Search

Ten green gram genotypes (K 851, GM 4, Meha, VMS 6 (GM-5), IPM 205-7 (Virat), Vaibhav, AKM-6802, CO-5, AKM-8803 and PM-2) were screened for their resistance to the sucking pests. The field experiment was conducted at the Instructional Farm, JAU, Junagadh during summer 2018. None of the varieties proved highly resistant to the whitefly Bemisia tabaci (Genn.) and thrips Megalurothrips distalis (Karny); however, Meha, IPM 205-7 (Virat), and VMS 6 (GM-5) were found resistant. The varieties Vaibhav, CO-5 and PM-2 have been classified as moderately resistant (MR) to B. tabaci and AKM- 6802 was moderately susceptible (MS) to both the pests. The susceptible (S) category included the AKM-8803, GM-4, and K-851 varieties.

Berseem (Trifolium alexandrinum L.) is one of the important legume fodder crops. It is widely grown in Central and Northern parts of India during winter season. Disease symptoms resembling to colla...

Pollination is the most important ecosystem service performed by insect pollinators benefiting more than three quarters of the major crops in the world. Conservation and management of honey bees ar...

Biotic stress is a major cause for pre and postharvest losses in agriculture. Food crops of the world are damaged by more than of 10,000 species of insects 30,000 species of weeds, 1,00, 000 types of diseases (due to fungi, viruses, bacteria and various microbes) and a 1,000 species of nematodes. Modern day management practices for the above specified stress factors largely depends on the utilization of synthetic pesticides. Pesticide misuse in numerous sectors of agriculture frequently has often linked to health issues and environmental pollution around the world. Thus, there is a growing interest in replacing or possibly supplementing the prevailing control strategies with new and safer techniques. One of the promising management tools in this new state of affairs for crop protection is microbial pesticides. At present, only 3% of plant protectants used globally are covered by bio pesticides, but their growth rate indicates an increasing trend in the past two decades. The discovery of insecticidal property of Bacillus thuringiensis (Bt) indicated a more extensive part of organism based natural control. Microbial pesticides comprise of a microorganisms (bacterium, fungus, virus or protozoan) or toxins produced by them as the active ingredient. The most commonly used microbial pesticides are entomopathogenic fungi (Metarhizium, Beauveria and Verticillium), entomopathogenic bacteria (Bt), entomopathogenic nematode (Steinernema and Heterorhabditis) and baculoviruses (NPV and GV) which able to cause disease in insects. Microbial insecticides are promising alternative to ecologically disruptive pest control measures as they are no longer harmful to the environment and non target organisms. If deployed appropriately, microbial insecticides have capability to bring sustainability to global agriculture for food and food safety.

The fall armyworm (FAW), Spodoptera frugiperda is a ruinous insect pest, native to tropical and subtropical regions of western hemisphere. It has recently invaded Indian subcontinent during 2018, c...

Aeroelastic instability in turbomachinery is one of the severe problems limiting its performance. Of particular interest is the phenomenon of stall flutter in compressors, which occurs when blades ...

Tubercles are modifications to the leading edge of an airfoil in the form of blunt wave-like serrations. Several studies on the effect of tubercles on isolated airfoils have shown a beneficial effect in the post-stall regime, as reduced drag and increased lift, leading to a delay of stall. The prospect of delaying stall is particularly attractive to designers of axial compressors in gas turbines, as this leads to designs with higher loading and therefore higher pressure rise with fewer number of stages. In the present study, experiments were performed on a cascade of airfoils with NACA 65209 profile with different tubercle geometries. The measurements were made over an exit plane using a five-hole probe to compare the cascade performance parameters. Additionally, hot-wire measurements were taken near the blade surface to understand the nature of the flow in the region close to the tubercles. Oil-flow visualization on the cascade end wall reveal the flow through the passage of blades with and without tubercles. For the cascade considered, the estimated stall angle for the best performing set of blades is found to increase up to 8.6{\deg} from that of the unmodified blade of 6.0{\deg}. Application of such structures in axial compressor blades may well lead to suppression of stall in axial compressors and extend the operating range.

The present numerical study deals with the steady and unsteady aerodynamics of an airfoil in a cascade with oscillating neighboring blades. The motivation for the study arises from aeroelastic studies of turbomachinery blades, where the unsteady forces acting on a blade due to different sources is examined. In order to identify the root cause of the various phenomena affecting the aeroelastic stability, it is necessary to observe the effect of only one source of disturbance and isolate the others. The cascade comprises of five blades with zero stagger and low incidence. The two adjacent blades to central one are oscillated with a fixed frequency and phase difference, with the rest of the blades remaining stationary, covering a range of frequencies and phase difference angles. The primary objective is to look at the variation of global parameters on central blade with reduced frequency. The moment and drag are estimated numerically and compared with experimental results which shows good agreement. The hysteresis loops of lift and moment coefficient with angular displacement are used to understand the effect of reduced frequency. A laminar separation bubble is observed to be formed during part of the oscillation cycle and its size is related to the unsteady forces on the blade. The behavior is also a function of reduced frequency to some extent. Such an understanding of the effect of oscillating blades in a blade row is essential for the modeling of the aerodynamic forces in an aeroelastic problem.

The modern agriculture is negatively affected due to the rapid exploitation of natural resources, indiscriminate use of pesticide application, and frequent weather events influenced by climate change. Biocontrol action is a significant tool for IPM, offers alternative management techniques that are safer for human and environmental health. It is also worth noting that biological control has worked in a versatile manner in different agricultural management systems and with different types of disease causing organisms existing in the nature. Several key pests and invasive pests were successfully controlled with the application of biological agents. Although biopesticides very slowly replace the use of pesticide that may be due to biopesticide exploration and application range. In India the main challenge for biopesticide is related to their shelf life, narrow host range for pathogens, variation in the lab to land performances, economic regulation, etc. Integrated approach will be beneficial for biopesticide application for this private and government sectors that come together with farmers to the village level and to build confidence in the use of biopesticides.

This paper presents the details about lateral-directional and longitudinal control of a tailless aircraft for landing condition. Tailless aircraft configurations are specifically designed for stealth and the absence of a vertical fin aids in low visibility to RADAR. For such configurations, yaw control becomes a major challenge. Usage of control surfaces, known as spoilers, specifically to obtain yaw-controllability is one of the approaches. For the considered tailless aircraft configuration, it was observed that due to deflection of spoilers, the effectiveness of elevons was significantly hampered. This decrease in effectiveness demands higher deflection of elevons which is not preferred due to actuator requirements. Another approach to tackle the yaw-controllability would be to use the existing elevons present in aircraft. This approach is discussed and analyzed in this paper. Critical landing condition have been chosen as the design point to cater for, namely: (a) to generate sufficient yawing, rolling and pitching moments to restore the aircraft (b) by using minimum deflection angles to control (c) to attain required CL at landing condition. Few results of this study are presented here.

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25o 52' 749.20″, E78o 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1o C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1o C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2o C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Turbomachinery aeroelasticity is gaining renewed interest in the light of current trends, which tend toward thinner blade designs that are not only highly loaded, but also have minimal weight. This...

This study addresses flutter that can occur in compressors when operating at high relative incidence. Studies are performed on a subsonic annular compressor cascade containing a sector of blades that can be subjected to controlled torsional oscillation. Measurements taken on the centrally located blade are used to study the unsteady surface pressures developed. Three large mean incidences are considered to characterize the aeroelastic performance. Aerodynamic damping is calculated for each test condition and its variation due to interblade phase angle (IBPA), reduced frequency, and incidence is studied. The source of stability or instability is traced to the nature of unsteady pressures. When the incidence is below the static-stall limit, an increasing incidence is found to exhibit aeroelastically more stable performance, whereas beyond the limit, the stability worsens. For the latter, the amount of improvement in stability by increasing reduced frequency is less compared to the former and its variation with IBPA is not as regular owing to the associated large uncertainty. The nonlinearity effects were found to be relatively higher for this case, especially from the aft region of the suction surface. It is also found that the phase of the local fluctuating pressure and its location on the chord has a decisive influence on the aerodynamic damping and its trends with respect to various parameters are discussed. The results are expected to be useful in the assessing aerodynamic damping trends in relation to the pressure phase variations in specific regions along the chord.

The intakes of modern aircraft are subjected to ever-increasing demands in their performance. Particularly, they are expected to carry out diffusion with the highest isentropic efficiency while subjected to aggressive geometry requirements arising from stealth considerations. To avoid a penalty in engine performance, the flow through intake needs to be controlled using various methods of flow control. In this study, a serpentine intake is studied experimentally and its performance compared with and without boundary layer suction. The performance parameters used are nondimensional total pressure loss coefficient and standard total pressure distortion descriptors. The effect is observed on surface pressure distributions, and inferences are made regarding separation location and extent. A detailed measurement at the exit plane shows flow structures that draw attention to secondary flows within the duct. Suction is applied at three different locations, spanning different number of ports along each location, comprising of ten unique configurations. The mass flow rate of suction employed ranges from 1.1% to 6.7% of mass flow rate at the inlet of the intake. The effect is seen on exit total pressure recovery as well as circumferential and radial distortion parameters. This is examined in the context of the location of the suction ports and amount of suction mass flow, by the deviation in surface pressure distributions, as well as the separation characteristics from the baseline case. The results show that applying suction far upstream of the separation point together with a modest amount of suction downstream results in the best performance.

The present study describes the effectiveness of different flow control methods applied to a serpentine intake. Due to the geometry of the duct and diffusing nature of flow, the duct performs poorly as an intake, delivering low pressure and distorted air to the compressor. The problem can be alleviated by employing flow control on the duct. In this study, two types of flow control, namely steady vortex generator jets and boundary layer suction, have been applied and detailed measurements carried out. The performance of the duct has been evaluated with respect to static pressure recovery, total pressure loss and circumferential distortion at the exit. The amount of mass flow required to be added or removed for each method is also considered. It was found that the application of suction showed a greater improvement in total pressure recovery and reduction in circumferential distortion intensity compared to vortex generator jets. A combination of suction and vortex generator jets showed an improved performance compared to application of either. The improvements are attributed to reduction in flow separation region due to suction and a decrease in the effect of secondary flow due to vortex generator jets.

The benefits of minimizing the weight of an aircraft are substantial, due to which all aircraft components are designed so as to perform acceptably with minimal weight. As a result, modern compressor, fan and turbine blades are increasingly being designed with thinner airfoil profiles, while also being subjected to high loading, so as to improve the thrust-to-weight ratio of the engine. These conditions make the blades extremely likely to result in large-amplitude vibrations. A class of critical vibrations are caused due to aeroelastic instabilities within the turbomachinery blade rows. Forced response or the self-excited flutter can lead to high-cycle fatigue which can cause a catastrophic failure of the blades. The absence of a reliable prediction methodology for the occurrence of these instabilities signify the importance of unsteady aerodynamic studies in turbomachine cascades. The present experiments are conducted on a newly commissioned annular cascade tunnel. The test section consisting of 14 compressor blades is studied under subsonic conditions. The profiles of the blades have a constant span design, and the cascade parameters are chosen as EPFL’s Second Standard Test Configuration at the mid-span location. A set of guide vanes upstream of this blade row set the required incidence to the cascade by imparting a circumferential component to the velocity. For the present unsteady studies, selected blades are subjected to controlled vibrations while the unsteady response on a reference stationery blade is measured. Two blades are connected to individual servo motors through a mechanism so as to execute controlled, low-amplitude, torsional (pitching) oscillations about its mid-chord axis. A reference blade is mounted on a load cell to enable measurement of both the axial and transverse forces and moments. In order to simulate the effect of the inter-blade phase angle prevalent in a rotating turbomachine blade row, the phase angle between the vibrating blades is varied to all admissible values. The fundamental parameters for evaluating the stability are the phase difference between blade position and the forces responses. This is estimated from the Fourier transform of the displacement and load signals. The parameters are evaluated for a range of reduced frequencies and inlet velocities to evaluate the stability of the cascade at all specified flow conditions.Copyright © 2015 by ASME

In the present study, the effectiveness of passive structures called tubercles on an axial compressor blade row is studied experimentally. Tubercles are the modifications to the leading edge of an airfoil in the form of blunt wave-like serrations. Although several studies on the effect of tubercles on isolated blades are available in literature, detailed study of their effect on a cascade of blades, such as in the case of an axial flow turbo-machine is lacking. Such an application in an axial compressor will result in a significant increase in the stall margin. Presently, experiments have been performed on a linear compressor cascade with a blade height of 0.15 m and mean chord of 0.06 m, on a NACA 65209 airfoil profile. The plain and modified blades are fabricated using rapid prototyping to ensure conformity to the required geometry. The cascade is designed in such a way that the incidence (angle of attack) and the stagger can be changed easily. The measurements are taken at the exit plane using a five-hole Pitot probe to obtain three-components of velocity and static pressure data over fine measurement grids. The effect is determined in terms of lift and drag coefficients, lift-to-drag ratio and total pressure loss coefficient. Experiments have been carried out for different pitch and amplitude (serration depth) of tubercles to understand their effect. The stall incidence angle for the best performing blade is found to increase up to 8.6° from that of the unmodified blade of 6.0°. Application of such structures in axial compressor blades may well be adequate to prevent stalling in axial compressors over a wide operating range.