Search

SARS-CoV-2 is a recently identified coronavirus accountable for the current pandemic disease known as COVID-19. Different patterns of disease progression infer a diverse host immune response, with interferon (IFN) being pivotal. IFN-I and III are produced and released by virus-infected cells during the interplay with SARS-CoV-2, thus establishing an antiviral state in target cells. However, the efficacy of IFN and its role in the possible outcomes of the disease are not yet defined, as it is influenced both by factors inherent to the virus and to the host. The virus exhibits multiple strategies to counteract the innate immune response, including those shared by SARS-CoV and MERS-CoV and other novel ones. Inborn errors in the host may affect IFN-related effector proteins or decrease its levels in plasma upon neutralization by preexistent autoantibodies. This battle between the IFN response triggered upon SARS-CoV-2 infection, its magnitude and timing, and the efficacy of its antiviral tools in dispute against the viral evasion strategies together with the genetic factors of the host, generate a scenario whose fate contributes to defining the severity of COVID-19.

The novel betacoronavirus, SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2), has spread across the globe at an unprecedented rate since its first emergence in Wuhan City, China in December 2019. Scientific communities around the world have been rigorously working to develop a potent vaccine to combat COVID-19 (coronavirus disease 2019), employing conventional and novel vaccine strategies. Gene-based vaccine platforms based on viral vectors, DNA, and RNA, have shown promising results encompassing both humoral and cell-mediated immune responses in previous studies, supporting their implementation for COVID-19 vaccine development. In fact, the U.S. Food and Drug Administration (FDA) recently authorized the emergency use of two RNA-based COVID-19 vaccines. We review current gene-based vaccine candidates proceeding through clinical trials, including their antigenic targets, delivery vehicles, and route of administration. Important features of previous gene-based vaccine developments against other infectious diseases are discussed in guiding the design and development of effective vaccines against COVID-19 and future derivatives., Graphical abstract Unlabelled Image

Made available in DSpace on 2022-04-28T19:44:18Z (GMT). No. of bitstreams: 0 Previous issue date: 2021-12-01 Agencia Nacional de Investigación e Innovación Comisión Sectorial de Investigación Científica Fondo Nacional de Desarrollo Científico y Tecnológico The molecular evolution of life on earth along with changing environmental, conditions has rendered mankind susceptible to endemic and pandemic emerging infectious diseases. The effects of certain systemic viral and bacterial infections on morbidity and mortality are considered as examples of recent emerging infections. Here we will focus on three examples of infections that are important in pregnancy and early childhood: SARS-CoV-2 virus, Zika virus, and Mycoplasma species. The basic structural characteristics of these infectious agents will be examined, along with their general pathogenic mechanisms. Coronavirus infections, such as caused by the SARS-CoV-2 virus, likely evolved from zoonotic bat viruses to infect humans and cause a pandemic that has been the biggest challenge for humanity since the Spanish Flu pandemic of the early 20th century. In contrast, Zika Virus infections represent an expanding infectious threat in the context of global climate change. The relationship of these infections to pregnancy, the vertical transmission and neurological sequels make these viruses highly relevant to the topics of this special issue. Finally, mycoplasmal infections have been present before mankind evolved, but they were rarely identified as human pathogens until recently, and they are now recognized as important coinfections that are able to modify the course and prognosis of various infectious diseases and other chronic illnesses. The infectious processes caused by these intracellular microorganisms are examined as well as some general aspects of their pathogeneses, clinical presentations, and diagnoses. We will finally consider examples of treatments that have been used to reduce morbidity and mortality of these infections and discuss briefly the current status of vaccines, in particular, against the SARS-CoV-2 virus. It is important to understand some of the basic features of these emerging infectious diseases and the pathogens involved in order to better appreciate the contributions of this special issue on how infectious diseases can affect human pregnancy, fetuses and neonates. Laboratory of Ion Channels Biological Membranes and Cell Signaling Department of Biophysics Faculty of Medicine Universidad de la República Department of Infectious Diseases Faculty of Medicine Universidad de la República Cellular and Molecular Physiology Laboratory (CMPL) Department of Obstetrics Division of Obstetrics and Gynaeology School of Medicine Faculty of Medicine Pontificia Universidad Católica de Chile Department of Physiology Faculty of Pharmacy Universidad de Sevilla Medical School (Faculty of Medicine) São Paulo State University (UNESP) University of Queensland Centre for Clinical Research (UQCCR) Faculty of Medicine and Biomedical Sciences University of Queensland Department of Pathology and Medical Biology University of Groningen University Medical Center Groningen (UMCG) Department of Molecular Pathology The Institute for Molecular Medicine Medical School (Faculty of Medicine) São Paulo State University (UNESP) Fondo Nacional de Desarrollo Científico y Tecnológico: 1190316

Middle East respiratory syndrome (MERS) is a threat to public health worldwide. A vaccine against the causative agent of MERS, MERS-coronavirus (MERS-CoV), is urgently needed. We previously identified a peptide ligand, Co4B, which can enhance antigen (Ag) delivery to the nasal mucosa and promote Ag-specific mucosal and systemic immune responses following intranasal immunization. MERS-CoV infects via the respiratory route; thus, we conjugated the Co4B ligand to the MERS-CoV spike protein receptor-binding domain (S-RBD), and used this to intranasally immunize C57BL/6 and human dipeptidyl peptidase 4-transgenic (hDPP4-Tg) mice. Ag-specific mucosal immunoglobulin (Ig) A and systemic IgG, together with virus-neutralizing activities, were highly induced in mice immunized with Co4B-conjugated S-RBD (S-RBD-Co4B) compared to those immunized with unconjugated S-RBD. Ag-specific T cell-mediated immunity was also induced in the spleen and lungs of mice intranasally immunized with S-RBD-Co4B. Intranasal immunization of hDPP4-Tg mice with S-RBD-Co4B reduced immune cell infiltration into the tissues of virus-challenged mice. Finally, S-RBD-Co4B-immunized mice exhibited were better protected against infection, more likely to survive, and exhibited less body weight loss. Collectively, our results suggest that S-RBD-Co4B could be used as an intranasal vaccine candidate against MERS-CoV infection.

Graphical abstract, Highlight • Network pharmacology of drug targets of Rhizoma Polygonati (RP) were constructed. • Molecular docking identified high affinity binding of diosgenin and (+)-Syringaresinol-O-beta-D-glucoside to the target proteins of SARS-CoV-2. • Potential compounds in RP may act on multiple target-signaling for potential treatment of COVID-19., Rhizoma Polygonati (huangjing in Chinese, 黄精) is an herb-homology-food used as a component of alternative medicine treating COVID-19 in the current pandemic emergency in China but the mechanisms remain elusive. Here using TCMSP and Swiss Target Prediction databases to sort out the potential targets of the main chemical components and GenCLiP3, NCBI, and GeneCard databases to search for COVID-19 related targets, the chemical compound-target-pathway network was analyzed. Each component was molecularly docked with host cell target angiotensin converting enzyme II, SARS-CoV-2 targets Spike protein, RNA-dependent RNA polymerase, or 3CL hydrolase. Our results showed a higher affinity of the compound diosgenin and (+)-Syringaresinol-O-beta-D-glucoside binding to the three SARS-CoV-2 proteins compared to the other compounds tested. Thus, our data suggest that potential compounds in Rhizoma Polygonati may act on different targets and have a great potential in treatment of COVID-19.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is responsible of the coronavirus disease 2019 (COVID-19) pandemic. Therapeutic options including antimalarials, antivirals, and vaccines are under study. Meanwhile the current pandemic has called attention over old therapeutic tools to treat infectious diseases. Convalescent plasma (CP) constitutes the first option in the current situation, since it has been successfully used in other coronaviruses outbreaks. Herein, we discuss the possible mechanisms of action of CP and their repercussion in COVID-19 pathogenesis, including direct neutralization of the virus, control of an overactive immune system (i.e., cytokine storm, Th1/Th17 ratio, complement activation) and immunomodulation of a hypercoagulable state. All these benefits of CP are expected to be better achieved if used in non-critically hospitalized patients, in the hope of reducing morbidity and mortality., Highlights • Coronavirus disease 19 (COVID-19) is an emerging viral threat with major repercussions for public health. • There is not specific treatment for COVID-19. • Convalescent plasma (CP) emerges as the first option of management for hospitalized patients with COVID-19. • Transference of neutralizing antibodies helps to control COVID-19 infection and modulates inflammatory response. • Other plasma components may enhance the antiviral and anti-inflammatory properties of CP.

As the novel coronavirus SARS-CoV-2 caused COVID-19 cases in the United States the initial test was developed and performed at the Center for Disease Control (CDC). As the number of cases increased the demand for tests multiplied, leading the CDC to utilize the Emergency Utilization Authorization to allow clinical and commercial laboratories to develop tests to detect the presence of the virus. Many nucleic acid tests based on reverse transcriptase-polymerase chain reaction (RT-PCR) were developed, each with different techniques, specifications and turnaround time. As the illnesses turned into a pandemic, testing became more crucial. The test supply became inadequate to meet the need that it had to be prioritized according to guidance. For surveillance, the need for serologic tests emerged. Here we review the timeline of test development, the turn-around times, the various approved tests and compare them as regards the genes they detect. We concentrate on the point-of-care tests and discuss the basis for new serologic tests. We discuss the testing guidance for prioritization and their application in a hospital setting. As SARS-CoV-2 virus arrived in the USA causing the COVID-19 illness, one of the most talked about issues in the management of the disease and the resulting pandemic has been clinical testing. A unique situation arose of a communicable and highly contagious disease necessitating the rapid diagnosis of patients and the identification of non-symptomatic infected persons. Unfortunately, the USA did not have a Food and Drug Administration (FDA) approved laboratory test for the illness. The FDA ultimately utilized its Emergency Use Authorizations (EUA) on February 4, 2020 to allow for more rapid and widespread development and implementation of in-vitro testing.1 Indeed, companies and organizations utilized the EUA to file applications for new tests based on different methodologies, amounting to 48 applications in the span of 3 months from the beginning of February to the end of April 2020. In addition, multiple other tests were put in place under a separate authorization by a Presidential memorandum in early March allowing laboratories that carry Clinical Laboratory Improvement Amendment (CLIA) certification to put tests in place without an EUA from the FDA. This created an unprecedented situation where the medical community and the public may not be familiar with the various new tests for COVID-19 that are offered to patients and hospitals. The purpose of this review is to provide information, up-to-date as of the date of submission of the manuscript to the journal, on the various tests that have been developed, their scientific basis and their interpretation. We give a real-world example demonstrating the time lag in the return of test results and review testing prioritization guidance since the supply of tests remains below the perceived need.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causal agent of the coronavirus disease (COVID-19) pandemic, has infected millions of people globally. Genetic variation and selective pressures lead to the accumulation of single nucleotide polymorphism (SNP) within the viral genome that may affect virulence, transmission rate, viral recognition and the efficacy of prophylactic and interventional measures. To address these concerns at the genomic level, we assessed the phylogeny and SNPs of the SARS-CoV-2 mutant population collected to date in Iran in relation to globally reported variants. Phylogenetic analysis of mutant strains revealed the occurrence of the variants known as B.1.1.7 (Alpha), B.1.525 (Eta), and B.1.617 (Delta) that appear to have delineated independently in Iran. SNP analysis of the Iranian sequences revealed that the mutations were predominantly positioned within the S protein-coding region, with most SNPs localizing to the S1 subunit. Seventeen S1-localizing SNPs occurred in the RNA binding domain that interacts with ACE2 of the host cell. Importantly, many of these SNPs are predicted to influence the binding of antibodies and anti-viral therapeutics, indicating that the adaptive host response appears to be imposing a selective pressure that is driving the evolution of the virus in this closed population through enhancing virulence. The SNPs detected within these mutant cohorts are addressed with respect to current prophylactic measures and therapeutic interventions.

Highlights • Hepatitis B core antigen (HBcAg) protein with PEDV epitopes can assemble into virus like particles. • Epitope placement within HBcAg can affect the immunogenicity of a vaccine. • The YSNIGVCK antigen from PEDV has a strong correlation with virus neutralization., Porcine epidemic diarrhea virus (PEDV) is a member of the Alphacoronaviridae genus within the Coronaviridae family. It is the causative agent of porcine epidemic diarrhea, a disease that can have mortality rates as high as 100% in suckling piglets. PEDV causes severe economic loss, and has been in existence for decades. A panzootic starting in 2010 renewed interest in the development of a universal vaccine toward PEDV. This report details several design changes made to a Hepatitis B virus core antigen (HBcAg)-based recombinant vaccine strategy, and their effect in vivo. Initially, several multi-antigen vaccine candidates were able to elicit antibodies specific to three out of four B-cell epitopes inserted into the chimeric proteins. However, a lack of virus neutralization led to a redesign of the vaccines. The focus of the newly redesigned vaccines was to elicit a strong immune response to the YSNIGVCK amino acid motif from PEDV. Genetically modified new vaccine candidates were able to elicit a strong antibody (Ab) response to the YSNIGVCK epitope, which correlated with an increased ability to neutralize the CO strain of PEDV. Additionally, the location of the inserted PEDV epitopes within the vector protein was shown to affect the immune recognition toward the native HBcAg during vaccination.

With the outbreak of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), coronaviruses have begun to attract great attention across the world. Of the known human coronaviruses, however, Middle East respiratory syndrome coronavirus (MERS-CoV) is the most lethal. Coronavirus proteins can be divided into three groups: nonstructural proteins, structural proteins, and accessory proteins. While the number of each of these proteins varies greatly among different coronaviruses, accessory proteins are most closely related to the pathogenicity of the virus. We found for the first time that the ORF3 accessory protein of MERS-CoV, which closely resembles the ORF3a proteins of severe acute respiratory syndrome coronavirus and SARS-CoV-2, has the ability to induce apoptosis in cells in a dose-dependent manner. Through bioinformatics analysis and validation, we revealed that ORF3 is an unstable protein and has a shorter half-life in cells compared to that of severe acute respiratory syndrome coronavirus and SARS-CoV-2 ORF3a proteins. After screening, we identified a host E3 ligase, HUWE1, that specifically induces MERS-CoV ORF3 protein ubiquitination and degradation through the ubiquitin-proteasome system. This results in the diminished ability of ORF3 to induce apoptosis, which might partially explain the lower spread of MERS-CoV compared to other coronaviruses. In summary, this study reveals a pathological function of MERS-CoV ORF3 protein and identifies a potential host antiviral protein, HUWE1, with an ability to antagonize MERS-CoV pathogenesis by inducing ORF3 degradation, thus enriching our knowledge of the pathogenesis of MERS-CoV and suggesting new targets and strategies for clinical development of drugs for MERS-CoV treatment.

As the novel coronavirus SARS-CoV-2 continues to spread in all countries, there is a growing interest in monitoring and understanding the impact of emerging strains on virus transmission and disease severity. Here, we analyzed SARS-CoV-2 genomic sequences reported in the Eastern Mediterranean Region (EMR) countries, as of 1 January 2021. The majority (∼75%) of these sequences originated from three out of 22 EMR countries, and 65.8% of all sequences belonged to GISAID clades GR, GH, G and GV. A delay ranging between 30-150 days from sample collection to sequence submission was observed across all countries, limiting the utility of such data in informing public health policies. We identified ten common non-synonymous mutations represented among SARS-CoV-2 in the EMR and several country-specific ones. Two substitutions, spike_D614G and NSP12_P323L, were predominantly concurrent in most countries. While the single incidence of NSP12_P323L was positively correlated with higher case fatality rates in EMR, no such association was established for the double (spike_D614G and NSP12_P323L) concurrent variant across the region. Our study identified critical data gaps in EMR highlighting the importance of enhancing surveillance and sequencing capacities in the region.

Graphical abstract A summarized view of recent findings of host proteins interacting with SARS-CoV-2 and genes containing associated variants with COVID-19 susceptibility and severity. The left side of the figure (A) shows host protein interactors (blue wrote) for SARS-CoV-2 identified through CryoEM or X-ray crystallography and AP-MS or AP-LC-MS/MS studies; the right side (B) depicts host genes (blue wrote) involved in COVID-19 susceptibility and severity discovered by GWAS/TWAS and bioinformatics studies. As shown here, some of the genes that has associated risk variants with COVID-19 belong to the identified protein interactors, for an example, ACE2 is both among the involved proteins and genes in SARS-CoV-2 infection., As of July 2021, the outbreak of coronavirus disease 2019 (COVID-19), caused by SARS-CoV-2, has led to more than 200 million infections and more than 4.2 million deaths globally. Complications of severe COVID-19 include acute kidney injury, liver dysfunction, cardiomyopathy, and coagulation dysfunction. Thus, there is an urgent need to identify proteins and genetic factors associated with COVID-19 susceptibility and outcome. We comprehensively reviewed recent findings of host-SARS-CoV-2 interactome analyses. To identify genetic variants associated with COVID-19, we focused on the findings from genome and transcriptome wide association studies (GWAS and TWAS) and bioinformatics analysis. We described established human proteins including ACE2, TMPRSS2, 40S ribosomal subunit, ApoA1, TOM70, HLA-A, and PALS1 interacting with SARS-CoV-2 based on cryo–electron microscopy results. Furthermore, we described approximately 1000 human proteins showing evidence of interaction with SARS-CoV-2 and highlighted host cellular processes such as innate immune pathways affected by infection. We summarized the evidence on more than 20 identified candidate genes in COVID-19 severity. Predicted deleterious and disruptive genetic variants with possible effects on COVID-19 infectivity have been also summarized. These findings provide novel insights into SARS-CoV-2 biology and infection as well as potential strategies for development of novel COVID therapeutic targets and drug repurposing.

Growing evidence suggests that T cells may play a critical role in combating severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Hence, COVID-19 vaccines that can elicit a robust T cell response may be particularly important. The design, development and experimental evaluation of such vaccines is aided by an understanding of the landscape of T cell epitopes of SARS-CoV-2, which is largely unknown. Due to the challenges of identifying epitopes experimentally, many studies have proposed the use of in silico methods. Here, we present a review of the in silico methods that have been used for the prediction of SARS-CoV-2 T cell epitopes. These methods employ a diverse set of technical approaches, often rooted in machine learning. A performance comparison is provided based on the ability to identify a specific set of immunogenic epitopes that have been determined experimentally to be targeted by T cells in convalescent COVID-19 patients, shedding light on the relative performance merits of the different approaches adopted by the in silico studies. The review also puts forward perspectives for future research directions., Graphical abstract Unlabelled Image

Graphical abstract, On March 11, 2020, the World Health Organization (WHO) declared the severe acute respiratory syndrome caused by coronavirus 2 (SARS-CoV-2) a global pandemic. As of July 2020, SARS-CoV-2 has infected more than 14 million people and provoked more than 590,000 deaths, worldwide. From the beginning, a variety of pharmacological treatments has been empirically used to cope with the life-threatening complications associated with Corona Virus Disease 2019 (COVID-19). Thus far, only a couple of them and not consistently across reports have been shown to further decrease mortality, respect to what can be achieved with supportive care. In most cases, and due to the urgency imposed by the number and severity of the patients’ clinical conditions, the choice of treatment has been limited to repurposed drugs, approved for other indications, or investigational agents used for other viral infections often rendered available on a compassionate-use basis. The rationale for drug selection was mainly, though not exclusively, based either i) on the activity against other coronaviruses or RNA viruses in order to potentially hamper viral entry and replication in the epithelial cells of the airways, and/or ii) on the ability to modulate the excessive inflammatory reaction deriving from dysregulated host immune responses against the SARS-CoV-2. In several months, an exceptionally large number of clinical trials have been designed to evaluate the safety and efficacy of anti-COVID-19 therapies in different clinical settings (treatment or pre- and post-exposure prophylaxis) and levels of disease severity, but only few of them have been completed so far. This review focuses on the molecular mechanisms of action that have provided the scientific rationale for the empirical use and evaluation in clinical trials of structurally different and often functionally unrelated drugs during the SARS-CoV-2 pandemic.

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.

Introduction : Brazil is the second largest country with COVID-19 positive cases worldwide. Due to the potent spread of the virus and the scarcity of kits and supplies, the Brazilian Ministry of Health has granted authorisation for the use of kits available during this emergency, without an accurate evaluation of their performance. This study compared the performance and cost-effectiveness of seven molecular assays/kits available in Sao Paulo, Brazil, for SARS-CoV-2 diagnosis Materials and Methods : A total of 205 nasopharyngeal/oropharyngeal samples from suspected cases of COVID-19, were tested using the following assays: (i) GeneFinder COVID-19 plus RealAmp kit; (ii) 2019-nCoV RNA PCR-Fluorescence Probing, Da An Gene Co.; (iii) in-house RT-qPCR SARS-CoV-2 IAL; (iv) 2019-nCoV kit, IDT; (v) molecular SARS-CoV-2 (E) kit, Bio-Manguinhos; (vi) Allplex 2019-nCoV modified Assay, Seegene Inc, and (vii) Biomol one-step COVID-19 kit, IBMP. The criteria for determining a SARS-CoV-2 true positive result included the cycle threshold cut-off values, the characteristics of exponential/linear curves, the gene target diversity, and a positive result in at least two assays Results : The overall sensitivity of the assays listed were GeneFinder 83.6%, Da An Gene 100.0%, IAL 90.4%, IDT 94.6%, Bio-Manguinhos 87.7%, Allplex 97.3%, and IBMP 87.7%. The minor sensitive gene target was RdRP. Although all assays had a Cohen's Kappa index ≥0.893, the best tests used multiplex assays identifying N-gene and/or E-gene targets Conclusion : All assays tested accurate for diagnosis, but considering cost-effectiveness (cost, time consumption, number of samples tested, and performance), the in-house IAL assay was ideal for COVID-19 diagnosis in Sao Paulo, Brazil.

The spike (S) protein mutations of SARS-CoV-2 are of major concern in terms of viral transmission and pathogenesis. Hence, we developed a PCR-based method to rapidly detect the 6 mutational hotspots (H49Y, G476S, V483A, H519Q, A520S, and D614G) in the S protein and applied this method to analyze the hotspots in the viral isolates from different geographical origins. Here, we identified that there was only the D614G mutation in the viral isolates. As of September 30, 2020, the analysis of 113,381 sequences available from the public repositories revealed that the SARS-CoV-2 variant carrying G614 has become the most prevalent form globally. Our results support recent epidemiological and genomic data demonstrating that the viral infectivity and transmission are enhanced by the S protein D614G mutation., Graphical abstract Unlabelled Image

Highlights • Antivirals targeting RdRp, proteases and Spike protein from SARS-CoV-2. • Drug searching combining structural biology and virology. • Drug repurposing, HTS and virtual inhibitor screening to find antivirals., Graphical abstract Highlights • Antivirals are targeting RdRp, proteases and Spike protein from SARS-CoV-2. • Drug searching combining structural biology and virology. • Drug repurposing, HTS and virtual inhibitor screening to find antivirals., The global spread of COVID-19 constitutes the most dangerous pandemic to emerge during the last one hundred years. About seventy-nine million infections and more than 1.7 million death have been reported to date, along with destruction of the global economy. With the uncertainty evolved by alarming level of genome mutations, coupled with likelihood of generating only a short lived immune response by the vaccine injections, the identification of antiviral drugs for direct therapy is the need of the hour. Strategies to inhibit virus infection and replication focus on targets such as the spike protein and non-structural proteins including the highly conserved RNA-dependent-RNA-polymerase, nucleotidyl-transferases, main protease and papain-like proteases. There is also an indirect option to target the host cell recognition systems such as angiotensin-converting enzyme 2 (ACE2), transmembrane protease, serine 2, host cell expressed CD147, and the host furin. A drug search strategy consensus in tandem with analysis of currently available information is extremely important for the rapid identification of anti-viral. An unprecedented display of cooperation among the scientific community regarding SARS-CoV-2 research has resulted in the accumulation of an enormous amount of literature that requires curation. Drug repurposing and drug combinations have drawn tremendous attention for rapid therapeutic application, while high throughput screening and virtual searches support de novo drug identification. Here, we examine how certain approved drugs targeting different viruses can play a role in combating this new virus and analyze how they demonstrate efficacy under clinical assessment. Suggestions on repurposing and de novo strategies are proposed to facilitate the fight against the COVID-19 pandemic.

Infectious bronchitis virus (IBV) is a major viral pathogen of commercial poultry, affecting chickens of all ages and causing major economic losses in poultry industry worldwide. Frequent points of mutations and recombination events in the S1 gene region, result in the emergence of new IBVs variants circulating in the form of several serotypes/genotypes that can be partially or poorly neutralized by current vaccines. IBV is well studied worldwide, nevertheless in African countries epidemiological and scientific data are poor and not updated. This review aims to give a current overview of IBV situation, to establish evolutionary relationship between the African variants and to list some of the potential measures to control IBV in Africa. Three S1 gene hypervariable regions were studied and compared to the reference genotypes/serotypes that found emerging in African regions. This comparison was based on phylogenetic trees, nucleotide and amino-acid sequence analysis. It clearly appears that IBV variants reported in Africa, display a low genetic relationship between them and with the majority of the reference strains emerging in neighboring countries, except the case of variants from Libya and Egypt that show a high relatedness. Also the Massachusetts serotypes were the most prevalent co-circulating with both serotypes, Italy02 type in Morocco and Qx-like genotype in South part of the African continent. In order to control the IBV variants in African regions, an efficient vaccination strategy program should be implemented.

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a β-coronavirus, is the causative agent of the COVID-19 pandemic. Like for other coronaviruses, its particles are composed of four structural proteins: spike (S), envelope (E), membrane (M), and nucleoprotein (N) proteins. The involvement of each of these proteins and their interactions are critical for assembly and production of β-coronavirus particles. Here, we sought to characterize the interplay of SARS-CoV-2 structural proteins during the viral assembly process. By combining biochemical and imaging assays in infected versus transfected cells, we show that E and M regulate intracellular trafficking of S as well as its intracellular processing. Indeed, the imaging data reveal that S is relocalized at endoplasmic reticulum (ER)-Golgi intermediate compartment (ERGIC) or Golgi compartments upon coexpression of E or M, as observed in SARS-CoV-2-infected cells, which prevents syncytia formation. We show that a C-terminal retrieval motif in the cytoplasmic tail of S is required for its M-mediated retention in the ERGIC, whereas E induces S retention by modulating the cell secretory pathway. We also highlight that E and M induce a specific maturation of N-glycosylation of S, independently of the regulation of its localization, with a profile that is observed both in infected cells and in purified viral particles. Finally, we show that E, M, and N are required for optimal production of virus-like-particles. Altogether, these results highlight how E and M proteins may influence the properties of S proteins and promote the assembly of SARS-CoV-2 viral particles.

The ongoing mutations in the structural proteins of SARS-CoV-2 are the major impediment for prevention and control of the COVID-19 disease. Presently we focused on evolution of the envelope (E) protein, one of the most enigmatic and less studied protein among the four structural proteins (S, E, M and N) associated with multitude of immunopathological functions of SARS-CoV-2. In the present study, we comprehensively analyzed 81,818 high quality E protein sequences of SARS-CoV-2 globally available in the GISAID database as of 20 August 2020. Compared to Wuhan reference strain, our mutational analysis explored only 1.2 % (982/81818) mutant strains undergoing a total of 115 unique amino acid (aa) substitutions in the E protein, highlighting the fact that most (98.8 %) of the E protein of SARS-CoV-2 strains are highly conserved. Moreover, we found 58.77 % (134 of 228) nucleotides (nt) positions of SARS-CoV-2 E gene encountering a total of 176 unique nt-level mutations globally, which may affect the efficacy of real time RT-PCR-based molecular detection of COVID-19. Importantly, higher aa variations observed in the C-terminal domain (CTD) of the E protein, particularly at Ser55-Phe56, Arg69 and the C-terminal end (DLLV: 72–75) may alter the binding of SARS-CoV-2 Envelope protein to tight junction-associated PALS1 and thus could play a key role in COVID-19 pathogenesis. Furthermore, this study revealed the V25A mutation in the transmembrane domain which is a key factor for the homopentameric conformation of E protein. Our analysis also observed a triple cysteine motif harboring mutation (L39M, A41S, A41V, C43F, C43R, C43S, C44Y, N45R) which may hinder the binding of E protein with spike glycoprotein. These results therefore suggest the continuous monitoring of the structural proteins including the envelope protein of SARS-CoV-2 since the number of genome sequences from across the world are continuously increasing., Highlights • We found 1.2 % and 58.77% of 81,818 strains possessing amino acid and nucleotide mutations, respectively, in SARS-CoV-2 E protein. • NTD, TMD, and CTD domains of E protein had aa substitutions at 7, 25, and 31 sites, respectively. • A total of 115 unique aa mutations were observed in 63 (84%) sites of the primary structure of E protein.

Highlights • The envelope protein of MERS coronavirus (MERS-CoV E protein) has been purified. • MERS-CoV E protein forms pentameric ion channels. • MERS-CoV E protein has one transmembrane domain. • The full length construct obtained is amenable to structural determination by NMR in detergents., The Middle East respiratory syndrome coronavirus (MERS-CoV) is a newly identified pathogen able of human transmission that causes a mortality of almost 40%. As in the case of SARS-CoV, MERS virus lacking E protein represents a potential vaccine. In both cases, abolishment of channel activity may be a contributor to the attenuation observed in E-deleted viruses. Herein, we report that purified MERS-CoV E protein, like SARS-CoV E protein, is almost fully α-helical, has a single α-helical transmembrane domain, and forms pentameric ion channels in lipid bilayers. Based on these similarities, and the proposed involvement of channel activity as virulence factor in SARS-CoV E protein, MERS-CoV E protein may constitute a potential drug target.

Coronaviruses (CoV) cause common colds in humans, but are also responsible for the recent Severe Acute, and Middle East, respiratory syndromes (SARS and MERS, respectively). A promising approach for prevention are live attenuated vaccines (LAVs), some of which target the envelope (E) protein, which is a small membrane protein that forms ion channels. Unfortunately, detailed structural information is still limited for SARS-CoV E, and non-existent for other CoV E proteins. Herein, we report a structural model of a SARS-CoV E construct in LMPG micelles with, for the first time, unequivocal intermolecular NOEs. The model corresponding to the detergent-embedded region is consistent with previously obtained orientational restraints obtained in lipid bilayers and in vivo escape mutants. The C-terminal domain is mostly α-helical, and extramembrane intermolecular NOEs suggest interactions that may affect the TM channel conformation., Graphical abstract Unlabelled Image, Highlights • SARS-CoV E protein is a pentameric ion channel. • The SARS-CoV E protein (8–65) is almost completely α-helical in LMPG micelles. • Ten inter-monomeric NOEs have been identified. • The SARS-CoV E protein (8–65) pentameric model has been obtained. • Orientation of key residues, e.g. Val25 is consistent with previous in vivo results.

Highlights • Evolution of global PEDV strains. • Cross-reactivity between PEDV and other coronaviruses and antigenic variations among different PEDV strains. • Pathologic features of different PEDV strains. • Considerations for vaccine strain selection: PEDV virulence attenuation and in vivo cross-protection among PEDV variants., Emerging and re-emerging coronaviruses cause morbidity and mortality in human and animal populations, resulting in serious public and animal health threats and economic losses. The ongoing outbreak of a highly contagious and deadly porcine epidemic diarrhea virus (PEDV) in Asia, the Americas and Europe is one example. Genomic sequence analyses of PEDV variants have revealed important insights into the evolution of PEDV. However, the antigenic variations among different PEDV strains are less explored, although they may contribute to the failure of PEDV vaccines in Asian countries. In addition, the evolution of PEDV results in variants with distinct genetic features and virulence differences; thus PEDV can serve as a model to explore the molecular mechanisms of coronavirus evolution and pathogenesis. In this article, we review the evolution, antigenic relationships and pathologic features of PEDV strains. This information and review of researches will aid in the development of strategies for control and prevention of PED.

Highlights • Passive Lactogenic Immunity to TGEV and PEDV. • Induction of the ‘gut-mammary-sIgA axis’. • Homing of IgA plasmablasts from the intestine to the mammary gland in female swine. • Correlates of lactogenic immunity in gilts/sows. • Maternal Vaccination Strategies to Prevent TGEV and PEDV., Morbidity, mortality, and loss of productivity from enteric diseases in neonatal piglets cost swine producers millions of dollars annually. In 2013–2014, the porcine epidemic diarrhea virus (PEDV) outbreak led to $900 million to $1.8 billion in annual losses to US swine producers. Passive lactogenic immunity remains the most promising and effective way to protect neonatal suckling piglets from enteric diseases like PEDV. Protecting suckling piglets through lactogenic immunity is dependent on trafficking of pathogen-specific IgA plasmablasts to the mammary gland and accumulation of secretory IgA (sIgA) antibodies in milk, defined as the gut-mammary-sIgA axis. Due to an impermeable placenta, piglets are born agammaglobulinic, and are highly susceptible to a plethora of infectious agents. They rely solely on colostrum and milk antibodies for maternal lactogenic immunity. Previous advances in the development of live and attenuated vaccines for another devastating diarrheal virus of pigs, transmissible gastroenteritis virus (TGEV), provide insights into the mechanisms of maternal immunity and piglet protection. In this chapter, we will review previous research on TGEV-induced lactogenic immunity to provide a historical perspective on current efforts for PEDV control and vaccines in the swine industry. Identifying factors that influence lactogenic immunity and the gut-mammary-sIgA axis may lead to improved vaccine regimens for PEDV and other enteric pathogens in gestating swine and improved overall herd immunity, swine health and industry productivity.

Highlights ► The role of the C-terminal tail of the HCoV-229E N protein in oligomerization. ► A correlation between oligomerization and thermostability. ► The C-terminal tail peptide interferes with the oligomerization. ► The development of drugs to disrupt the oligomerization of the viral N protein., The coronavirus (CoV) N protein oligomerizes via its carboxyl terminus. However, the oligomerization mechanism of the C-terminal domains (CTD) of CoV N proteins remains unclear. Based on the protein disorder prediction system, a comprehensive series of HCoV-229E N protein mutants with truncated CTD was generated and systematically investigated by biophysical and biochemical analyses to clarify the role of the C-terminal tail of the HCoV-229E N protein in oligomerization. These results indicate that the last C-terminal tail plays an important role in dimer–dimer association. The C-terminal tail peptide is able to interfere with the oligomerization of the CTD of HCoV-229E N protein and performs the inhibitory effect on viral titre of HCoV-229E. This study may assist the development of anti-viral drugs against HCoV. Structured summary of protein interactions N and C-terminal tail peptidebind by cosedimentation in solution (View interaction) N and Nbind by cosedimentation in solution (View Interaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) C-terminal tail peptide and Nbind by fluorescence technology (View interaction) N and Nbind by cross-linking study (View interaction) N and Nbind by cross-linking study (View Interaction: 1, 2, 3, 4)

The sequence of a 6.0-kb fragment was compared in the 3′-encoding region of the genome in 27 infectious bronchitis virus (IBV) strains. All these strains have the same S-3-M-5-N gene order, as is the case for other IBVs. However, the sizes of the corresponding open reading frames (ORFs) of some genes varied among the virus strains. Phylogenetic analysis and sequence alignments demonstrated that recombination events had occurred in the origin and evolution of the strains CK/CH/LSD/03I and CK/CH/LLN/98I and the possible recombinant junction sites might be located at the 3c and M genes, respectively. The normal product of ORF 3a is 57 amino acids long, whereas a 43-bp deletion at the 3′-end of the CK/CH/LSD/03I 3a gene was detected, resulting in a frameshift event and C-terminally truncated protein with 47 amino acids. Comparison of the growth ability in embryos and replication and pathogenicity in chickens with IBV carrying the normal 3a gene indicated that this deleted sequence in the 3a gene of CK/CH/LSD/03I was not necessary for viral pathogenesis and replication either in vitro or in vivo. Occurrence of a mutation at the corresponding position of the CK/CH/LLN/98I start codon in the 3a gene led to the absence of ORF 3a in this virus, resulting in a novel genomic organization at the 3′-encoding regions: S-3b, 3c-M-5a, 5b-N. Comparison with other viruses carrying the normal 3a gene revealed that CK/CH/LLN/98I had replication and pathogenicity abilities in vivo similar to those of other IBVs; however, its growth ability in embryos was lower, although the relationship between the lower growth ability and the ORF 3a defect requires further confirmation.

Little information is available on persistent infection of severe acute respiratory syndrome (SARS) coronavirus (CoV). In this study, we established persistent infection of SARS-CoV in the Vero E6 cell line. Acute infection of Vero E6 with SARS-CoV produced a lytic infection with characteristic rounding cytopathic effects (CPE) and the production of a large number of infectious particles in the culture fluid within 3 days post-infection. Upon subsequent culturing of the remaining adherent cells, the cells gradually proliferated and recovered normal morphology similar to that of the parental cells, and continued to produce large numbers of infectious viral particles during the observation period of 5 months. Among a total of 87 cell clones obtained from the persistently infected Vero E6, only four cell clones (named #13, #18, #21, and #34) were positive for viral RNA. Clones #13, #18, and #34 shifted to viral RNA-negative during subsequent cultures, while #21 continuously produced infectious particles at a high rate. The SARS-CoV receptor, angiotensin-converting enzyme 2, was almost completely down regulated from the cell surface of persistently infected cells. Western blot analysis as well as electron microscopy indicated that the ratios of spike to nucleocapsid protein in clone #21 as well as its parental persistently infected cells were lower than that in the cells in the acute phase of infection. These Vero E6 cells persistently infected with SARS-CoV may be useful for clarifying the mechanism of the persistent infection and also for elucidating the possible pathophysiologic significance of such long-term maintenance of this virus.

SARS-CoV 3a protein was a unique protein of SARS coronavirus (SARS-CoV), which was identified in SARS-CoV infected cells and SARS patients' specimen. Recent studies revealed that 3a could interact specifically with many SARS-CoV structural proteins, such as M, E and S protein. Expressed 3a protein was reported to localize to Golgi complex in SARS-CoV infected cells. In this study, it was shown that 3a protein was mainly located in Golgi apparatus with different tags at N- or C-terminus. The localization pattern was similar in different transfected cells. With the assay of truncated 3a protein, it was shown that 3a might contain three transmembrane regions, and the second or third region was properly responsible for Golgi localization. By ultra-centrifugation experiment with different extraction buffers, it was confirmed that 3a was an integral membrane protein and embedded in the phospholipid bilayer. Immunofluorescence assay indicated that 3a was co-localized with M protein in Golgi complex in co-transfected cells. These results provide a new insight for further study of the 3a protein on the pathogenesis of SARS-CoV.

The present study was undertaken to determine immune response and protection efficacy of a spike (S) protein fragment containing neutralizing epitopes (4F/4R) of turkey coronavirus (TCoV) by priming with DNA vaccine and boosting with the recombinant protein from the corresponding DNA vaccine gene segment. Turkeys were vaccinated by priming with either one dose (G1-750DP) or two doses (G3-750DDP) of 750 μg DNA vaccine expressing 4F/4R S fragment and boosting with one dose of 200 μg 4F/4R S fragment. One dose of 100 μg DNA vaccine mixed with polyethyleneimine (PEI) and sodium hyaluronate (HA) followed by one dose of 750 μg DNA vaccine and one dose of 200 μg 4F/4R S fragment were given to the turkeys in group G2-100DPH. After infectious challenge by TCoV, clinical signs and TCoV detected by immunofluorescence antibody (IFA) assay were observed in less number of turkeys in vaccination groups than that in challenge control groups. TCoV viral RNA loads measured by quantitative real-time reverse transcription-PCR were lower in vaccinated turkeys than those in challenge control turkeys. The turkeys in G3-750DDP produced the highest level of TCoV S protein-specific antibody and virus neutralization (VN) titer. Comparing to the turkeys in G1-750DP, significantly less TCoV were detected by IFA in the turkeys in G2-100DPH receiving an extra dose of 100 μg DNA mixed with PEI and HA. The results indicated that DNA-prime protein-boost DNA vaccination regimen targeting TCoV S fragment encompassing neutralizing epitopes induced humoral immune response and partially protected turkeys against infectious challenge by TCoV.

We have previously reported the nucleotide sequences of gene 2 (spike (S) protein gene), gene 6 (nucleocapsid (N) protein gene), and the 3′ end untranslated region of a novel avian infectious bronchitis virus (IBV) strain, CU-T2 [Jia et al. (1995) Arch. Virol. 140, 259–271]. In the present report we describe the sequences of the remaining genes of this strain (gene 3, 4 and 5) with the exception of gene 1 (RNA polymerase gene). Gene 3 contained three open reading frames (ORFs), 3a, 3b and 3c of 174, 195 and 282 nucleotides (nt), respectively. Gene 4 (membrane (M) protein gene) consisted of 749 nt with a single ORF of 687 nt. Gene 5 contained two ORFs, 5a and 5b, with 198 and 249 nt, respectively. Thus, in total, there were 7349 nt from the 5′ end of S protein gene to the 3′ end of the CU-T2 genome. The overall nt sequence homologies between gene 3, 4, and 5 of CU-T2 and those of other strains were between 84.1–90.8%, 85.8–88.8% and 90.4–96.4%, respectively. The predicted amino acid (aa) sequence homologies revealed that gene 3b and 5b were more conserved than 3a, 3c and 5a. Each individual gene of CU-T2 strain (with the exception of the RNA polymerase gene) had a different level of homology with the homologous gene of other strains, suggesting that the evolution of IBV strains in general has been a complex, and as yet, poorly understood process. © 1997 Elsevier Science B.V. All rights reserved.

A recombinant vaccinia virus producing the bacteriophage T7 RNA polymerase was used to express foreign genes in eukaryotic cells. Translation efficiency in this expression system was enhanced significantly by employing the encephalomyocarditis virus (EMCV) 5'-untranslated region (UTR) which confers cap-independent translation by directing internal initiation of translation. The enhancement was accomplished by fusing open reading frames (ORFs) to the N terminus of the EMCV polyprotein coding region, thus utilizing its highly efficient translation initiation site. Expression vectors were constructed to allow cloning in all three reading frames. As reporter genes, we used the lacZ gene and a number of genes encoding coronavirus structural proteins: among others the genes encoding glycoproteins with N-terminal signal sequences. The signal sequences of these glycoproteins are located internally in the primary translation product. We demonstrated that this did not interfere with translocation and glycosylation and yields biologically active proteins. The usefulness of sequences that direct internal initiation was extended by using EMCV UTR s to express two and three ORFs from polycistronic mRNAs.

Virus-like particles (VLPs) and nano-particles (NP) are increasingly considered for both prophylactic and therapeutic vaccines for a wide variety of human and animal diseases. Indeed, 2 VLPs have already been licensed for use in humans, the human papilloma virus vaccine and the hepatitis B virus vaccine. (1) Reflecting this increased interest, a second international conference with a specific focus on VLPs and NP was held at the Salk Institute for Biological Studies in La Jolla, California, in June 2014. Approximately 100 attendees, hailing from many nations, came from academic institutions, research institutes, and biotech companies. A wide variety of topics were discussed, ranging from development and characterization of specific VLP and NP vaccine candidates to methods of production of these particles. Session three was focused on the general question of immune responses to VLPs.