Search

This study aimed to identify gene expression markers shared between both influenza hemagglutination inhibition (HAI) and virus-neutralization antibody (VNA) responses. We enrolled 158 older subjects who received the 2010-2011 trivalent inactivated influenza vaccine. Influenza-specific HAI and VNA titers and mRNA-sequencing were performed using blood samples obtained at Days 0, 3 and 28 post vaccination. For antibody response at Day 28 versus Day 0, several gene sets were identified as significant in predictive models for HAI (n=7) and VNA (n=35) responses. Five gene sets (comprising the genes MAZ, TTF, GSTM, RABGGTA, SMS, CA, IFNG and DOPEY) were in common for both HAI and VNA. For response at Day 28 versus Day 3, many gene sets were identified in predictive models for HAI (n=13) and VNA (n=41). Ten gene sets (comprising biologically related genes, such as MAN1B1, POLL, CEBPG, FOXP3, IL12A, TLR3, TLR7 and others) were shared between HAI and VNA. These identified gene sets demonstrated a high degree of network interactions and likelihood for functional relationships. Influenza-specific HAI and VNA responses demonstrated a remarkable degree of similarity. Although unique gene set signatures were identified for each humoral outcome, several gene sets were determined to be in common with both HAI and VNA response to influenza vaccine.

Modern insensitive high explosives HE are heterogeneous materials consisting of a mixture of explosive grains within a polymeric binder matrix [1]. The mechanical material behaviour is strongly determined by this heterogeneous structure. The stiffness and strength comes mainly from the explosive grains whereas the softer polymeric binder is responsible for the viscoelastic behaviour. Depending on the mechanical loading regime different mechanisms are present and must be taken into account for the material modelling.

Smallpox was eradicated 34 years ago due to the success of the smallpox vaccine; yet, the vaccine continues to be studied because of its importance in responding to potential biological warfare and the adverse events associated with current smallpox vaccines. Interindividual variations in vaccine response are observed and are, in part, due to genetic variation. In some cases, these varying responses lead to adverse events, which occur at a relatively high rate for the smallpox vaccine compared with other vaccines. Here, we aim to summarize the cytokine responses associated with smallpox vaccine response to date. Along with a description of each of these cytokines, we describe the genetic and adverse event data associated with cytokine responses to smallpox vaccination.

Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

Global effects caused by the detonation of an IED near a military vehicle induce subsequent severe acceleration effects on the vehicle occupants. Two concepts to minimize these global effects were developed, with the help of a combined method based on a scaled experimental technology and numerical simulations. The first concept consists in the optimization of the vehicle shape to reduce the momentum transfer and thus the occupant loading. Three scaled V-shaped vehicles with different ground clearances were built and compared to a reference vehicle equipped with a flat floor. The second concept, called dynamic impulse compensation (DIC), is based on a momentum compensation technique. The principal possibility of this concept was demonstrated on a scaled vehicle. In addition, the numerical simulations have been performed with generic full size vehicles including dummy models, proving the capability of the DIC technology to reduce the occupant loading.

We previously reported HLA allelic associations with vaccinia virus (VACV)-induced adaptive immune responses in a cohort of healthy individuals (n = 1,071 subjects) after a single dose of the licensed smallpox (Dryvax) vaccine. This study demonstrated that specific HLA alleles were significantly associated with VACV-induced neutralizing antibody (NA) titers (HLA-B*13:02, *38:02, *44:03, *48:01, and HLA-DQB1*03:02, *06:04) and cytokine (HLA-DRB1*01:03, *03:01, *10:01, *13:01, *15:01) immune responses. We undertook an independent study of 1,053 healthy individuals and examined associations between HLA alleles and measures of adaptive immunity after a single dose of Dryvax-derived ACAM2000 vaccine to evaluate previously discovered HLA allelic associations from the Dryvax study and determine if these associations are replicated with ACAM2000. Females had significantly higher NA titers than male subjects in both study cohorts [median ID50 discovery cohort 159 (93, 256) vs. 125 (75, 186), p < 0.001; replication cohort 144 (82, 204) vs. 110 (61, 189), p = 0.024]. The association between the DQB1*03:02 allele (median ID50 discovery cohort 152, p = 0.015; replication cohort 134, p = 0.010) and higher NA titers was replicated. Two HLA associations of comparable magnitudes were consistently found between DRB1*04:03 and DRB1*08:01 alleles and IFN-γ ELISPOT responses. The association between the DRB1*15:01 allele with IFN-γ secretion was also replicated (median pg/mL discovery cohort 182, p = 0.052; replication cohort 203, p = 0.014). Our results suggest that smallpox vaccine-induced adaptive immune responses are significantly influenced by HLA gene polymorphisms. These data provide information for functional studies and design of novel candidate smallpox vaccines.

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p

Immune response variations after vaccination are influenced by host genetic factors and demographic variables, such as race, ethnicity and sex. The latter have not been systematically studied in regard to live rubella vaccine, but are of interest for developing next generation vaccines for diverse populations, for predicting immune responses after vaccination, and for better understanding the variables that impact immune response.We assessed associations between demographic variables, including race, ethnicity and sex, and rubella-specific neutralizing antibody levels and secreted cytokines (IFNγ, IL-6) in two independent cohorts (1994 subjects), using linear and linear mixed models approaches, and genetically defined racial and ethnic categorizations.Our replicated findings in two independent, large, racially diverse cohorts indicate that individuals of African descent have significantly higher rubella-specific neutralizing antibody levels compared to individuals of European descent and/or Hispanic ethnicity (p0.001).Our study provides consistent evidence for racial/ethnic differences in humoral immune response following rubella vaccination.

Although endemic goiter has been shown to have a high prevalence in Turkey, little is known about the concentration of urinary iodine, plasma selenium (Se), copper (Cu), and zinc (Zn) in these patients. We studied on 140 male patient with endemic goiter (mean age: 22.2 +/- 0.19 yr) and 140 healthy male subjects (mean age: 21.8 +/- 0.28 yr). Daily urinary iodine excretion was determined by the ionometric method. Plasma Se, Zn, and Cu were determined by using atomic absorption spectrometry. Daily urinary iodine excretion was found to be significantly lower in the patient group (38.7 +/- 2.26 microg/d) than that of controls (50.73 +/- 2.56 microg/day, p = 0.001). Plasma Zn concentrations were also found to be significantly lower in the patient group (1.04 +/- 0.03 microg/mL) than that of controls (1.16 +/- 0.02 microg/mL, p = 0.001). No significant difference was determined in Se and Cu concentrations between the patient and control groups. Our study shows that a moderate iodine deficiency exists in both patients with endemic goiter and control subjects, which indicates the important role of iodine deficiency in the etiopathogenesis of endemic goiter in Turkey. Zinc deficiency may also contribute to the pathogenesis of endemic goiter. However, Se and Cu do not seem to have any role in the etiopathogenesis of endemic goiter in Turkey. A community-based iodine fortification program throughout the country may be proposed to take over the problem, which also can prevent the contributing effects of other element deficiencies that occur when iodine deficiency is the prevailing factor.

Differential thermal analysis has been carried out on AgGaS2 samples in order to investigate the relationship between the superheating of the melt and the supercooling behaviour of the material leading to an improvement of crystal growth conditions. The knowledge gained will be correlated to the crystal growth experiments which had been carried out by using the gradient freezing method.

The immunogenicity and efficacy of influenza vaccination are markedly lower in the elderly. Granzyme B (GrzB), quantified in fresh cell lysates, has been suggested to be a marker of cytotoxic T lymphocyte (CTL) response and a predictor of influenza illness among vaccinated older individuals. We have developed an influenza-specific GrzB ELISPOT assay using cryopreserved PBMCs. This method was tested on 106 healthy older subjects (ages 50-74) at baseline (Day 0) and three additional time points post-vaccination (Day 3, Day 28, Day 75) with influenza A/H1N1-containing vaccine. No significant difference was seen in GrzB response between any of the time points, although influenza-specific GrzB response appears to be elevated at all post-vaccination time points. There was no correlation between GrzB response and hemagglutination inhibition (HAI) titers, indicating no relationship between the cytolytic activity and humoral antibody levels in this cohort. Additionally, a significant negative correlation between GrzB response and age was observed. These results reveal a reduction in influenza-specific GrzB response as one ages. In conclusion, we have developed and optimized an influenza-specific ELISPOT assay for use with frozen cells to quantify the CTL-specific serine protease GrzB, as a measure of cellular immunity after influenza vaccination.

CdTe 0.9 Se 0.1 :Cl is a detector grade material for gamma and X-rays. Its high resistivity and the high mobility lifetime product yield a high charge collection efficiency of 90 percent. CdTe 0.9 Se 0.1 :Cl was used for the first time to built up a strip detector. The detector performance was investigated by a 57 Co source. The signal behaviour, charge collection efficiency and coupling effects were analyzed for different strips. The comparison between the signal amplitude of all strips showed a good homogeneous response for the device. For a single strip a charge collection efficiency of more than 40 percent was obtained.

The influence of growth conditions on radiation detector performance was studied by examining Cd(Te,Se):Cl crystals. They were grown by the travelling heater method under microgravity conditions during the PHOTON 8 mission. An additional forced convection was produced by a rotating magnetic field (400 Hz) of 2 mT. The influence on crystal quality was analyzed by several characterization methods such as time dependent charge measurement, photo-induced current transient spectroscopy and admittance spectroscopy. The charge collection efficiency of detectors was increased from 10% without magnetic field up to 66% by the influence of the rotating magnetic field. The improved detector performance is explained by the increased resistivity and a reduced number of deep levels.

CdTe:Cl crystals were grown from the liquid and from the vapour phase under microgravity (μg) conditions on board the unmanned EURECA I mission. The resistivity distribution of the grown crystals was measured by time dependent charge measurement (TDCM). Photo induced current transient spectroscopy (PICTS) was used to investigate the deep level properties. The axial resistivity distributions of the crystals grown in space differ significantly from 1 g reference crystals. In the case of vapour growth, these differences can be explained by an additional laminar flow under 1 g conditions. Supercooling has to be considered in growth from a Te zone under μg.

We investigated the optical properties of defects in CdTe and ${\mathrm{Cd}}_{1\mathrm{\ensuremath{-}}\mathit{x}}$${\mathrm{Zn}}_{\mathit{x}}$Te (0x1). Residual impurities give rise to specific far infrared absorptions, while metal vacancy-donor complexes (A centers), identified by optically detected magnetic resonance, are characterized by their near infrared (1.4 eV) photoluminescence (PL) properties. The specific zero-phonon-line positions and phonon couplings are worked out for these complexes involving different group-VII (F, Cl, Br, In) or group-III (In, Al) donors. In addition to the A center PL two emission bands are found at 1.135 and at 1.145 eV. The temperature dependences of the PL show that the 1.145 eV luminescence follows the temperature dependence of the band gap, while the energy position of the 1.135 eV band emission shifts to higher energies with increasing temperature. The A-center PL and the luminescence bands at 1.1 eV are investigated throughout the complete alloy composition range form x=0 to 1. The A center and the 1.135 eV band were found to follow the band-gap shift from CdTe to ZnTe, whereas the 1.145 eV luminescence keeps its emission energy constant.

Semi-insulating titanium and vanadium doped cadmium telluride crystals were grown from the vapour phase. We show results of the electrical characterisation obtained by Hall measurements, photoinduced current transient spectroscopy (PICTS), admittance spectroscopy and time-of-flight measurements. The crystals with a resistivity of about 10 9 Ω · cm showed a deep level, which was identified for CdTe:V at −0.77 eV and a similar value at −0.66 eV for CdTe:Ti, both with reference to the conduction band. The μτ products are almost the same for both materials in the range of 10 −5 cm 2 /V. A compensation model, which was developed for semi-insulating GaAs, is adapted to semi-insulating vanadium- and titanium-doped cadmium telluride. We show that the data from the compensation model correspond to the measured properties.

CdTe is one of the most encouraging semiconductor materials in the field of room temperature γ- and X-ray spectroscopy. To improve the detector properties, the ternary systems (Cd,Zn)Te and Cd(Te,Se), and CdTe were grown by vertical Bridgman technique. To achieve low noise detectors, the resistivity of all materials was increased by chlorine doping. The crystals were characterized by electrical (Hall measurements, photoinduced current transient spectroscopy) methods. The numbers of deep levels influencing the resistivity were reduced by introducing Se into the CdTe system. A common deep level close to the middle of the bandgap has been identified, responsible for the compensation effect in all three systems. In addition high resistivity and n-type conductivity were achieved in CdTeSe materials for the first time

CdTe and CdTe 0.9 Se 0.1 crystals were grown by the travelling heater method under different material transport regimes. The different transport regimes in the liquid zone were either caused by diffusion (and residual convection), or by 1 g convection, or by forced convection. The forced convection was produced by a B=2 mT rotating magnetic field (400 Hz) under μg conditions. The equations for describing the model of the rotating magnetic field are derived, showing that the magnetic force term in the Navier-Stokes equation can be calculated separately in the case of μg conditions and small magnetic field. The rotating magnetic field generates a stable steady flow in the solution zone, which improves the radial and axial distribution of μτ products

We present results of electron paramagnetic resonance (EPR) and optical spectroscopy on different charge states of the transition metal impurity iron in ZnTe and CdTe. We identify the energy level position of the Fe+ acceptor in ZnTe at Ev + 1.7eV and estimate its position in CdTe. Ionisation transitions from Fe+to the conduction and valence bands ar found in both absorption spectroscopy and photo-EPR. Optical intra-defect tracsitions from Fe+ to crystalfield-split excited states ar resolved for the first time. This assignment to Fe2+ is based on optically detected EPR. Application of both far-infrared Fourier transform and EPR spectroscopy allows the determination of the total iron concentration in all charge states.

Optically detected and conventional spin resonance investigations have been successful in determining the structure of cation vacancy-donor pairs (A-centers) and anion vacancies ( V Te ) in CdTe. Investigations in the ternary alloy systems Cd1−xZnxTe for the complete range of x show that the A-center binding energy is almost independent of the composition. In CdTe the VTe+/0 level position is 0.2 eV above the valence band and correlation to a deep luminescence band at 1.15 eV can be drawn. In the alloys this photoluminescence band closely follows the conduction band from CdTe to ZnTe. Studies of the spectroscopic g- values of the shallow donors in Cd 1−x Zn x Te show that they shift linearly from -1.69 in CdTe to -0.4 in ZnTe.

Cd1−xZnxTe crystals grown by the traveling heater method have been investigated by low‐temperature photoluminescence. The excitonic energy gap as a function of the alloy composition was determined over the complete range of x=0 to x=1. The composition dependent broadening of the neutral acceptor bound exciton (A 0X) line was determined. Theoretical calculations, where the A 0X exciton is treated within the pseudodonor model and the conduction/valence band offset between CdTe and ZnTe is taken into account, give close agreement with the experiment for x≤0.77. Evidence for clustering of Zn atoms is found for x≥0.77.

Einkristalle der bei Raumtemperatur stabilen (RT) Phase der Verbindung TlSbSe2 wurden durch Sublimation bei 350°C erhalten. Die Kristalle sind monoklin, Raumgruppe P21 (No. 4), a = 9,137(1) A, b = 4,097(1) A, c = 12,765(2) A, β = 111,75(1)°, Z = 4. Im Gegensatz zu der Hochtemperaturphase (HT) weist die RT-Phase eine streng geordnete Kationenverteilung auf. Das Kristallgitter bildet eine Schichtstruktur parallel (001), bei der die Sb-Atome von (3 + 2), die Tl von (1 + 4) Se-Atomen innerhalb einer Schicht koordiniert sind. Die Kristallstruktur der RT-Phase der Verbindung TlSbSe2 kann als Uberstruktur der HT-Phase beschrieben werden. Die Uberstrukturordnung und ein Modell der Verzwillingung werden diskutiert. Crystal Structure of the Ordered Phase of the Compound TlSbSe2 Single crystals of the RT-phase of the compound TlSbSe2, which are stable at room temperature, were prepared by sublimation at 350°C. The crystals are monoclinic, space group P21 (No. 4), a = 9.137(1) A, b = 4.097(1) A, c = 12.765(2) A, β = 111.75(1)°, Z = 4. Contrary to the high temperature (HT) phase the cation distribution of the RT-phase is strongly ordered. The lattice forms a layer structure parallel (001), where the Sb atoms have a (3 + 2) and the Tl atoms a (1 + 4) coordination of Se atoms within the layer. The crystal structure of the RT-phase of the compound TlSbSe2 can be described as a superstructure of the HT-phase. The order of the superstructure and a model of the twinning are discussed.

The crystallization process of the dental glass-ceramic Dicor is investigated by DSC and the texture is shown by electron microscopy. Dilatometric measurements demonstrate the conformity of the thermal expansion of the glass and the special investment, which is used for embedding the glassy blank during crystallization.

Differential thermal analyses (DTA), dilatometric, and X-ray powder diffraction studies of the semiconductor TISbSe 2 show the existence of three phases. Between the high temperature (HT) phase with statistically distributed cations and the room temperature (RT) phase, an intermediate phase with partial cation order (PO phase) was found. The phase transition from HT to PO phase is of first order, where both displacement and atomic exchange processes occur. The phase transition from PO to RT is of higher order, accompanied by diffusion processes, which increase the order of the cations. The completely ordered RT phase can be obtained by long time annealing (e.g. four weeks at 350 °C). Another method to obtain the well ordered RT phase is to pass repeatedly the phase transitions without melting the material. The coefficients of thermal expansion have been measured for the temperature range from 25 to 300 °C.

The electrical properties of semi-insulating CdTe crystals were characterized considering the application of the material as a room temperature radiation detector. Requirement for the detector application is a high resistivity material which is achieved by the compensation of shallow levels by deep donors in the middle of the band gap. These deep donors are obtained by doping the CdTe crystals with titanium or vanadium or by the influence of chlorine and intrinsic defects like the antisite defect. The energies of the deep levels are within the range of 0.31 eV and 0.95 eV determined by photoinduced current spectroscopy and admittance measurements. To calculate the compensation effects we applied a model originally developed for semi-insulating GaAs. To form detectors with a high local resolution, homogeneous material is needed. Homogeneity was tested by time dependent charge measurements. While CdTe:Cl showed variations of about 20% other high resistivity materials could vary up to one order of magnitude across one wafer. The variation of resistivity in CdTe crystals could be attributed to the crystal growth by a combined segregation-compensation model.

Spatially resolved resistivity measurements of CdTe crystals doped with Titanium (Ti) and Vanadium (V) were performed. From the temperature dependence of the resistivity the spatial variation of the thermal activation energy was deduced. Variations in axial as well as radial direction were observed and qualitatively explained by a combined segregation and compensation model. It is based on the deep donor levels of Ti and V at 0.95 eV below the conduction band.

We report on electrical and optical properties of vertical Bridgman grown Cl-doped CdTe including the ternary compositions Cd0.9Zn0.1Te and CdTe0 9Se0.1 with respect to application as a radiation detector. Based on Hall effect measurements, photoinduced current spectroscopy (PICTS) and photoluminescence we infer that high resistive material with good performance is controlled by deep level defects. The resistivity is calculated as a function of the shallow acceptor concentration (Cl-A-centers) with the conclusion that a deep donor state at mid gap must be present.

Cd1-xZnxTe ZriTe crystals grown by the travelling heater methode (THM) have been investigated by low temperature photoluminescence (PL). The excitonic energy gap as a function of the alloy composition was determined for the complete range of x - 0 to x - 1. The composition dependent broadening of the neutral acceptor bound exciton (A°X) line was measured and compared to theoretical calculations. The Donor - Acceptor pair luminescence in the crystals is a superposition of recombinations due to residual Cu acceptors and A - centers (anion vacancy - donor pairs ).

The dentine materials of the metal ceramic systems VMK 68 and Biodent as well as the ceramics of all ceramic systems Duceram, Cosmotech, Optec, IPS-Empress and Corum were tested for their leucite content. The structure analysed in the scanning electron microscope showed leucite in the dendritic and idiomorphic form. X-ray diffraction analyses verified the leucite content in metal ceramic systems and ceramics of the nonbonded systems. Comparing the metal ceramic systems with the nonbonded systems, an increase in leucite content was observed in the nonbonded systems.

This report contains a monthly update of environmental regulatory activity that is of interest to the Department of Energy. It is provided to DOE operations and contractor staff to assist and support environmental management programs by tracking regulatory developments. The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and a projection of further action.

This report contains a monthly update of environmental regulatory activity that is of interest to the Department of Energy. It is provided to DOE operations and contractor staff to assist and support environmental management programs by tracking regulatory developments. The Environmental Regulatory Update Table provides information on regulatory initiatives of interest to DOE operations and contractor staff with environmental management responsibilities. The table is updated each month with information from the Federal Register and other sources, including direct contact with regulatory agencies. Each table entry provides a chronological record of the rulemaking process for that initiative with an abstract and projection of further action.

The iron acceptor charge state Fe+ in as-grown ZnTe was investigated by electron paramagnetic resonance and photoelectron paramagnetic resonance. The photoelectron paramagnetic resonance results show a threshold energy at 1.75 eV, locating the acceptor level at 0.65 eV below the conduction band. For a valence band offset of 100 meV between ZnTe and CdTe, the acceptor level Fe0/− in CdTe is predicted to be located at about 0.2 eV above the conduction band edge. Our investigations do not confirm that the 1.17 eV emission band in CdTe is related to iron.