Search

Alopecia is one of the common symptoms after high-dose radiation exposure. In our experiments, neonatal mice that received 7 Gy X-ray exhibited defects in overall hair growth, except for their cheeks. This phenomenon might suggest that some substances were secreted and prevented hair follicle loss in the infant tissues around their cheeks after radiation damage. In this study, we focused on exosome-like vesicles (ELV) secreted from cheek skin tissues and back skin tissues, as control, and examined their radiation protective effects on mouse fibroblast cell lines. We observed that ELV from irradiated cheek skin showed protective effects from radiation. Our results suggest that ELV from radiation-exposed cheek skin tissue is one of the secreted factors that prevent hair follicle loss after high-dose radiation.

From the viewpoints of safety plant operation and improvement of utilization rate of equipment, reduction of the human error in inspection work and efficient maintenance engineering and inspection work are needed. Therefore, we developed a maintenance support tool using augmented reality (AR) technology and 360-degree camera. Furthermore, the self-localization technology using Visual Simultaneous Localization and Mapping (Visual SLAM) technology is adopted. The inspection work and data management which linked with localization data with Visual SLAM technology are the feature of this system. These technologies help users identify equipment, assist users’ recognition and judgment of the object conditions and effective inspection data management.

Intraarticular gene transfer of cyclin-dependent kinase (CDK) inhibitors to suppress synovial cell cycling has shown efficacy in treating animal models of rheumatoid arthritis. Endogenous CDK inhibitors also modulate immune function via a CDK-independent pathway. Accordingly, systemic administration of small molecules that inhibit CDK may or may not ameliorate arthritis. To address this issue, alvocidib (flavopiridol), known to be tolerated clinically for treating cancers, and a newly synthesized CDK4/6-selective inhibitor were tested for antiarthritic effects. In vitro, they inhibited proliferation of human and mouse synovial fibroblasts without inducing apoptosis. In vivo, treatment of collagen-induced arthritis mice with alvocidib suppressed synovial hyperplasia and joint destruction, whereas serum concentrations of anti-collagen type II (CII) Abs and proliferative responses to CII were maintained. Treatment was effective even when therapeutically administered. Treated mice developed arthritis after termination of treatment. Thus, immune responses to CII were unimpaired. The same treatment ameliorated arthritis induced by K/BxN serum transfer to lymphocyte-deficient mice. Similarly, the CDK4/6-selective inhibitor suppressed collagen-induced arthritis. Both small-molecule CDK inhibitors were effective in treating animal models of rheumatoid arthritis not by suppressing lymphocyte function. Thus, the two small-molecule CDK inhibitors ameliorated arthritis models in a distinctive way, compared with other immunosuppressive drugs.

In this investigation, a model for two-phase composites with interpenetrating microstructure has been developed by introducing the concept of matricity into a constitutive relation of particle-reinforced composites. Firstly we consider two models for particle-reinforced composites, namely an αM-model for an α-phase matrix composite and a βM-model for an α-phase particle composite. Elastic and plastic deformation of these composites can be predicted by a theory for particle-reinforced composites based on the Eshelby’s equivalent inclusion method and Mori-Tanaka’s mean field concept. Secondly, a matricity-model is developed under the assumption that the composite with an α-phase volume fraction fα and matricity Mα consists of the parts of αM-model and βM-model in a volume ratio of Mα to 1 − Mα. The model can reasonably predict the elastic–plastic deformation of the composites in a full range of phase composition. This model is also incorporated into a finite element method, and finite element analysis is carried out on the deformation behavior of a functionally graded material.

Human T-cell leukemic virus type 1 (HTLV-1)–infected T cells express the fucosyltransferase (Fuc-T) VIIgene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VIItranscription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5′-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)–responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C–rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)–promoter. Furthermore, CREMα, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

Two viral genes of human T cell leukemia virus type 1, Tax and HBZ, are the focus of current research that aims to understand the oncogenic mechanisms of adult T cell leukemia, which is induced by viral infection. Tax is considered to play critical roles in tumorigenesis by modulating various cellular phenotypes, and the anti-sense gene HBZ was recently reported to counteract various functions of Tax. However, HBZ itself may also play critical roles in tumorigenesis. In this short commentary, I have summarized these apparent paradoxes and discussed the limitations of the mechanisms proposed. It will be critically important to understand the protein levels of HBZ in infected cells and the mode of action of its RNA.

The human T cell leukemia virus-1 (HTLV-1) is a retrovirus that causes adult T cell leukemia (ATL) and neurological disorder, the tropical spastic paraparesis (HAM/TSP). The pathogenesis apparently results from the pleiotropic function of Tax protein, which is a key regulator of viral replication. Tax exerts (a) trans-activation and -repression of transcription of different sets of cellular genes through binding to groups of transcription factors and coactivators, (b) dysregulation of cell cycle through binding to inhibitors of CDK4/6, and (c) inhibition of some tumor suppressor proteins. These effects on a wide variety of cellular targets seem to cooperate in promoting cell proliferation. This is an effective viral strategy to amplify its proviral genome through replication of infected cells; ultimately it results in cell transformation and leukemogenesis.

HTLV-1 Tax oncoprotein exerts pleiotropic effects on cellular regulatory systems, trans-activation and trans-repression of transcription and promotion of the cell cycle, through interaction with various cellular factors. Here, we report Tax-mediated inhibition of DNA topoisomerase I. The interaction of Tax with topoisomerase I was demonstrated in vitro and also in vivo, and inhibition of DNA relaxation activity of topoisomerase I was clearly shown. These results suggested that Tax has a novel potential to affect various cellular processes, such as transcription and maintenance of genomic stability, in which DNA topoisomerase I is involved.

TREB5/hXBP-1/HTF is a basic region leucine zipper protein which binds to a cyclic AMP responsive element (CRE)-like element in both human T-cell leukemia virus type 1 and human major histocompatibility complex (MHC) class II genes. To analyze the structure and transcription regulation of the TREB5 gene, we isolated the mouse TREB5 gene and cDNA. The mouse TREB5 gene contains five exons and four introns and spans approximately 5 kb. The deduced amino acid sequence of mouse TREB5 exhibited 77% and 94% homology to human and rat TREB5, respectively. The b-zip structure is completely conserved in mouse, rat and human. Southern blot analysis of the mouse genomic DNA demonstrated that positive bands exactly coincide with those expected from sequences of the cloned genes, indicating that the mouse TREB5 gene is present as a single copy. The transcription start site of the mouse TREB5 gene was mapped to -15 bp upstream from the ATG initiation codon. Promoter analysis of serial deletion mutants revealed that the -142 bp upstream region is the minimum sequence to promote mouse TREB5 gene expression and that the -1.0 kb upstream region is required for full promoter activity.

HTLV-1 Tax oncoprotein interacts with various cellular factors and modulates transcription and the cell cycle. To identify more cellular targets, we employed the yeast two hybrid system with Tax using a human cDNA library, and isolated a cDNA encoding the human counterpart of Drosophila discs large tumor suppressor protein, hDLG. Tax binding to hDLG was confirmed in vitro and also in HTLV-1-infected T-cells. Furthermore, hDLG was found to be efficiently phosphorylated in Tax-transfected cells and HTLV-1-infected T-cells. The C-terminus of Tax and the PDZ domain of hDLG were responsible for the binding of Tax to hDLG. The C-terminal peptide of Tax prevented the binding of hDLG to APC tumor suppressor gene product, suggesting inhibition of hDLG function by Tax. Over-expression of hDLG in NIH3T3 cells by microinjection induced a reduction of BrdU incorporation into DNA, but co-expression of Tax suppressed this inhibitory effect of hDLG. These results suggest that hDLG arrested the cell cycle and that Tax canceled this inhibitory action of hDLG through targeting hDLG. Therefore, Tax affects this novel regulatory pathway of the cell cycle alteration, of which seems to play a role in the development of human cancer.

Tax protein of human T-cell leukemia virus type 1 (HTLV-1) is a potent transcriptional regulator which can activate or repress specific cellular genes and has been proposed to contribute to leukemogenic processes in adult T-cell leukemia. The molecular mechanism of Tax-mediated trans-activation has been well investigated. However, trans-repression by Tax remains to be studied in detail, although it is known to require a specific DNA element such as E-box or p53 binding site. Examining possible mechanisms of trans-repression, we found that co-expression of E47 and p300 activated E-box dependent transcription and this activation was efficiently repressed by Tax. In this system, Tax bound to p300 and decreased the level of p300 complexed on the E-box element. Similarly, Tax inhibited transcription directed by p53 and CBP, reducing the level of CBP on the p53 binding site. These results indicate that Tax interferes with recruitment of CBP/p300 into protein complexes on E-box and p53 binding site through its binding to CBP/p300. In contrast to these findings, we observed that Tax increased the level of CBP on the viral 21-bp enhancer which is trans-activated by Tax. From these observations, we propose a universal mechanism for Tax-mediated trans-repression and trans-activation of transcription in which Tax binds to CBP/p300 and determines the accessibility of CBP/p300 to protein complexes on specific DNA element.

Tax oncoprotein of human T-cell leukemia virus type 1 (HTLV-1) affects multiple regulatory processes of infected cells through activation and repression of specific transcription and also through modulation of functions of cell cycle regulators. Previously, we found that Tax binds to p16ink4a, a member of the INK4 family of cyclin-dependent kinase inhibitors, and counteracts its inhibitory activity, resulting in cell cycle progression. In this study, we examined the effects of Tax on other members of the INK4 family and found that Tax can bind to p15ink4b similarly to p16ink4a, but not to p18ink4c and p19ink4d. Tax binding to p15ink4b inactivated its function and restored CDK4 kinase activity. Accordingly, Tax-expressing cells became resistant to p15ink4b-mediated growth arrest induced by TGFβ. On the other hand, expression of p18ink4c was transcriptionally repressed by Tax through the E-box element of the promoter, which may contribute to the marked reduction of p18ink4c mRNA in HTLV-1-infected T-cells. These observations indicate that Tax suppresses the inhibitory activities of INK4 family members through two independent mechanisms: functional inhibition of two INK4 proteins and repression of expression of another INK4 protein. These effects may play roles in HTLV-1-induced deregulation of the cell cycle, possibly promoting cellular transformation.

Sox family proteins are characterized by a unique DNA-binding domain, a HMG box which shows at least 50% sequence similarity with mouse Sry, the sex-determining factor. At present almost 30 Sox genes have been identified. Members of this family have been shown to be conserved during evolution and to play key roles during animal development. Some are involved in human diseases, including sex reversal. Here we report the isolation of a novel member of the Sox gene family, Sox30, which may constitute a distinct subgroup of this family. Using a bacterially expressed DNA-binding domain of Sox30, we show that it is able to specifically recognize the ACAAT motif. Furthermore, Sox30 is capable of activating transcription from a synthetic promoter containing the ACAAT motif. The specific expression of Sox30 in normal testes, but not in maturing germ cell-deficient testes, suggests the involvement of Sox30 in differentiation of male germ cells. Mapping analyses revealed that the Sox30 gene is located on human chromosome 5 (5q33) and on mouse chromosome 11.

Human T cell leukemia virus type I infection is associated with a low incidence of morbidity in the form of adult T cell leukemia and neurologic disease, suggesting that there are other factors determining the pathogenic outcome of infection. We found that HCMV could infect various human cell lines known to be susceptible to HTLV-I infection, including T cell lines already harboring HTLV-I, and that HCMV infection could highly activate gene expression from the HTLV-I LTR. In addition, the coexpression of IE1 and IE2 genes of HCMV increased transcription from the HTLV-I LTR. The deletion analysis indicated that the entire U3 region is not required, but that the 216-bp region from + 101 to + 316 is sufficient for activation of the LTR by IE1 and IE2. These results suggest that HCMV IE proteins may affect the level of HTLV-I gene expression in coinfected individuals by interacting with HTLV-I LTR sequences.

Tax protein of human T-cell leukemia virus type 1 (HTLV-1) is a potent trans-activator of specific sets of target genes, and on the other hand, it is a trans-repressor of other sets of genes. It is also an inhibitor of the tumor suppressor protein p16 INK4a and thus has been thought to contribute to induction of adult T-cell leukemia (ATL). We examined the mutagenic effects of Tax on a cellular gene, hypoxanthine guanine phosphoribosyltransferase ( hprt ), and LacI gene in lambda shuttle vector exogenously integrated in Big Blue Rat-2 (BBRat-2) cells. Expression of Tax in BBRat-2 cells enhanced the frequency of HPRT (−) phenotype severalfold. Tax-expressing cell clones, BBTax-1 and -2 established from BBRat-2 cells, gave rise to an average mutation frequency of 5.9 × 10 −5 in LacI gene, but Tax-negative cell clones, BBRat-C1 and -C2, showed 2.1 × 10 −5 . The 2.8-fold increase in mutation frequency in the presence of Tax indicates that Tax expression enhanced mutation frequency in chromosomal DNA. However, neither the mutation spectrum of base transitions, transversions, and deletions/insertions nor the loci of the mutations were significantly affected by Tax expression. These findings indicate that Tax has the capability to induce random mutations and suggest that Tax would be able to modulate cellular phenotypes through mutation of the cellular genome.

We have isolated a novel cDNA clone encoding interferon (IFN) consensus sequence-binding protein in adult T-cell leukemia cell line or activated T cells (ICSAT); this protein is the human homolog of the recently cloned Pip/LSIRF. ICSAT is structurally most closely related to the previously cloned ICSBP, a member of the IFN regulatory factor (IRF) family of proteins that binds to interferon consensus sequences (ICSs) found in many promoters of the IFN-regulated genes. Among T-cell lines investigated, ICSAT was abundantly expressed in human T-cell leukemia virus type 1 (HTLV-1)-infected T cells. When the HTLV-1 tax gene was expressed or phorbol myristake acetate-A23187 stimulation was used, ICSAT expression was induced in Jurkat cells which otherwise do not express ICSAT. When the binding of ICSAT to four different ICSs was tested, the relative differences in binding affinities for those ICSs were determined. To study the functional role of ICSAT, we performed cotransfection experiments with the human embryonal carcinoma cell line N-Tera2. ICSAT was demonstrated to possess repressive function over the gene activation induced by IFN stimulation or by IRF-1 cotransfection. Such repressive function is similar to that seen in IRF-2 or ICSBP. However, we have found that ICSAT has a different repressive effect from that of IRF-2 or ICSBP in some IFN-responsive reporter constructs. These results suggest that a novel mechanism of gene regulation by "differential repression" is used by multiple members of repressor proteins with different repressive effects on the IFN-responsive genes.

Infection of a human retrovirus HTLV-1 induces adult T cell leukemia and a neurological disease, HAM/TSP. Regulatory protein Tax of HTLV-1 is thought to contribute to the pathogenesis. We have studied the mechanism of transcriptional activation induced by Tax protein and identified two independent mechanisms: (a) binding to the enhancer-binding proteins, CREB, CREM, NF-kappa B and SRF, resulting in the activation of these factors through indirect binding to each specific DNA sequence, and (b) binding to I kappa B protein resulting in the suppression of the negative regulator I kappa B, which binds to NF-kappa B. In addition to these factors, a new protein GLI/THP is also involved in the transactivation. On the basis of these mechanisms, gene regulations in vitro and in vivo in HTLV-1-infected cells are discussed.

Tax protein of HTLV-1 triggers transcriptional activation through enhancers, NF-kappa B binding site, 21-bp enhancer, and serum response element. Previously, we demonstrated binding of Tax to transcription factors NF-kappa B1 p105 and p50. Here, we report that Tax enhances expression of NF-kappa B2 at the mRNA level and proteins; the effect was more apparent on the p52 expression than on its precursor p100, suggesting post-translational regulation. Consistent with these observations, HTLV-1-infected T-cell lines expressed higher levels of p52. Tax binds to the protein products p52 and p100 which inhibits NF-kappa B proteins forming cytoplasmic complexes; the binding to p100 was preferential over NF-kappa B1 p105. However, Tax did not induce efficient dissociation of the cytoplasmic complexes p100/c-Rel or p100/p65, and thus did not induce nuclear translocation of c-Rel or p65. This was in sharp contrast to the previous observation that Tax dissociated the p105/c-Rel and I kappa B-gamma/p65 complexes. These results indicate that HTLV-1 Tax interacts with NF-kappa B2 p100 and p52 and upregulate the NF-kappa B function, but their contribution to Tax-mediated transcriptional regulation differs from those of NF-kappa B1.

The cyclic AMP-response element (CRE), a transcriptional enhancer, is regulated by CREB (CRE-binding protein) which is the leucine zipper protein phosphorylated by protein kinase A in response to cAMP signal. The highly homologous protein CREM (CRE-modulator) is thought to modulate CREB-stimulated transcription, and is also involved in transcriptional control during spermatogenesis. In this paper, we report two types of cDNAs of human CREM (hCREM), type 1 and type 2; type 1 is a group of human counterparts of the mouse CREM alpha and type 2 is a novel form having a distinct 5' exon which is unrelated to any species of the CREB and CREM isoforms so far described. This unique 5' region of type 2 hCREM may suggest its independent expression from type 1 CREM. The specific 5' region of type 2 hCREM consisted of 88 bp, containing an initiation codon for translation, but no possible phosphorylation site, suggesting different roles from type 1 CREM. Both type 1 and 2 hCREMs are expressed in lymphoid and non-lymphoid cell lines. Their excess expression by transfection induced suppression of cAMP-mediated activation of transcription, suggesting their negative regulation of CRE-mediated transcription.

The human T cell leukemia virus type 1 (HTLV-1) is a retrovirus that causes adult T cell leukemia and the neurological disorder tropical spastic paraparesis. Pathology apparently results from the activities of the Tax protein, which trans-activates the expression of viral and cellular genes by binding to various enhancer-binding proteins needed for transcription. This ultimately results in cell transformation, immortalization and disease.

Deletion mutants in the 5′ upstream sequence of the human CYP21A2 gene demonstrated a novel regulatory DNA element responsible for cAMP-dependent expression of the gene in the transient expression system using Y-1 cells (mouse adrenocortical tumor cell line). This regulatory element (-2574 to -2489 bp) was also found to exhibit a strong enhancer activity through heterologous promoters in response to cAMP and to contain a sequence like the cAMP-responsive element (CRE) and a CAAT-like sequence. The CRE-like sequence has a five-base motif (5′-TGACG-3′) of the palindromic CRE consensus (TGACGTCA). Competitive gel mobility shift assays using nuclear extracts of bovine adrenal cortex with sequences typical of the binding sites for the binding proteins of CRE and the CAAT-like sequence revealed that these binding proteins, or related factors, bound to their cognate DNA binding sites in the upstream enhancer region of the CYP21A2 gene. These two enhancer elements and their cognate binding factors cooperate with previously identified tissue-specific enhancers (adrenal-specific protein factor and Ad4-like sequences) and their binding factors to express a high level of cAMP-responsive expression of the CYP21A2 gene.

Nucleotide sequences of two HTLV-I proviruses isolated from Indian patients with HAM/TSP were analyzed. The sequence data of the env, pX, and LTR regions showed 98-99% homologies with the prototype HTLV-I, ATK-1, isolated from a Japanese ATL patient, indicating that HTLV-I isolates in India and Japan are similar, with minor variations. However, certain small sequences of noncoding regions in the pX and LTR showed differences of 6.1 and 7.2%, respectively, thus the conclusion could vary depending on the regions and length of the s0equences used for comparison.

The trans-activator protein Tax of human T-cell leukemia virus type 1 (HTLV-1) activates the viral 21-base-pair (bp) enhancer in the long terminal repeat and has been suggested to associate indirectly with the enhancer DNA. To demonstrate this, we used DNA-affinity precipitation assay and detected the Tax protein in 21-bp DNA-protein complexes isolated from HTLV-1-infected cells. To identify cellular components in the complexes, we tested various 21-bp DNA-binding proteins by gel electrophoretic mobility-shift assay. Each binding protein gave a shifted band of each 21-bp DNA-protein complex, and exogenously added Tax protein further shifted these bands of cAMP-responsive element (CRE) binding protein (CREB) and CRE modulator but did not shift other bands. Anti-Tax antibodies blocked formation of the complex, indicating complex formations of [Tax-CREB(or CRE modulator)-21-bp DNA]. The formations of these complexes paralleled the functional activities of Tax mutants. Furthermore, the Tax-CREB complex was detected in a nuclear extract of HTLV-1-infected cells, and the Tax-CREB-21-bp-DNA complex was demonstrated as a major component of Tax complexes containing the 21-bp DNA probe. These observations indicate that Tax protein binds to CREB and CRE modulator and the complexes then bind to the 21-bp enhancer, suggesting that the complex binding to the enhancer mediates trans-activation of transcription.

The human IL-3 gene, located on chromosome 5, contains several cis-acting DNA sequences, i.e. CLE (conserved lymphokine element) and a GC-rich region, similar to the GM-CSF gene. To investigate the role of these elements, the 5' flanking region of the IL-3 gene was attached to a bacterial chloramphenicol acetyltransferase (CAT) gene. The fusion plasmids were analyzed by an in vitro transcription system using Jurkat cell nuclear extract prepared from cells stimulated with phorbol-12-myristate-13-acetate and calcium ionophore (PMA/A23187), introduced into Jurkat cells, expressed transiently, and stimulated by co-transfection of human T cell leukemia virus type I (HTLV-I) encoded transactivator, p40tax. The GC-rich region enhanced TATA-dependent transcription in the in vitro transcription system and also strongly responded to p40tax stimulation in the in vivo cotransfection assay. Using this GC-rich region as a probe, we identified a constitutive DNA-protein complex, alpha, whose binding specificity correlates with transcription activity. However, this element is not sufficient for the expression of the IL-3 gene in response to T cell activation signals (PMA/A23187) and no sequence was found within the IL-3 gene which mediates the response to PMA/A23187. The enhancer sequence which responds to T cell activation signals may be located outside the IL-3 gene and may be shared by other lymphokines, possibly by GM-CSF. We propose that the GM-CSF enhancer (CLE2/GC box) which mediates the response to T cell activation signals may stimulate the expression of the IL-3 gene.

The long terminal repeat (LTR) of HTLV-1 consists of U3-R-U5 and contains elements which regulate the viral gene expression. In addition to these elements, we found that the U5 sequence contained a repressive element in the gene expression. Sequential deletions of the LTR substantially increased CAT expression of a LTR-CAT construct. The repressive effect was also observed at RNA level on unspliced RNA, but not on spliced RNA. These differential effects suggest that the U5 element is a cis-acting RNA element, since splicing within the R segment removed the U5 element. In the context of HTLV-1 gene expression, the U5 element would repress expression of unspliced genomic RNA of HTLV-1, but not subgenomic RNA.

I briefly review the discovery and characterization of the first human retrovirus, human T-cell leukemia virus type 1, focusing on contributions from Japanese researchers. The unique regulatory mechanisms for the viral regulation with Tax and Rex, etiology of ATL and possible leukemogenic mechanism with Tax are also discussed briefly.

TREB5 (hXBP-1) is a basic region leucine zipper protein which binds to a CRE-like element in both human T-cell leukemia virus type 1 and MHC class II genes. To study the function(s) of TREB5 in normal development, we have generated TREB5 deficient mice by gene targeting. Heterozygous mutant mice have not exhibited any obvious abnormalities; however, homozygous mutant embryos die between embryonic days 10.5 and 14.5. The major defect responsible for lethality is cellular necrosis of cardiac myocytes located at the atrium and the truncus arteriosus with its following ventricle. Necrotic alteration was not observed in either the endocardial cushion or the conotruncal ridge. These results indicate that TREB5 plays an essential role in maintenance and/or growth of cardiac myocytes during cardiogenesis.

The long terminal repeat (LTR) of human T-cell leukemia virus type 1 (HTLV-1) has two distinct DNA elements, one copy of TRE2S and three copies of a 21-bp sequence that respond to the viral trans -activator protein, Tax. Either multiple copies of the 21-bp sequence or a combination of one copy each of TRE2S and 21-bp sequence is required for efficient trans activation by Tax. In the trans activation of multiple copies of 21-bp sequence, CREB/ATF protein plays an essential role in forming a complex with Tax. To understand the role of TRE2S in trans activation of one copy of 21-bp sequence, we examined protein binding to the DNA elements by DNA affinity precipitation assay including Gli2 protein binding to TRE2S and CREB protein binding to 21-bp sequence. Binding of CREB to a DNA probe containing both elements, TRE2S-21bp probe, was dependent on Gli2 protein under restricted conditions and was enhanced in a dose-dependent fashion by the binding of Gli2 protein to the same probe. Mutation in either element abolished the efficient binding of CREB. A glutathione S -transferase fusion protein of a fragment of Gli2 was able to bind to CREB. Therefore, Gli2-CREB interaction on the DNA probe is proposed to stabilize CREB binding to DNA. Tax can bind to CREB protein on the DNA; therefore, stabilization of DNA binding of CREB results in more recruitment of Tax onto DNA. Conversely, Tax increased the DNA binding of CREB, although it had almost no effect on the binding of Gli2. These results suggest that Gli2 binds to the DNA element and interacts with CREB, resulting in more recruitment of Tax, which in turn stabilizes DNA binding of CREB. Similar cooperation of the protein binding to TRE2S-21bp probe was also observed in nuclear extract of an HTLV-1-infected T-cell line. Consistent with the Gli2-CREB interaction on the DNA elements, Tax-mediated trans activation was dependent on the size of the spacer between TRE2S and 21-bp sequence. The effective sizes of the spacer suggest that TRE2S in the LTR would cooperate with the second and third copies of the 21-bp sequence and contribute to trans activation of the viral gene transcription.

• A retrovirus was isolated from a T-cell line that was established from lymphocytes in the cerebrospinal fluid of a patient with human T-cell leukemia virus type I-associated myelopathy (HAM), and its genome was sequenced. The nucleotide sequence of the 3' half of the total genome was identical in 99.5% of the nucleotides to that of the prototype human T-cell leukemia virus type I that was derived from a patient with adult T-cell leukemia. These results indicate that the same retrovirus human T-cell leukemia virus type I is associated with both a neurological disease, HAM, and a lymphoproliferative disease, adult T-cell leukemia.

The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 α, β, γ, and δ) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, α and β, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity.

Human T-cell leukemia virus type 1 (HTLV-1) is an etiologic agent of adult T-cell leukemia (ATL) and of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Recently it has been reported that defective HTLV-1 provirus was detected frequently in the central nervous system (CNS) lesions of HAM/TSP patients. Here we investigated sequence variations of the pX region of HTLV-1 in the CNS and peripheral blood lymphocytes (PBL) of the same patient. The results analyzing 9-13 clones isolated from each specimen indicated that the pX region is highly variable within a patient with HAM/TSP, and the mutations were found at almost random positions within the sequences analyzed. The frequency and pattern of those mutations did not appear to differ significantly between the CNS and PBL of the same patient, although they differed among patients. Similarly, frequent mutations were observed in an asymptomatic carrier of HTLV-1, although the variability was moderate, suggesting that the high variability of the pX sequence is not a specific event in HAM/TSP. However, one asymptomatic carrier showed much less frequent variations very similarly to an ATL patient; both of them harbored clonally expanded infected cells. Thus the apparent low variability was explained by clonal selection of a single species of the provirus by the clonal proliferation of infected cells. These results clearly indicate that mutations including defectives are not specifically associated with the CNS lesions in HAM/TSP patients, but suggest that the random mutations simply reflect the rate of viral replication in individuals and the variants were not inherited frequently.

Patients with human T-cell leukemia virus type-1 (HTLV-1)-associated myelopathy (HAM/TSP) generally harbor a much greater population of HTLV-1-infected T cells in peripheral blood mononuclear cells (PBMCs) than asymptomatic carriers. These cells are not malignant but frequently proliferate clonally. To investigate the possibility that higher expression of the viral activator Tax induces preferential proliferation of infected nonmalignant T cells in HAM/TSP patients, the expression of Tax mRNA in fresh PBMCs was analyzed by reverse transcriptase-mediated polymerase chain reaction. Total amount of Tax mRNA was higher in HAM/TSP patients than in carriers, but the expression level was almost the same as that in asymptomatic carriers when compared per infected cell. The expression levels in adult T-cell leukemia patients were significantly lower than those in HAM/TSP patients and asymptomatic carriers. These results indicate that tax gene is not expressed at a continuously high level in HAM/TSP patients who carry a high population of infected T cells, even in those with clonally proliferated infected T cells.

TREB5 (hXBP-1) protein is a transcription factor that recognizes the CRE-like element in enhancers of human T-cell leukemia virus and MHC class II gene and activates their transcription. TREB5 is a member of the CREB/ATF family, containing a basic amino acid region and leucine zipper structure (b-Zip structure). To characterize the key domain of TREB5 for transcriptional activation, mutational analysis was carried out. The C-terminal region of 148-221 amino acids was identified as an activation domain and was also active when fused to Gal4 DNA binding domain. This domain contains three unique regions rich in glutamic acid, glutamine, or serine/threonine and is active in both osteosarcoma (HOS) and T (Jurkat) cell lines. All of these three regions are essential; however, a part of the serine/threonine region was dispensable in Jurkat, but not in HOS cells. In addition to the activation domain, the N-terminal region showed activity in conjunction with the b-Zip structure, but not with the Gal4 DNA binding domain. Furthermore, this region showed activity in Jurkat cells, but not in HOS cells. These results suggest that TREB5 has two activational functions in transcription and may provide diversity in cell-type-specific transcriptional activation, possibly through dimerization with other b-Zip proteins and phosphorylation.

Japan is one of the highest endemic areas of the world for human T cell leukemia-lymphoma virus type I (HTLV-I). To gain new insight as to the origin of this virus in Japan and especially in the southern islands of the archipelago, we investigated the long terminal repeat (LTR) of 67 newly isolated HTLV-I proviral DNAs from peripheral blood mononuclear cells of HTLV-I-infected individuals for their restriction fragment length polymorphism (RFLP). The specimens were from Japanese living in different geographical areas (Hokkaido, Honshu, Kyushu, or the Ryukyu Islands) of Japan (59 cases) or Americans of Japanese ancestry living in Hawaii (8 cases). The analysis of the results, together with data for the 19 previously published LTR sequences, demonstrated the existence of 2 subtypes of HTLV-I in Japan. The first, which we propose to name Japanese subtype (previously named subtype III), is more frequent (67 of 86: 78%) than the second, the cosmopolitan subtype (previously named subtype II) (19 of 86: 22%). In parallel, a fragment of 413 base pairs of the U3/R region (nucleotide 22 to 434) was cloned and sequenced from 10 of the new Japanese samples. The alignment of these sequences and their comparison and phylogenetic analysis with previously published LTR HTLV-I sequences, demonstrated clearly the existence of the two distinct molecular subtypes of HTLV-I in Japan, diverging in this LTR region by about 1.6%. Furthermore, the study of the geographical distribution of the 2 subtypes among the 80 samples from patients whose place of residence in Japan was known showed an uneven distribution. While the Japanese subtype was present in all parts of Japan, the cosmopolitan subtype seemed to cluster in the southern islands of the archipelago (i.e., Kyushu and the Ryukyu Islands) as well as in immigrants from those areas who had lived in Hawaii for decades. These new molecular data raise questions and suggest hypotheses, discussed here, concerning the origin and means of dissemination of these human retrovirus subtypes in Japan.

Human T-cell leukemia virus type I causes adult T-cell leukemia and tropical spastic paraparesis, and its regulator protein Tax has been implicated in the pathogenic activity of human T-cell leukemia virus type I. Tax activates transcription of viral and cellular genes through specific enhancers: the 21-bp enhancer of human T-cell leukemia virus type I, the nuclear factor kappa B (NF-kappa B)-binding site of the interleukin 2 receptor alpha gene, and the serum-responsive element of c-fos. Tax binds to enhancer-binding proteins including cAMP-responsive element-binding protein, cAMP-responsive element modulator, transcription factor NF-kappa B p50 and p67SRF, and associates with each enhancer DNA indirectly. In addition to this mechanism, we report here that Tax binds to inhibitory factor kappa B gamma (I-kappa B) gamma, which forms a complex with NF-kappa B protein heterodimer p50-p65 or homodimer p50-p50 and retains them in the cytoplasm. Tax binding to I-kappa B gamma induces nuclear translocation of NF-kappa B p65. In association with this nuclear translocation of p65, transcription directed by the kappa B enhancer is strongly activated. Tax binds to the ankyrin motifs of I-kappa B gamma, suggesting its possible interaction with many other proteins carrying ankyrin motifs contributing to various regulatory processes. This is a different mechanism of transcriptional activation by the oncoprotein Tax and seems to be independent from the trans-activation through indirect binding to enhancer DNAs.

Limited nucleotide sequences of human T-cell lymphotropic virus type I (HTLV-1) provirus isolated from the first case of a Korean patient with HTLV-I associated myelopathy and tropical spastic paraparesis (HAM/TSP) were analysed and compared with other isolates from different regions of the world. The sequences of the env, LTR regions (536bp, 690bp respectively) showed 98.7%, 99.3% homologies with the prototype HTLV-I, ATK-1, isolated from a Japanese Adult T-cell leukemia (ATL) patient. A comparison between other isolates from different geographical origins revealed that the Korean HTLV-I isolate is more closely related to Japanese isolates than to those from other geographical origins.

The wild-type p53 protein suppresses transformation, but certain missense mutants of p53 can transform cells. Although the wild-type p53 protein contains a transcriptional activation domain, no p53-responsive element has been identified. Here, we identified the p53-responsive element within the Tax-responsive element [21-base-pair (bp) enhancer] of human T-cell leukemia virus type I. Mutation analysis of the 21-bp enhancer indicated that the 16-bp sequence containing the cAMP-responsive element and its surrounding sequence was responsible for p53-induced transactivation. This 16-bp sequence was demonstrated to bind specifically to wild-type human p53 protein in vitro. Using a series of deletion mutants of p53, we showed that almost the entire region of p53 is needed for the transactivating capacity. Furthermore, the transforming mutants of p53 were unable to act as transcriptional activators. The p53-responsive element identified here should be useful to analyze the mechanism by which p53 regulates expression of a set of genes with a negative effect on cellular growth.

The kappa B sequence (GGGACTTTCC) binds a factor, NF-kappa B, that is constitutively found in its functional, DNA binding form only in B lymphocytes. A factor with apparently indistinguishable sequence specificity can be induced in many other cell types, where it is used to regulate inducible gene expression. For example, kappa B-related sequences have been shown to be important for the transcription of a few inducible genes, such as the interleukin 2 receptor alpha-chain gene and the beta-interferon gene. However, these genes are not constitutively active in B lymphocytes, suggesting that other regulatory mechanisms must play a role in determining the patterns of expression. We have investigated the constitutive and inducible transcriptional activity mediated by five kappa B-related sequence elements in two different cell types. We show that in S194 plasma cells the activity of each element correlates well with the relative affinity of B-cell-derived NF-kappa B for that element. This leads to significantly lower transcription enhancement by sites derived from the interleukin 2 receptor or T-cell receptor genes in S194 cells. However, in either EL-4 (T) cells or S194 cells, both lower-affinity sites can be significantly induced by the tax gene product of human T-cell leukemia virus type I, showing that NF-kappa B activity can be modulated even in a B-cell line that constitutively expresses this factor.