that the interaction of MdSVWC1 with MdSPN16 would result in the activation of an extracellular proteolytic cascade, which would then initiate the Toll signaling pathway and facilitate the expression of AMP genes. Conclusions: MdSVWC1 displays activity as a soluble pattern recognition receptor that regulates cellular and humoral immunity by recognizing microbial components and facilitating host defense. [ABSTRACT FROM AUTHOR]

Background/Objective: Fungi that infect insects constitute a very large and diverse group, with approximately 1600 diagnosed and known species belonging to 90 genera, and The fungi have developed their capabilities and ability to infect insects and in different strains, the house fly Musca domestica L. (Diptera: Muscidae), has great medical importance due to its ability to transmit thousands of pathogenic microorganisms such as parasites, fungi, bacteria and viruses. Methods/Statistical analysis: This study was conducted in the insect laboratory at the Faculty of Education for Girls / Anbar University with the aim of isolating and characterizing the most important Entomopathogenic Fungi and evaluating their efficiency on the house fly Musca domestica L. (Diptera: Muscidae). House fly adults were collected and raised in the laboratory, approximately 50 adult house fly insects were collected and treated at three concentrations for seven days in two ways: mixing with food and direct spraying on insects from the suspension [spores] of the fungi Metarhizium anisopliae and Trichoderma harzianum that were isolated from the Zira'a area of Ramadi city. Findings: the results of isolation and diagnosis of fungi showed the registration of the two fungi M. anisopliae and Trichoderma harzianum and their diagnosis was confirmed. (ID: PP035895 and ID: PP065519). The results also showed that there were significant differences between the concentrations used in the experiment, and the percentage of mortality in insects was directly proportional to the increase in the suspension of fungal spores, as the concentration of 1 X 107 spores/ml showed the highest percentage of mortality in the house fly in both methods [direct spraying method and mixing with food], as the percentage of mortality in the direct spraying method from the fungus M. Anisopliae and after a period of 7 days, the percentage of mortality was 85.7% and the percentage of mortality of the same organism by mixing with food was 66.6%, while the same concentration (1 x 107 spores/mL) with the spore suspension of T. harzianum by mixing with food was mortality rate of 85.7% and gave 100% mortality with the direct spraying method after 7 days. The results also revealed that T. harzianum spore suspension at all concentrations used in the experiment showed a higher percentage of lethality than M. anisopliae. Conclusion: The study found that molecular diagnosis is indispensable in the diagnosis of microorganisms, especially fungi because they share many phenotypic and even microscopic characteristics, and the study showed the sensitivity of house fly adults to the spore suspension of the studied fungi, and the study showed the superiority of the fungus T. harzianum in increasing the percentage of mortality compared to M. anisopliae. [ABSTRACT FROM AUTHOR]

Simple Summary: House flies are important carriers of diseases and can cause economic losses in livestock by reducing feeding activity. Overuse of chemical insecticides has led to resistance in many house fly populations worldwide. This study aimed to assess how two house fly populations in Antalya, Türkiye respond to the insecticides cyfluthrin and etofenprox. By exposing adult flies to these chemicals, the researcher found that the Kemer population showed very low resistance to cyfluthrin, while the Serik population exhibited moderate resistance. For etofenprox, Kemer flies showed no resistance, and Serik flies showed very low resistance. The findings suggest that integrated pest control methods and regular resistance monitoring are necessary to manage and prevent further resistance in house fly populations. The house fly, Musca domestica L. (Diptera: Muscidae), is a significant vector for many pathogens and parasites. Presence of this vector causes economic losses due to decreased feeding activity in livestock, resulting in reduced yields of products. The repeated and unconscious application of chemical insecticides has resulted in the development of resistance in the majority of house fly populations worldwide. The aim of this research was to determine the susceptibility levels of two field M. domestica populations to cyfluthrin and etofenprox in Antalya, Türkiye. The LD50 values, resistance ratios, and resistance status were determined by exposing adult house flies to the test chemicals for one hour. The Kemer population exhibited very low resistance to cyfluthrin, with a 5-fold increase, while the Serik population, in contrast, showed moderate resistance with a 29.67-fold increase. The resistance ratios of field populations to etofenprox were 2.33-fold (no resistance) for Kemer and 6.44-fold (very low resistance) for Serik, respectively. This is the first study to determine the resistance levels of house flies against cyfluthrin and etofenprox insecticides in Türkiye. To prevent or reduce the development of resistance to insecticides in house flies, integrated control methods and resistance management programs should be employed. Furthermore, it is advised that regular monitoring tests be conducted to observe the level of resistance. [ABSTRACT FROM AUTHOR]

The purpose of the research is to evaluate the susceptibility to deltamethrin and the pro-insecticide chlorfenapyr in a field population of Musca domestica L. compared to a laboratory strain Lab UF and to clarify a possible mechanism of crossresistance to chlorfenapyr.Materials and methods. The study was carried out on the adults of the laboratory strain Lab UF and the field population Nik of the housefly M. domestica collected from a livestock farm in the Tyumen region, where pyrethroid insecticides had been used for a long time. The toxicity of the pyrethroid deltamethrin (Delcid, 4%) and the pyrrole chlorfenapyr (Pyrafen EC, 360 g/l) against insects was estimated by the no-choice feeding test. Based on the dose-mortality response, lethal concentrations of insecticides were calculated by the probit analysis and the resistance ratio was determined. To clarify the possible mechanism of cross-resistance to chlorfenapyr in the Nik population of M. domestica, the activity of the main detoxification enzymes was determined depending on sex of the insects. In addition, the presence of the kdr-mutation providing resistance to pyrethroids was assessed by the Sanger sequencing.Results and discussion. The lethal concentrations of insecticides and the resistance ratios revealed the moderate resistance to deltamethrin and high susceptibility to chlorfenapyr in the field Nik population. A statistically significant increase in the activity of monooxygenases by 2.25–4.36 times, glutathione-S-transferase by 2.02–2.18 times, acetylcholinesterase by 1.45–1.46 times and alpha-naphthyl esterase by 1.41–1.46 times was noted in females and males of the Nik population compared to these parameters of the Lab UF strain. The presence of the kdr-mutation (L1014F) in houseflies of the field population was confirmed by the Sanger sequencing, while the kdr-his mutation (L1014H) was not detected. The results obtained allow us to suggest that resistance to deltamethrin and high susceptibility to chlorfenapyr in the field population of M. domestica are caused by the L1014F mutation and the increased P450 monooxygenase activity. Negative crossresistance can be used to develop insecticidal formulations that reduce the risk of rapid development of insecticidal resistance in M. domestica L.

Abstract Background Single-domain von Willebrand factor type C (SVWC) constitute a protein family predominantly identified in arthropods, characterized by a SVWC domain and involved in diverse physiological processes such as host defense, stress resistance, and nutrient metabolism. Nevertheless, the physiological mechanisms underlying these functions remain inadequately comprehended. Results A massive expansion of the SVWC gene family in Musca domestica (MdSVWC) was discovered, with a count of 35. MdSVWC1 was selected as the representative of the SVWC family for functional analysis, which led to the identification of the immune function of MdSVWC1 as a novel pattern recognition receptor. MdSVWC1 is highly expressed in both the fat body and intestines and displays acute induction upon bacterial infection. Recombinant MdSVWC1 binds to surfaces of both bacteria and yeast through the recognition of multiple pathogen-associated molecular patterns and exhibits Ca2+-dependent agglutination activity. MdSVWC1 mutant flies exhibited elevated mortality and hindered bacterial elimination following bacterial infection as a result of reduced hemocyte phagocytic capability and weakened expression of antimicrobial peptide (AMP) genes. In contrast, administration of recombinant MdSVWC1 provided protection to flies from bacterial challenges by promoting phagocytosis and AMP genes expression, thereby preventing bacterial colonization. MdSPN16, a serine protease inhibitor, was identified as a target protein of MdSVWC1. It was postulated that the interaction of MdSVWC1 with MdSPN16 would result in the activation of an extracellular proteolytic cascade, which would then initiate the Toll signaling pathway and facilitate the expression of AMP genes. Conclusions MdSVWC1 displays activity as a soluble pattern recognition receptor that regulates cellular and humoral immunity by recognizing microbial components and facilitating host defense.

Abstract The common housefly, Musca domestica, known for transmitting over 100 infections, was studied using green-synthesized Cadmium Sulfide nanoparticles (CdS NPs) from Agaricus bisporus. These CdS NPs were tested on third-instar larvae under laboratory conditions using dipping and feeding methods with concentrations (75, 100, 125, 150, 175, and 200 µg/mL). The toxicity, measured by LC50, was found to be 138 µg/mL for dipping treatment and 123 µg/mL for feeding treatment. Analysis with an energy-dispersive X-ray microanalyzer confirmed Cd accumulation in the larval midgut, indicating penetration of CdS NPs into the organism, which may potentially increase their toxicity. CdS NPs caused disruptions in Heat Shock Protein 70, cell apoptosis, and various biochemical components. Scanning electron microscopy revealed morphological abnormalities in larvae, pupae, and adults exposed to CdS NPs. Ultrastructural examination showed significant midgut tissue abnormalities in larvae treated with 123 µg/mL of CdS NPs. Our study demonstrated that green-synthesized CdS NPs from A. bisporus can effectively control the development of M. domestica larvae.

The common housefly, Musca domestica, known for transmitting over 100 infections, was studied using green-synthesized Cadmium Sulfide nanoparticles (CdS NPs) from Agaricus bisporus. These CdS NPs were tested on third-instar larvae under laboratory conditions using dipping and feeding methods with concentrations (75, 100, 125, 150, 175, and 200 µg/mL). The toxicity, measured by LC50, was found to be 138 µg/mL for dipping treatment and 123 µg/mL for feeding treatment. Analysis with an energy-dispersive X-ray microanalyzer confirmed Cd accumulation in the larval midgut, indicating penetration of CdS NPs into the organism, which may potentially increase their toxicity. CdS NPs caused disruptions in Heat Shock Protein 70, cell apoptosis, and various biochemical components. Scanning electron microscopy revealed morphological abnormalities in larvae, pupae, and adults exposed to CdS NPs. Ultrastructural examination showed significant midgut tissue abnormalities in larvae treated with 123 µg/mL of CdS NPs. Our study demonstrated that green-synthesized CdS NPs from A. bisporus can effectively control the development of M. domestica larvae. [ABSTRACT FROM AUTHOR]

Musca domestica L., a common housefly, and Culex quinquefasciatus mosquito are quite well-known pests that can transfer a wide range of diseases to humans as well as animals. In this study, various isoborneol derivatives including esters, ethers, and thioethers were synthesized from isoborneol under mild conditions. These derivatives were evaluated for inhibition of house-fly M. domestica adults and Cx. quinquefasciatus larvae. Two of the synthesized isoborneol ester derivatives (2 and 3) showed good activity against both insect species. Additional two derivatives (6 and 9) were active against M. domestica L., and the derivatives (1–3, 8) were active against Cx. quinquefasciatus larvae. [ABSTRACT FROM AUTHOR]

The plant essential oils are intricate blends of semi-volatile and volatile substances. They primarily consist of monoterpenes and sesquiterpenes; however, very trace amounts of diterpenes, triterpenes, and tetraterpenes are also present. In view of environmental concerns, highly aromatic essential oils, exhibit a variety of bioactivities against the targeted species as a novel pest control alternative to synthetic insecticides. As a result, the study aims to evaluate the impact of essential oils (EO) extracted from various plant species: Azadirachta indica, Citrus limon, Eucalyptus globulus, Laurus nobilis, Mentha piperita , and Ocimum tenuiflorum. Gas chromatography and Mass spectrometry (GC–MS) were used to determine the chemical components of these essential oils. Furthermore, the extracted oils were subjected to individual and combination formulations of bio-insecticides, which were assessed on houseflies and cockroaches in comparison to a blank control and the positive control dichlorvos (dimethyl 2, 2-dichlorovinyl phosphate). The findings showed that the maximum essential oil yields from the leaves of A. indica, E. globulus , and O. tenuiflorum were 11.38, 9.64 and 10.41 %, respectively. Compared to DDVP, which killed all insects within the 12-hour period, the combined form of leaf essential oils at 100 % concentration proved to be more effective in controlling insect mortality. It accounted for 98 % of the deaths in houseflies and 76.4 % of the deaths in cockroaches, according to the contact toxicity evaluation. The active insecticidal components in the formulation include eucalyptol, undecane, tetradecane, estragole, pentadecane, and caryophyllene. [Display omitted] • Herbal essential oils extracted from six medicinal plants and showed acute toxicity on housefly and cockroach. • The essential oil formulation showed promising biological activities contact toxicity on housefly and cockroach. • GC–MS analysis predict eucalyptol, undecane, tetradecane, estragole, pentadecane, and caryophyllene highest percentage. • The 100 % herbal insecticidal product was developed and commercialised with cost effective. [ABSTRACT FROM AUTHOR]

The male-limited inheritance of Y chromosomes favors alleles that increase male fitness, often at the expense of female fitness. Determining the mechanisms underlying these sexually antagonistic effects is challenging because it can require studying Y-linked alleles while they still segregate as polymorphisms. We used a Y chromosome polymorphism in the house fly, Musca domestica, to address this challenge. Two male determining Y chromosomes (YM and IIIM) segregate as stable polymorphisms in natural populations, and they differentially affect multiple traits, including male courtship performance. We identified differentially expressed genes encoding odorant binding proteins (in the Obp56h family) as candidate agents for the courtship differences. Through network analysis and allele-specific expression measurements, we identified multiple genes on the house fly IIIM chromosome that could serve as trans regulators of Obp56h gene expression. One of those genes is homologous to Drosophila melanogaster CG2120, which encodes a transcription factor that binds near Obp56h. Upregulation of CG2120 in D. melanogaster nervous tissues reduces copulation latency, consistent with this transcription factor acting as a negative regulator of Obp56h expression. The transcription factor gene, which we name speed date, demonstrates a molecular mechanism by which a Y-linked gene can evolve male-beneficial effects.

Abstract Background Flies are acknowledged as vectors of diseases transmitted through mechanical means and represent a significant risk to human health. The study aimed to determine the prevalence of enteropathogens carried by flies in Pudong New Area to inform strategies for preventing and controlling flies. Methods Samples were collected from various locations in the area using cage trapping techniques between April and November 2021, encompassing various habitats such as parks, residential areas, restaurants, and farmers’ markets. The main fly species were identified using cryomicrography and taxonomic enumeration, with 20 samples per tube collected from different habitats. Twenty-five enteropathogens were screened using GI_Trial v3 TaqManTM microbial arrays. Results A total of 3,875 flies were collected from 6,400 placements, resulting in an average fly density of 0.61 flies per cage. M. domestica were the most common species at 39.85%, followed by L. sericata at 16.57% and B. peregrina at 13.14%. Out of 189 samples, 93 tested positive for enteropathogens, with nine different pathogens being found. 12.70% of samples exclusively had parasites, a higher percentage than those with only bacteria or viruses. The study found that M. domestica had fewer enteropathogens than L. sericata and B. peregrina, which primarily harbored B. hominis instead of bacteria and viruses such as E. coli, Astrovirus, and Sapovirus. During spring testing, all three fly species exhibited low rates of detecting enteropathogens. M. domestica were found in residential areas with the highest number of pathogen species, totaling six. In contrast, L. sericata and B. peregrina were identified in farmers’ markets with the highest number of pathogen species, totaling six and seven, respectively. Conclusions Flies have the potential to serve as vectors for the transmission of enteropathogens, thereby posing a substantial risk to public health.

Background: Flies are acknowledged as vectors of diseases transmitted through mechanical means and represent a significant risk to human health. The study aimed to determine the prevalence of enteropathogens carried by flies in Pudong New Area to inform strategies for preventing and controlling flies. Methods: Samples were collected from various locations in the area using cage trapping techniques between April and November 2021, encompassing various habitats such as parks, residential areas, restaurants, and farmers' markets. The main fly species were identified using cryomicrography and taxonomic enumeration, with 20 samples per tube collected from different habitats. Twenty-five enteropathogens were screened using GI_Trial v3 TaqManTM microbial arrays. Results: A total of 3,875 flies were collected from 6,400 placements, resulting in an average fly density of 0.61 flies per cage. M. domestica were the most common species at 39.85%, followed by L. sericata at 16.57% and B. peregrina at 13.14%. Out of 189 samples, 93 tested positive for enteropathogens, with nine different pathogens being found. 12.70% of samples exclusively had parasites, a higher percentage than those with only bacteria or viruses. The study found that M. domestica had fewer enteropathogens than L. sericata and B. peregrina, which primarily harbored B. hominis instead of bacteria and viruses such as E. coli, Astrovirus, and Sapovirus. During spring testing, all three fly species exhibited low rates of detecting enteropathogens. M. domestica were found in residential areas with the highest number of pathogen species, totaling six. In contrast, L. sericata and B. peregrina were identified in farmers' markets with the highest number of pathogen species, totaling six and seven, respectively. Conclusions: Flies have the potential to serve as vectors for the transmission of enteropathogens, thereby posing a substantial risk to public health. [ABSTRACT FROM AUTHOR]

Understanding the causes, extent, and period of neglect is not only a medical but also a forensic task when it comes to legal investigations. In this study, we evaluated 46 autopsied cases where there was clear evidence of physical neglect during the last period of the deceased's life. The age of the deceased ranged from 21 to 96 years; most of them were female (71.7%). The majority of cases (89.9%) took place in a domestic environment, with partners or relatives providing care. The most frequent post-mortem findings were pressure sores, followed by inflammatory skin changes, and signs of malnutrition and dehydration. Neglect was the cause or co-cause of death in 23% of the cases. More than half of the deceased showed severe contamination of the skin surface by excrement, and in almost 40% of the cases, fly infestation was found. The majority of insects belonged to the group of house flies (Diptera: Muscidae), mainly the common house fly, Musca domestica. By analyzing the entomological evidence, it was possible to prove an insect infestation period of at least several days ante-mortem. Since the period of neglect may be relevant in terms of legal proceedings, the present work demonstrates the particular importance of insect traces in providing this evidence. While prosecution and conviction of caregivers remain challenging, it is all the more essential that entomology and legal medicine collaborate on the analysis of findings of neglect. [ABSTRACT FROM AUTHOR]

Simple Summary: Enzymes of the detoxification system are known to play a crucial role in insecticide resistance in insects. The role of P450 monooxygenases in providing resistance to chlorfenapyr is ambiguous and of interest due to possible negative cross-resistance to pyrethroids and other insecticides, the resistance to which is ensured by increased activity of these enzymes. This study aimed to perform a biochemical and molecular evaluation of P450 monooxygenases in susceptible and chlorfenapyr-resistant strains of Musca domestica L. depending on sex. The chlorfenapyr-resistant strain of M. domestica L. did not differ from the susceptible strain in terms of the pattern of overall P450-monooxygenase activity: the larvae of both strains had lower enzymatic activity than the adults. However, the development of resistance to chlorfenapyr in house flies was accompanied by an increase in P450-monooxygenase activity without changes in CYP6D1 expression. PCR-RFLP analysis revealed a previously undescribed mutation in the promoter region of the CYP6D1 gene of M. domestica, the effect of which on the gene expression level was not detected. The house fly Musca domestica L. is one of the most common insects of veterinary and medical importance worldwide; its ability to develop resistance to a large number of insecticides is well known. Many studies support the involvement of cytochrome P-450-dependent monooxygenases (P450) in the development of resistance to pyrethroids, neonicotinoids, carbamates, and organophosphates among insects. In this paper, the monooxygenase activity and expression level of CYP6D1 were studied for the first time in a chlorfenapyr-resistant strain of house fly. Our studies demonstrated that P450 activity in adults of the susceptible strain (Lab TY) and chlorfenapyr-resistant strain (ChlA) was 1.56–4.05-fold higher than that in larvae. In females of the Lab TY and ChlA strains, this activity was 1.53- and 1.57-fold higher, respectively (p < 0.05), than that in males, and in contrast, the expression level of CYP6D1 was 21- and 8-fold lower, respectively. The monooxygenase activity did not vary between larvae of the susceptible strain Lab TY and the chlorfenapyr-resistant strain ChlA. Activity in females and males of the ChlA strain exceeded that in the Lab TY strain specimens by 1.54 (p = 0.08) and 1.83 (p < 0.05) times, respectively, with the same level of CYP6D1 expression. PCR-RFLP analysis revealed a previously undescribed mutation in the promoter region of the CYP6D1 gene in adults of the Lab TY and ChlA strains, and it did not affect the gene expression level. The obtained results show that the development of resistance to chlorfenapyr in M. domestica is accompanied by an increase in P450-monooxygenase activity without changes in CYP6D1 expression. [ABSTRACT FROM AUTHOR]

The house fly, Musca domestica L. (Diptera: Muscidae), is considered to be a nuisance pest and a mechanical carrier of medical and veterinary pathogenic organisms. Because the fly has developed resistance to a variety of commonly used insecticides, novel alternative pest control tactics are being researched. Five desiccant dust-based formulations, silica gel (CimeXa), perlite (Imergard WP), diatomaceous earth (Celite 610, biologically produced in diatoms), silica gel + pyrethrins + piperonyl butoxide (PBO, a synergist) (Drione), and silica gel + thyme oil (EcoVia WD), were evaluated for effects on house fly egg hatching, larval development to pupation, adult emergence from pupae, and adult survival in the laboratory. While silica gel, perlite, and diatomaceous earth did not reduce egg hatching, pupation, and adult emergence from pupae, the silica gel + pyrethrins + PBO and silica gel + thyme oil formulations provided 100% control of those life stages. Adult house flies exposed to complete bodily coating and limited exposure from tarsal contact were killed by all three desiccant dust products without botanicals and two products formulated with botanicals. The formulations with bioactive botanicals provided more rapid control (3–4 h) than the desiccant dusts without botanicals (<24 h). All dust formulations showed effectiveness for house fly control to one extent or another; possible uses of the dusts as control tactics are discussed. [ABSTRACT FROM AUTHOR]

• GWP of housefly larvae treatment is significantly higher in summer than in winter. • Bioconversion itself contributed very little to GWP. • GWP will increase slightly when larvae are stored by drying rather than freezing. • There is a contradiction between a higher mature larvae production and a lower GWP. The significant increase in the demand for biomass waste treatment after garbage classification has led to housefly larvae treatment becoming an attractive treatment option. It can provide a source of protein while treating biomass waste, which means that nutrients can be returned to the natural food chain. However, the performance of this technology in terms of its environmental impacts is still unclear, particularly with regards to global warming potential (GWP).This study used a life cycle assessment (LCA) approach to assess a housefly larvae treatment plant with a treatment capacity of 50 tons of biomass waste per day. The LCA results showed that the 95% confidence intervals for the GWP in summer and winter were determined to be 24.46–32.81 kg CO 2 equivalent (CO 2 -eq)/ton biomass waste and 5.37–10.08 kg CO 2 -eq/ton biomass waste, respectively. The greater GWP value in summer is due to the longer ventilation time and higher ventilation intensity in summer, which consumes more power. The main GWP contributions are from (1) electricity needs (accounting for 78.6% of emissions in summer and 70.2% in winter) and (2) product substitution by mature housefly larvae and compost (both summer and winter accounting for 96.8% of carbon reduction). [Display omitted] [ABSTRACT FROM AUTHOR]

The common house fly, Musca domestica L., is a mechanical vector of numerous diseases that may be spread from one living thing to another by sponging their mouthparts on their body and leg hairs after they have vomited. House flies (Musca domestica) have been known as a mechanical vector in spreading infectious diseases such as cholera, shigellosis, salmonellosis and skin infections. The present study aims to investigate the abundance of M. domestica adults in an urban region of Cairo Governorate, Egypt, throughout one year and bacterial diversity on its body surface. Adults of M. domestica were collected monthly by hunting. Collected adults were subjected to molecular identification. Bacteria were isolated from the surface of flies' body pieces and identified by automated identification systems (VITEK). Obtained data revealed that the highest abundance (201.67±15.57) was recorded in May 2022, while the lowest abundance (17.33±0.57) was recorded in April 2023. Also, M. domestica abundance positively correlated significantly (P≤0.001) with temperature (r= 0.895) and relative humidity (r= 0.827). Musca domestica species were molecularly identified, and the sequences were then banked on NCBI under the accession numbers OQ784762-OQ784764. The highest bacterial pathogen presence were Gram-positive Staphylococcus spp. and Bacillus spp. (77.0 %). Gram-negative Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumonias had the lowest presence (total of 23.0 %). On the other hand, the results of antibiotic sensitivity revealed that Bacillus spp., Pseudomonas aeruginosa, and Klebsiella pneumonia are more resistant to several antibiotics than Staphylococcus spp. and Escherichia coli. [ABSTRACT FROM AUTHOR]

Dientamoeba fragilis and Blastocystis sp. are single-celled protozoan parasites of humans and animals. Although they are found in the intestines of healthy hosts, the pathogenicity of them is still unclear. To date, there is no report on D. fragilis and only two studies (without subtyping) on the occurrence of Blastocystis sp. in Musca domestica. In this study, fly samples were collected from livestock farms and their surroundings in the Kirsehir province (Central Anatolia Region) of Türkiye from May to August 2023. A total of 150 microscopically identified M. domestica samples were analyzed for the detection of D. fragilis and Blastocystis sp. molecularly. The overall prevalence of Blastocystis sp. and D. fragilis in M. domestica was determined to be 3.3% (5/150) and 8.0% (12/150), respectively. The SSU rRNA gene sequences of the isolates indicated genotype 1 of D. fragilis. Eleven isolates were identical and represented a single isolate (KAU-Dfrag1). BLAST analysis of KAU-Dfrag1 indicated identity with the isolates reported from humans, cattle, sheep, and budgerigars. The other isolate (KAU-Dfrag2) was polymorphic at two nucleotides from KAU-Dfrag1 and three nucleotides from known genotypes from GenBank and represented a variant of genotype 1. The Blastocystis sp. isolates were found to be identical and represent a single genotype (KAU-Blast1). BLAST analysis revealed that the KAU-Blast1 genotype belonged to the potentially zoonotic subtype 5 (ST5) and exhibited the highest genetic identity (ranging from 99.4 to 99.6%) with pigs, cattle, and sheep from different countries. Our study provides the first data on the molecular prevalence, epidemiology, and genotypic characterization of D. fragilis and Blastocystis sp. in M. domestica. [ABSTRACT FROM AUTHOR]

Insect chitinases have been proposed as potential targets for pest control. In this work, a novel group IV chitinase gene, MdCht9, from Musca domestica was found to have multiple functions in the physiological activity, including chitin regulation, development and antifungal immunity. The MdCht9 gene was cloned and sequenced, its phylogeny was analysed and its expression was determined in normal and 20E treated larvae. Subsequently, RNA interference (RNAi)‐mediated MdCht9 knockdown was performed, followed by biochemical assays, morphological observations and transcriptome analysis. Finally, the recombinant protein MdCht9 (rMdCht9) was purified and tested for anti‐microbial activity and enzyme characteristics. The results showed that MdCht9 consists of three domains, highly expressed in a larval salivary gland. RNAi silencing of MdCht9 resulted in significant down‐regulation of chitin content and expression of 15 chitin‐binding protein (CBP) genes, implying a new insight that MdCht9 might regulate chitin content by influencing the expression of CBPs. In addition, more than half of the lethality and partial wing deformity appeared due to the dsMdCht9 treatment. In addition, the rMdCht9 exhibited anti‐microbial activity towards Candida albicans (fungus) but not towards Escherichia coli (G−) or Staphylococcus aureus (G+). Our work expands on previous studies of chitinase while providing a potential target for pest management. [ABSTRACT FROM AUTHOR]

Over the past few years, there has been growing interest in the ability of insect larvae to convert various organic side-streams containing mycotoxins into insect biomass that can be used as animal feed. Various studies have examined the effects of exposure to aflatoxin B1 (AFB1) on a variety of insect species, including the larvae of the black soldier fly (BSFL; Hermetia illucens L.; Diptera: Stratiomyidae) and the housefly (HFL; Musca domestica L.; Diptera: Muscidae). Most of these studies demonstrated that AFB1 degradation takes place, either enzymatic and/or non-enzymatic. The possible role of feed substrate microorganisms (MOs) in this process has thus far not been investigated. The main objective of this study was therefore to investigate whether biotransformation of AFB1 occurred and whether it is caused by insect-enzymes and/or by microbial enzymes of MOs in the feed substrate. In order to investigate this, sterile and non-sterile feed substrates were spiked with AFB1 and incubated either with or without insect larvae (BSFL or HFL). The AFB1 concentration was determined via LC-MS/MS analyses and recorded over time. Approximately 50% of the initially present AFB1 was recovered in the treatment involving BSFL, which was comparable to the treatment without BSFL (60%). Similar patterns were observed for HFL. The molar mass balance of AFB1 for the sterile feed substrates with BSFL and HFL was 73% and 78%, respectively. We could not establish whether non-enzymatic degradation of AFB1 in the feed substrates occurred. The results showed that both BSFL and substrate-specific MOs play a role in the biotransformation of AFB1 as well as in conversion of AFB1 into aflatoxin P1 and aflatoxicol, respectively. In contrast, HFL did not seem to contribute to AFB1 degradation. The obtained results contribute to our understanding of aflatoxin metabolism by different insect species. This information is crucial for assessing the safety of feeding fly larvae with feed substrates contaminated with AFB1 with the purpose of subsequent use as animal feed.

ObjectiveTo determine the resistance of adult Culex quinquefasciatus and Musca domestica to commonly used insecticides in Dazhu District of Chongqing in 2023， and provide scientific evidence for rational use of hygienic insecticides.MethodsDrug resistance was determined by using adult mosquito contact tube method and adult fly drop method.ResultsIn 2023， the 24-hour mortality rate of adult Culex quinquefasciatus in Dazu District， Chongqing， against permethrin （0.25%）， beta-cypermethrin （0.025%）， deltamethrin （0.025%）， malathion （5%） and propoxur （0.1%） was 37.35%， 21.92%， 28.33%， 96.43%， and 95.38%， respectively. The median lethal dose （LD50） value of female adult Musca domestica against beta-cypermethrin （95.8%）， chlorpyrifos （97%）， deltamethrin （90%） and dichlorvos （95%） was 2.572 μg， 0.329 μg， 0.406 μg， and 0.492 μg， respectively， with resistance of 829.68， 7.65， 53.42， and 46.42 folds to the above tested insecticides．ConclusionAdult Culex quinquefasciatus and Musca domestica in Dazu District show various degrees of resistance to commonly used insecticides. It warrants suspending the insecticides with high resistance， whereas mixedly and alternatively administering the insecticides with possible resistance and low resistance. Additionally， we should continue to monitor the resistance and guide the rational use of insecticides.

Abstract Background The house fly, Musca domestica, is a significant carrier of diseases that can impact public health. Repeated use of pyrethroid insecticides may act as a selection pressure for mutations and amino acid substitutions in the house fly voltage-sensitive sodium channel (VSSC), which ultimately confers resistance. The objectives of this study were to determine the presence of knockdown resistance (kdr) mutations using molecular tools and to set up a CDC bottle bioassay specific for house flies in the United Arab Emirates (UAE) to screen for deltamethrin resistance. Methods Adult flies were collected from 19 locations in Abu Dhabi, UAE, and DNA was extracted, followed by PCR amplification of specific alleles (PASA) and conventional PCR using several primers to amplify regions of the VSSC gene. Sanger sequencing was performed on PCR products. We also designed primers that detect four kdr mutations using complementary DNA (cDNA) in reverse transcriptase (RT)-PCR followed by Sanger sequencing. Additionally, a CDC bottle bioassay was set up for detecting deltamethrin resistance in adult house flies. Results In PASA, the primers successfully amplified the target bands (480, 280 and 200 bp). The kdr allele was found in flies collected from 18 of the 19 locations, at the highest and lowest prevalence of 46.9% and 9.4%, respectively. Resistant homozygous (RR) insects constituted 5.0% of the tested populations, and heterozygous (RS) insects accounted for 36.5%. The RR genotype was prevalent in house flies collected at 10 of 19 sampling locations. House fly populations were mostly in Hardy–Weinberg equilibrium, except in three locations. In addition to verifying the presence of the previously identified kdr mutation L1014F, in this study we detected two kdr mutations, L1014H and T929I, that have not previously been reported in the UAE. Also, for the first time in the UAE, a CDC bottle bioassay for deltamethrin resistance was used, which found that 60 min and 4.5 µg/ml were the diagnostic time and dose, respectively. Using this assay, we detected deltamethrin resistance in house flies from two of 16 locations, with a resistance level of 12.5%. Conclusions Using DNA sequencing, we confirmed the presence of a known kdr mutation and uncovered two new kdr mutations in house flies from Abu Dhabi. Additionally, we detected deltamethrin resistance in these flies using a CDC bottle bioassay. Further research is recommended to comprehensively identify more kdr mutations in UAE house fly populations and assess their impacts on control strategies. Graphical Abstract

Simple Summary: This study investigated the detection and discrimination of the neonicotinoid insecticide imidacloprid by behaviorally resistant and susceptible house flies (Musca domestica L.). Flies were allowed to contact a sucrose solution containing either a low or a high concentration of imidacloprid with their tarsi alone or with both their tarsi and proboscis. The proboscis extension response (PER) for each house fly was recorded at 0, 2, and 10 s following the start of tarsal contact with the test solution. Following proboscis contact with the sucrose solution containing a high concentration of imidacloprid, behaviorally resistant flies had a significant reduction in PER (within 2 s), while imidacloprid-susceptible flies showed no differences in PER associated with the concentration of imidacloprid. When only the tarsi were allowed to contact either solution, there were no significant differences in PER observed for either fly strain (resistant or susceptible). These results suggest that behaviorally resistant house flies detect imidacloprid and can discriminate among low and high concentrations following proboscis contact but not tarsal contact with a sucrose solution containing imidacloprid. Understanding the mechanisms responsible for behavioral resistance to insecticides by the house fly is critical for creating sustainable pest management strategies for this fly. The house fly, Musca domestica L., is a significant human and livestock pest. Experiments used female adult house flies glued onto toothpicks for controlled exposure of their tarsi alone (tarsal assay) or their tarsi and proboscis (proboscis assay) with a sucrose solution containing imidacloprid at either a low (10 µg/mL) or high (4000 µg/mL) concentration. Proboscis extension response (PER) assays were used to characterize the response of imidacloprid-susceptible and behaviorally resistant house fly strains to contact with sucrose solutions containing either a low or high concentration of imidacloprid. In each assay, 150 female flies from each fly strain were individually exposed to sucrose solutions containing either a low or high concentration of imidacloprid by deliberate contact of the fly tarsi to the test solution. The PER for each fly was subsequently recorded at 0, 2, and 10 s following the initial tarsal contact. A significant and rapid reduction in PER was observed only for the behaviorally resistant fly strain and only following contact by the flies' proboscis with the sucrose solution containing the high imidacloprid concentration. The results suggest that chemoreceptors on the fly labellum or internally on the pharyngeal taste organs are involved in the detection of imidacloprid and discrimination of the concentration, resulting in an avoidance behavior (proboscis retraction) only when imidacloprid is at sufficient concentration. Further research is needed to identify the specific receptor(s) responsible for imidacloprid detection. [ABSTRACT FROM AUTHOR]

Many entomopathogenic fungi cause infections that kill their insect host. Little is understood about changes in the reproductive investment that occurs during an infection by a lethal disease over the waning life of an insect. Life-history theory suggests the host will respond by investing resources into fighting the disease or increasing reproduction. Here, we investigate how the reproductive life of adult house flies, Musca domestica , is impacted by its host-specific fungal pathogen, Entomophthora muscae. Specifically, we test how the week-long infection alters the mating behavior of virgin adult male house flies. We find that the pathogen significantly decreases male libido, an effect which grows stronger over the course of the infection. Furthermore, females were significantly less likely to choose an infected male, reducing male mating success. Additionally, we assessed sperm viability to understand the reproductive costs for monandrous females to mate with infected males. Analyses revealed that sperm quality decreases as early as 3 days post-infection. These results show that E. muscae , which can have a prevalence near 100% in wild populations, causes severe lifetime reproductive costs to male house flies. Understanding how host–pathogen interactions affect host life history is crucial for elucidating all the negative effects pathogen virulence exerts on hosts. [ABSTRACT FROM AUTHOR]

The Musca domestica is a serious hygienic pest of poultry, humans, and livestock facilities with the immense ability for resistance development against chemical insecticides. The current study aimed to evaluate the susceptibility and resistance status of M. domestica against different classes of insecticides. For this purpose, adult M. domestica populations were collected from five different localities of Sargodha division (Sargodha, Khushab, Jauharabad, Mianwali, and Bhakkar), Punjab, Pakistan, and tested against selected insecticides. The resistance ratios (RR) at LC50 ranged from 10.32-35.37 folds for deltamethrin, 17.49- 38.13 folds for fipronil, and 10.70-18.81 folds for chlorpyrifos. The RR values at LC50 for imidacloprid and pyriproxyfen ranged from 4.35-28.0 and 10.56-21.45 folds, respectively. The study showed varying levels of resistance in M. domestica populations from area to area and from insecticide to insecticide. Therefore, to control resistance development in M. domestica from livestock facilities, inappropriate and excessive use of insecticides must be controlled through proper mechanisms and strategies. [ABSTRACT FROM AUTHOR]

Cyromazine is a triazine insect growth regulator insecticide that is recommended for control of Musca domestica worldwide. Cyromazine is highly effective in causing mortality of M. domestica; however, some aspects of its lethal and sublethal effects on the biology of M. domestica are still unknown. The present study explored lethal and sublethal effects on several biological traits and population parameters of M. domestica. Concentration–response bioassays of cyromazine against third-instar larvae of M. domestica exhibited sublethal and lethal effects from concentrations of 0.03 (LC10), 0.06 (LC25), and 0.14 (LC50) μg/g of a larval medium. Exposure of M. domestica larvae to these concentrations resulted in reduced fecundity, survival, longevity and oviposition period, and delayed development of immature stages (i.e., egg hatch time and larval and pupal durations) in the upcoming generation of M. domestica. The values of population parameters such as intrinsic rate of increase, finite rate of increase, net reproductive rate, age-specific survival rate and fecundity, and age–stage life expectancy and reproductive value, analyzed using the age–stage and two-sex life table theory, were significantly reduced in a concentration-dependent manner in comparison with the control group. In conclusion, the study highlights the significant effects of cyromazine on the biology of M. domestica that could help suppress its population in cases of severe infestations. [ABSTRACT FROM AUTHOR]

Insects, particularly house fly pupae (M. domestica L.), are increasingly promoted as a rich and sustainable protein source, presenting a practical solution for organic waste management. These insects possess the capability to transform animal waste into valuable biomass, underscoring the necessity to evaluate housefly larval growth on diverse waste mixtures. The primary objective was to comprehend how different culture media influence the life history traits of this species. To address this, the research aimed to assess the growth and development performance of housefly larvae reared on various waste mixtures. Adult house flies (M. domestica) were sourced from meat and fish markets in Rajshahi city, Bangladesh, employing systematic sampling from different market sections for a representative selection. Experimental diets were formulated with combinations of cattle blood, cattle manure, rice bran, wheat bran, and kitchen waste, categorized into Diet-A (kitchen waste:cattle manure:wheat bran), Diet-B (cattle blood:rice bran), Diet-C (cattle manure:wheat bran), and Diet-D (cattle blood:kitchen waste:rice bran). Additionally, a control group comprised a mixture of waste materials, including yeast, egg white, milk powder, and wheat bran. The findings revealed that larvae, pupae, and adults reared on Diet-B, incorporating cattle blood and rice bran, demonstrated increased length compared to other diets. This varied diet also produced the heaviest larvae, pupae, and adults, exhibiting the highest morphometric parameters. The moisture content of pupae varied across the different diets, ranging from 53.23±0.17 % to 65.47±1.32 %. The pupae reared on Diet-B had the highest levels of crude protein (53.44±0.05 %, p < 0.05), while those reared on Diet-C had the highest levels of fat (18.56±0.05 %, p < 0.05 except for diet A). The findings demonstrate that housefly larvae can be reared on diets containing rice bran and cattle blood, which have different nutritional profiles and biological capacities. However, the ideal rearing strategy should depend on how M. domestica will be utilized in the future. The study highlights insects, especially housefly pupae, as a sustainable protein source and an organic waste management solution. Therefore, the results of this study contribute to the broader understanding of Musca domestica and offer practical implications for both scientific research and pest management practices.

Diptera have high capacity to adapt to anthropized environments and they present high medical and sanitary relevance, since they are related to pathogens transmission and myiasis causing. In this context, it is known that anthropic environments (e.g., street markets) with high human circulation and food supply can directly influence the composition and structure of muscoid dipterans assemblages. The aim of this work was to evaluate the effect of street markets on the composition and structure of assemblages of flies with sanitary importance in an urban environment of Toritama city, Pernambuco state, Brazil. The flies were captured using adhesive mousetrap “Cola Rato” before and after the occurrence of free markets. A total of 7,780 specimens belonging to six families and 14 species were collected. Muscidae was the most representative and diverse family, with 96.98% of all flies captured and four species. We observed that the assemblages were more abundant after the occurrence of the street markets (H = 6.56; df = 1; P < 0.01). Regarding the composition of the assemblies, 50% of the species were common to both treatments, with emphasis on the dominant species Musca domestica and Megaselia scalaris. This study reveals that free markets can modulate the structure and composition of flies’ assemblages in urban environments, including being able to offer health risks, considering that species of medical importance are related to this environment.

The house fly, Musca domestica L. (Diptera: Muscidae), is a significant vector for many pathogens and parasites. Presence of this vector causes economic losses due to decreased feeding activity in livestock, resulting in reduced yields of products. The repeated and unconscious application of chemical insecticides has resulted in the development of resistance in the majority of house fly populations worldwide. The aim of this research was to determine the susceptibility levels of two field M. domestica populations to cyfluthrin and etofenprox in Antalya, Türkiye. The LD50 values, resistance ratios, and resistance status were determined by exposing adult house flies to the test chemicals for one hour. The Kemer population exhibited very low resistance to cyfluthrin, with a 5-fold increase, while the Serik population, in contrast, showed moderate resistance with a 29.67-fold increase. The resistance ratios of field populations to etofenprox were 2.33-fold (no resistance) for Kemer and 6.44-fold (very low resistance) for Serik, respectively. This is the first study to determine the resistance levels of house flies against cyfluthrin and etofenprox insecticides in Türkiye. To prevent or reduce the development of resistance to insecticides in house flies, integrated control methods and resistance management programs should be employed. Furthermore, it is advised that regular monitoring tests be conducted to observe the level of resistance.

A fungus isolated from mango wasp was found to be pathogenic to houseflies. The isolated fungus was identified as Aspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106, 1x107, 1x108, 2x106, 2x107, 2x108, 3x106, 3x107, and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods. The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface. Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

Abstract Non-technical summary Given increasing global political, security and economic challenges, politicians in the European Union (EU) are seeking to reduce the EU's dependence on imports, including feed for farmed livestock. While insect farming has been suggested as an advantageous source of livestock feed is the insect farming industry, the sector has not met optimistic expectations. In particular, labor and electricity costs are driving insect companies offshore, including to Asia and the United States. This paper explores ways that the EU could solve this problem, the most promising of which is to expand the EU's production of maize and soy. Technical summary In the context of the Russian invasion of Ukraine and increasing global destabilization, policy makers within the European Union have expressed the need to reduce the bloc's dependence on imported agricultural products such as livestock feed. One industry that has been promoted as an advantageous source of livestock feed is insect agriculture. However, the insect industry's growth has not kept pace with optimistic expectations, and high labor and electricity costs in Europe appear to be driving major insect companies to expand production offshore. One solution may involve supporting the automation of insect farming, though automation may have harmful social consequences by reducing employment and exacerbating inequality. A more promising solution could involve bringing additional land under cultivation to expand domestic production of maize and soy, and the most up-to-date estimates suggest that doing so may even offer environmental benefits over insect production. Social media summary Insect farming has been offered as a solution to EU food security, but labor and power costs complicate the picture.

Background: The house fly, Musca domestica, is vector for pathogens and parasites and causes economic damage to livestock by reducing forage conversion efficiency, negatively impacting weight gain and milk production. It has shown resistance to multiple insecticide classes. The aim of this research was to determine the susceptibility levels of seven­teen field M. domestica strains to thiamethoxam, a neonicotinoid insecticide, in Türkiye. Methods: Insecticide susceptibility of the house flies to thiamethoxam was determined using the WHO glass jar meth­od. A probit analysis program was used to determine LD50 values, and then the resistance ratios were compared with insecticide-susceptible strain. Results: All strains were ≥18.5-fold resistant to thiamethoxam. The data showed that 10 out of 17 strains had either high or very high resistance levels. Our findings revealed that house flies from solid waste landfills in Samsun, Ankara, and Kocaeli exhibited higher resistance ratios compared to those found in animal shelters. Conversely, in Gaziantep, Antalya, İzmir and Erzurum, the exact opposite trend was observed. Regarding the LD50 values among solid waste stor­age areas, the lowest rate was obtained from Gaziantep (0.72 gr ai/m2), and the highest rate was obtained from Ankara (9.35 gr ai/m2). Furthermore, regarding the LD50 values among animal shelters, the lowest was obtained from Samsun (0.37 gr ai/m2), and the highest was obtained from Denizli (21800 gr ai/m2). Conclusion: The use of integrated control systems is recommended for controlling house fly populations, including insecticide class rotations for preventing, or at least, delaying the onset of resistance.

The goal of this study, which was carried out in 2022 in the Advanced Entomology Laboratory of the Department of Biology, Girls College of Education, University of Kufa, was to determine how well the fungus filtrates of Alternaria alternata affected the mortality percentages of house fly larvae and pupae, Musca domistica. The results indicated an increase in the mortality percentages of larvae in the first and third instar of the house fly, Musca domistica with increasing concentrations used. In the study, the highest mortality percentages were recorded after three days of treatment with a concentration of 10% (100 and 85%) in the first and third instar larvae, respectively. The effect of the fungus filtrates on some biological aspects when treating the third instar larvae of houseflies, as it led to a decrease in pupation percentages to 15% when treating pupae with a concentration of % 10, and the pupal deformation percentages to 10% and a decrease in adult emergency percentages to 0%. when treating pupae with the fungus filtrates of Alternaria alternata at a concentration of 10 %, which increased the pupal deformation to 80% and decreased adult emergency percentages to 20%. [ABSTRACT FROM AUTHOR]

This study assessed the impact of an alcoholic extract of Citrus aurantium leaves on the mortality percentages in the larvae and pupae of house flies, Musca domistica, and was carried out in the Advanced Entomology Laboratory in the Department of Biology at the Girls College of Education at the University of Kufa in 2022. The results indicated an increase in the mortality percentages of larvae in the first and third stars of the house fly, Musca domistica with increasing concentrations used. In this study, the highest mortality percentages were recorded after three days of treatment with a concentration of 50 mg/ml (100 and 61%) in the first and third instar larvae, respectively. The effect of the alcoholic extract on some biological aspects when treating the third instar larvae of houseflies, as it led to a decrease in pupation percentages to 24% when treating pupae with a concentration of 50 mg/ml, and the pupal deformation percentages to 24% and a decrease in adult emergency percentages to 0% when treating pupae with the alcoholic extract of Citrus aurantium leaves at a concentration of 50 mg/ml, which increased the pupal deformation to 50% and decreased adult emergency percentages to 50%. [ABSTRACT FROM AUTHOR]

The achievement of this research was to study the influence of AgNPs on the life stages of Muscadomestica. The supernatant of Trichodermaharzianum successfully reduces AgNO3 into AgNPs through the duration of incubation, as noticed by the color change from white to red. The absorbance of UV–visible light results in an absorbance peak at 418 nm for nanoparticle solutions of Ag particles. The scanning electron microscopy (SEM) image confirmed the formation of AgNPs with an average particle size of 46.63 nm without aggregation or adhesion. The microscopy of energy-dispersive X-ray (EDX) approved the formation of AgNPs with a high amount of some atoms of carbon and oxygen derivatives from components of fungus extract used to reduce AgNO3. The concentration of AgNPs prepared with serial dilutions of 5%, 10%, 15%, 20% and 25%, also with sterilized distilled water as a control and the influence of AgNPs on phases of M. domestica had been studied. The eggs of the studied insects were affected by 20% of AgNPs, which showed an increase in incubation time of 11 h without any hatched eggs at 25%. The larval stage of the insect was also influenced by AgNPs solution, which at 25% increased the duration of incubation to reach 11 h with 27 larval insects dead, compared with 7 h without any missing membrane in the larval stage of the insect. As well as the pupal phase of insects, we increased the period of incubation to 10 h with 7 h in control, and in addition, the number of pupal insects dead reached 23 in 25% concentration. Finally, the AgNPs also increased the number of adult insects to reach 27 at 25% concentration. The AgNPs approved the activity toward M. domestica and therefore considered it a preferable option for biological control. [ABSTRACT FROM AUTHOR]

Insect farming for animal feed production is considered a promising alternative to the traditional feed manufacturing sector, because of its low ecological footprint and circular use of required resources. However, treating insects as mini-livestock is accompanied by various questions on the suitable rearing conditions needed to achieve high-quality products, while considering insect welfare. Although there are concepts which have long served as a compass for animal welfare regulations, these have been under increasing criticism. Also, they have been drawn up for vertebrate animals and are, therefore, not entirely applicable to insects. We hold that the development of commonly accepted methods for keeping insects as mini-livestock demands deep knowledge on insect biology and a dynamic discussion on insect welfare. We plead for an evaluation of the relevant ethical and empirical aspects of insect rearing conditions and for establishing welfare criteria based on these evaluations. By addressing several questions and uncertainties from an interdisciplinary perspective of entomology, animal ethics and philosophy of mind, we argue that taking into account current knowledge on insect biology could aid in the emergence of a novel, well-informed and integrated perspective on insect welfare. Ultimately, our goal is to trace the necessary biological factors for designing implementable and appropriate insect rearing conditions, in order to avoid ethical mistakes that have historically been made in animal production systems. [ABSTRACT FROM AUTHOR]

Zoophilic Diptera plays a leading role in the epizootic foci formation of many infectious and parasitic diseases and directly affects the quality of livestock products. The current study aimed to analyze the number and species composition of parasitic Diptera in industrial, farm, and homestead agrobiocenoses of large and small cattle, pig, and poultry farms in Eastern Ukraine. The research involved entomological collection during the peak activity daylight hours in early May, July, and early September 2021-2022 per farm. A total of 360 entomological collections were made, and 4310 zoophilous flies were examined. In livestock farms of five districts of the Kharkiv region of Ukraine, 28 species of zoophilic flies were registered, among which Musca domestica, Muscina stabulans, Stomoxys calcitrans, Lucilia sericata, Protophormia terraenovae, and Drosophila species were dominant species. The analysis revealed that cattle biocenoses hosted 27 fly species, pigs had 8 species, and poultry and small cattle each had 7 species. The study indicated an increase in the population of Musca autumnalis, the main species in the pastures, near livestock premises during the summer. Stomoxys calcitrans was also recorded in livestock agrobiocenoses. The species Musca domestica, Musca autumnalis, and Stomoxys calcitrans account for 78.8% to 88.3% of the entire complex of zoophilous flies. The two species of Ortellia caesarion (shiny dung beetle) and Ortellia cornicina (green dung beetle), known for their role as manure mineralizers and deemed non-threatening to animals, were completely absent during the research period. The findings indicated the species of Eristalis tenax in agrobiocenoses in 2021. Therefore, it can be concluded that zoophilic flies are physical irritants to animals and potential carriers of many infectious diseases, especially diseases caused by unicellular organisms. [ABSTRACT FROM AUTHOR]

Four nitromethylene analogues of imidacloprid (CH-IMIs) having a 4,5-dimethylated (diMe) imidazolidine ring were stereospecifically synthesized to evaluate their affinity for the nicotinic acetylcholine receptors of the housefly Musca domestica. Among the analogues, the 4S,5R-diMe analogue showed the highest receptor affinity (Ki=0.39 nM). The insecticidal activity against M. domestica of the synthesized compounds was also measured under synergistic and nonsynergistic conditions. Under nonsynergistic conditions, the insecticidal activity of the 4S,5R-diMe analogue was the highest. The order of the insecticidal potency of the four diMe-CH-IMIs (4S,5R->4R,5S-= 4R,5R->4S,5S-diMe analogues) was the same as that of the receptor affinity. Piperonyl butoxide (PBO) did not synergize with the test compounds, but both PBO and NIA16388 applications strengthened the activity of analogues other than the 4S,5S-diMe analogue. This suggests that the configuration of the substituents on the imidazolidine ring should influence the metabolism process of CH-IMI in houseflies. [ABSTRACT FROM AUTHOR]

Musca domestica is one of the most important agents in the transmission of pathogenic organisms from contaminated materials to the human body. In various studies, the role of flies in the transmission of many diseases has been well-proven. The purpose of this study was to investigate the bacterial contamination of Musca domestica in different sources. In this study, samples were collected from slaughterhouses, coastal areas, hospital grounds, and urban and rural waste. After collection, the samples were transferred into sterile glass containers and then the isolation and identification of bacterial species was done in the laboratory. Based on the obtained results, Escherichia coli was the dominant species in this study. From all the examined samples, most of the contaminations were related to E. coli, Staphylococcus aureus, Enterobacter aerogenes, and Staphylococcus epidermidis, respectively. Based on the results of this study, it can be said that the presence of these insects in public centers can be carriers of pathogenic agents. Considering the necessity of preventing the spread of infection and pollution in public places and different parts of the environment, it seems necessary to improve and carry out sanitary engineering measures to control these insects. [ABSTRACT FROM AUTHOR]

The morphogenetic consequences of exposure to short-term heat stress (STHS) in two housefly strains mass-selected for lifespan were studied based on the assessment of adult wing variability by geometric morphometrics. Significant differences in the size and shape of the wing between the control and impact groups of different genders in the strains were revealed. Shg (short lived) and Lg (long-lived). The STHS effect manifested in an increase in the size of the wing and a directed change in its shape. The between-group hierarchy of gender and stress-induced differences is expressed in the same way in both strains of flies. The range of linear differences is significantly higher than the gender differences, which, in turn, are higher than the level of stress-induced ones. Instability of imago wing development (Vm) in Shg was significantly higher than the Lg strains, and higher in all groups of females, but in most cases significantly lower in impact groups (taking into account the increase in size, the latter may be associated with the effect of hormesis). It is hypothesized that the directed morphogenetic effects of STHS are based on latent species modifications, the appearance of which in the phenotype is due to stress-induced epigenetic genome rearrangements that cause similar morphological changes in the wing in groups of adult males and females of both strains. The phenotypic plasticity of strains during selection for different lifespans and the changes induced by STHS directly indicate the reality of stress-induced rapid morphogenetic rearrangements under a sharp change in environmental conditions. [ABSTRACT FROM AUTHOR]

Musca domestica salivary gland hypertrophy virus (MdSGHV) affects house flies by enlarging salivary glands, impeding ovary development in females, and mating behavior in both males and females. It is not known if this virus impacts the quantity of saliva produced by house flies. This study aimed to establish baseline saliva quantities in healthy M. domestica across sexes and ages and examine how MdSGHV infection influences saliva output in 5-day-old males. Results reveal that healthy female Musca domestica produce more saliva on average than males and that saliva production among both sexes decreases with age. A comparison of infected, PBS-injected, and healthy flies shows significantly higher saliva quantities in infected individuals, suggesting MdSGHV enhances saliva production to improve transmission. These findings provide insights into MdSGHV transmission dynamics, which may provide for a better understanding of how other vector-borne diseases like Zika and Dengue virus interact in the infected salivary glands of the host vector. [ABSTRACT FROM AUTHOR]