Search

IE1 Sequence Alignment in Several Primary GBM Tissues (S1); HCMV IE is enriched in the SSEA1+ fraction of primary GBM cells and co-localizes with stemness markers in situ (S2); IE siRNA Optimization (S3); HCMV transcripts are enriched in the GSC fraction (S4); HCMV IE modulates Sox2 expression in GBM via miR145 (S5); IE1 overexpression induces Sox2 via miRNA145 inhibition in GSCs (S6); IE attenuation induces a mesenchymal and pro-inflammatory phenotype in HCMV-positive GSC (S7); Immunohistochemical analyses of IE1+/- mouse gliomas (S8); GSC lines used in this study are tumorigenic in vivo (S9); CR208, an IE1 deficient HCMV does not promote GBM stemness to the same extent as Towne parental strain (S10).

PDF file - 131K, Generation of Trp53+/- mice; Human samples; Virus preparation; HCMV in situ hybridization; HCMV DNA PCR and RT-PCR; Other statistical analysis

PDF file - 77K

PDF file - 60K, Analysis for MCMV DNA and RNA in muscle and connective tissue in mice infected with MCMV at 4 weeks of age.

Detection of HCMV and cellular markers in 40 patient samples included in this study (S1); HCMV serostatus in a subset of GBM cases (S2); Histopathological and immunohistochemical characterization of spontaneous mouse gliomas (S3).

Description of additional methods and procedures used in the study. Also includes Supplementary References.

PDF file - 600K, Control IHC and additional HCMV IHC in human RMS

Legend for Supplementary Figures S1-S10.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate-early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with oncogenic properties. Here, we show how HCMV IEs are preferentially expressed in glioma stem–like cells (GSC), where they colocalize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSCs that are endogenously infected with HCMV, attenuating IE expression by an RNAi-based strategy was sufficient to inhibit tumorsphere formation, Sox2 expression, cell-cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSCs elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSCs, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and proinflammatory cytokines, resembling the therapeutically resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miR-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSCs infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared with mock-infected human GSCs. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in GBM cells. Cancer Res; 75(15); 3065–76. ©2015 AACR.

// Charles Cobbs 1,2,* , Sabeena Khan 1,* , Lisa Matlaf 1 , Sean McAllister 1 , Alex Zider 1 , Garret Yount 1 , Kenneth Rahlin 1 , Lualhati Harkins 3 , Vladimir Bezrookove 1 , Eric Singer 1 , and Liliana Soroceanu 1 1 California Pacific Medical Center Research Institute, San Francisco, CA 2 The Swedish Neuroscience Institute, Ben and Catherine Ivy Brain Tumor Center, Seattle, WA, and 3 University of Alabama at Birmingham, Birmingham AL * These authors contributed equally to the work. Correspondence: Liliana Soroceanu, email: // Keywords : Human Cytomegalovirus Glycoprotein B, glioblastoma, tumor invasiveness, Platelet Derived Growth Factor Receptor Alfa, slice invasion assay, time-lapse videomicroscopy. Received : January 21, 2014 Accepted : March 10, 2014 Published : March 12, 2014 Abstract Our laboratory first demonstrated that human cytomegalovirus (HCMV) is associated with the most deadly form of primary brain tumor, glioblastoma (GBM). We showed that HCMV glycoprotein B (gB) mediates viral cellular entry via the receptor tyrosine kinase PDGFR-alpha (PDGFRα), resulting in activation of the PI3K/Akt pathway, a critical signaling axis gliomagenesis. Here, we investigated the effects of gB overexpression on glioma progression. We demonstrate that gB is endogenously expressed in primary GBM samples and show that ectopic gB expression in glioma cells induced sustained phosphorylation of PDGFRα, Akt, and Src. Recombinant gB protein and the whole virus enhanced invasion of primary glioblastoma cells into Matrigel and rat brain slices, and this effect was specifically inhibited by neutralizing antibodies to either gB or PDGFRα. Importantly, neutralizing antibodies to gB significantly inhibited the invasiveness of patient-derived HCMV-positive glioblastoma cells, suggesting that functional inhibition of this viral protein could hinder glioblastoma progression. gB overexpression promoted in vivo glioma growth and enhanced phosphor-Akt levels and tumor cell dispersal relative to controls. Taken together, our results demonstrate that HCMV gB promotes key hallmarks of glioblastoma and suggest that targeting gB may have therapeutic benefits for patients with HCMV -positive gliomas.

Cytomegalovirus (CMV) has been detected in several human cancers, but it has not proven to be oncogenic. However, recent studies have suggested mechanisms through which cytomegalovirus may modulate the tumor environment, encouraging its study as a positive modifier of tumorigenesis. In this study, we investigated the effects of cytomegalovirus infection in Trp53 heterozygous mice. Animals were infected with murine cytomegalovirus (MCMV) after birth at 2 days (P2) or 4 weeks of age and then monitored for tumor formation. Mice injected at 2 days of age developed tumors at a high frequency (43%) by 9 months of age. In contrast, only 3% of mock-infected or mice infected at 4 weeks developed tumors. The majority of tumors from P2 MCMV–infected mice were pleomorphic rhabdomyosarcomas (RMS) harboring MCMV DNA, RNA, and protein. An examination of clinical cases revealed that human RMS (embryonal, alveolar, and pleomorphic) harbored human cytomegalovirus IE1 and pp65 protein as well as viral RNA. Taken together, our findings offer support for the hypothesis that cytomegalovirus contributes to the development of pleomorphic RMS in the context of Trp53 mutation, a situation that occurs with high frequency in human RMS. Cancer Res; 72(22); 5669–74. ©2012 AACR.

Glioblastoma multiforme (GBM) is the most common and lethal adult brain tumor. Resistance to standard radiation and chemotherapy is thought to involve survival of GBM cancer stem cells (CSCs). To date, no single marker for identifying GBM CSCs has been able to capture the diversity of CSC populations, justifying the needs for additional CSC markers for better characterization. Employing targeted mass spectrometry, here we present five cell-surface markers HMOX1, SLC16A1, CADM1, SCAMP3, and CLCC1 which were found to be elevated in CSCs relative to healthy neural stem cells (NSCs). Transcriptomic analyses of REMBRANDT and TCGA compendiums also indicated elevated expression of these markers in GBM relative to controls and non-GBM diseases. Two markers SLC16A1 and HMOX1 were found to be expressed among pseudopalisading cells that reside in the hypoxic region of GBM, substantiating the histopathological hallmarks of GBM. In a prospective study (N = 8) we confirmed the surface expression of HMOX1 on freshly isolated primary GBM cells (P0). Employing functional assays that are known to evaluate stemness, we demonstrate that elevated HMOX1 expression is associated with stemness in GBM and can be modulated through TGFβ. siRNA-mediated silencing of HMOX1 impaired GBM invasion—a phenomenon related to poor prognosis. In addition, surgical resection of GBM tumors caused declines (18% ± 5.1SEM) in the level of plasma HMOX1 as measured by ELISA, in 8/10 GBM patients. These findings indicate that HMOX1 is a robust predictor of GBM CSC stemness and pathogenesis. Further understanding of the role of HMOX1 in GBM may uncover novel therapeutic approaches.

Summary Background Colorectal cancer is the second most frequent cause of death from cancer in the USA, and most tumours arise sporadically with no clear cause or genetic predisposition. Human cytomegalovirus is a β-herpesvirus that is endemic in the human population and can cause life-threatening disease in immunosuppressed adults. In vitro, human cytomegalovirus can transform cells and dysregulate many cellular pathways relevant to colon adenocarcinoma pathogenesis, especially those affecting the cell cycle, mutagenesis, apoptosis, angiogenesis, and cyclo-oxygenase-2 (COX-2) expression. We aimed to assess whether gene products of human cytomegalovirus could be detected in colorectal cancers. Methods We obtained formalin-fixed, paraffin-embedded pathological specimens of colorectal polyps, adeno-carcinomas, and adjacent normal mucosa from 29 patients. To detect human cytomegalovirus proteins and nucleic acids, we used immunohistochemistry with two different monoclonal antibodies, in-situ hybridisation, and PCR with DNA sequencing. Findings Human cytomegalovirus proteins IE1–72 and pp65 were detected in a tumour cell-specific pattern in 14 (82%) of 17 and seven (78%) of nine colorectal polyps, respectively, and 12 (80%) of 15 and 11 (92%) of 12 adenocarcinomas, respectively, but not in adjacent non-neoplastic colon biopsy samples from the same patients (none of seven and none of two, respectively). Human cytomegalovirus infection of colon-cancer cells (Caco-2) in vitro resulted in specific induction of Bcl-2 and cyclo-oxygenase-2 proteins, both of which are thought to contribute to progression of colon cancer. Interpretation Human cytomegalovirus nucleic acids and proteins can be found that specifically localise to neoplastic cells in human colorectal polyps and adenocarcinomas, and virus infection can induce important oncogenic pathways in colon-cancer cells.

The standard treatment of high-grade glioma presents a combination of radiotherapy, chemotherapy and surgery. Immunotherapy is proposed as a potential adjunct to standard cytotoxic regimens to target remaining microscopic disease following resection. We have shown ex vivo expanded/activated γδ T cells to be a promising innate lymphocyte therapy based on their recognition of stress antigens expressed on gliomas. However, successful integration of γδ T cell therapy protocols requires understanding the efficacy and safety of adoptively transferred immune cells in the post-treatment environment. The unique features of γδ T cell product and the environment (hypoxia, inflammation) can affect levels of expression of key cell receptors and secreted factors and either promote or hinder the feasibility of γδ T cell therapy. We investigated the potential for the γδ T cells to injure normal brain tissue that may have been stressed by treatment. We evaluated γδ T cell toxicity by assessing actual and correlative toxicity indicators in several available models including: (1) expression of stress markers on normal primary human astrocytes (as surrogate for brain parenchyma) after irradiation and temozolomide treatment, (2) cytotoxicity of γδ T cells on normal and irradiated primary astrocytes, (3) microglial activation and expression of stress-induced ligands in mouse brain after whole-brain irradiation and (4) expression of stress-induced markers on human brain tumors and on normal brain tissue. The lack of expression of stress-induced ligands in all tested models suggests that γδ T cell therapy is safe for brain tumor patients who undergo standard cytotoxic therapies.

R egulators of G -protein S ignaling (RGS) proteins attenuate signaling activities of G proteins, and modulation of expression appears to be a primary mechanism for regulating RGS proteins. In human astrocytoma 1321N1 cells RGS2 expression was increased by activation of muscarinic receptors coupled to phosphoinositide signaling with carbachol, or by increased cyclic AMP production, demonstrating that both signaling systems can increase the expression of a RGS family member in a single cell type. Carbachol-stimulated increases in endogenous RGS2 protein levels appeared by immunocytochemical analysis to be largely confined to the nucleus, and this localization was confirmed by Western blot analysis which showed increased nuclear, but not cytosolic, RGS2 after carbachol treatment. Additionally, transiently expressed green fluorescent protein (GFP)-tagged, 6×His-tagged, or unmodified RGS2 resulted in a predominant nuclear localization, as well as a distinct accumulation of RGS2 along the plasma membrane. The intranuclear localization of GFP-RGS2 was confirmed with confocal microscopy. Thus, RGS2 expression is rapidly and transiently increased by phosphoinositide signaling and by cyclic AMP, and endogenous and transfected RGS2 is largely, although not entirely, localized in the nucleus.

Based on previous findings of increased nitric oxide synthase (NOS) expression in human gliomas (4), we hypothesized that peroxynitrite, a highly reactive metabolite of nitric oxide (NO) and superoxide (O(*-)(2)), might be increased in these tumors in vivo. Here we demonstrate that nitrotyrosine (a footprint of peroxynitrite protein modification) is present in human malignant gliomas. Furthermore, we show that p53, a key tumor suppressor protein, has evidence of peroxynitrite-mediated modifications in gliomas in vivo. Experiments in vitro demonstrate that peroxynitrite treatment of recombinant wild-type p53 at physiological concentrations results in formation of higher molecular weight aggregates, tyrosine nitration, and loss of specific DNA binding. Peroxynitrite treatment of human glioma cell lysates similarly resulted in selective tyrosine nitration of p53 and was also associated with loss of p53 DNA binding ability. These data indicate that tyrosine nitration of proteins occurs in human gliomas in vivo, that p53 may be a target of peroxynitrite in these tumors, and that physiological concentrations of peroxynitrite can result in a loss of p53 DNA binding ability in vitro. These findings raise the possibility that peroxynitrite may contribute to loss of wild-type p53 functional activity in gliomas by posttranslational protein modifications.

RGS2, a regulators of G-protein signaling family member, regulates G-protein signaling and is itself controlled in part by regulated expression. We tested if cell stress regulates RGS2 expression in human astrocytoma 1321N1 cells. Treatment with H2O2 increased RGS2 mRNA levels time- and concentration-dependently, with 200 microM H2O2 causing an approximately eightfold increase after 2 h. Peroxynitrite and heat shock also increased RGS2 mRNA levels. H2O2-induced RGS2 expression was negatively regulated by phosphoinositide-3-kinase and extracellular signal-regulated kinases. H2O2 also concentration-dependently increased RGS2 protein levels, and the RGS2 appeared to be predominantly in the nucleus. These results demonstrate that RGS2 expression is up-regulated by cell stress.

An increased awareness of the potential oncomodulatory properties of human cytomegalovirus (HCMV) has evolved over the last decade. We first reported the presence of HCMV in human glioblastomas, and subsequently these findings have been corroborated by other groups. However, some controversy has been associated with the immunohistochemical and in situ hybridization techniques used, since standard immunohistochemical and in situ hybridization techniques have been insufficient to detect low level HCMV antigens and nucleic acids in some tumor tissues. Here, we present detailed methods that can be used for the sensitive detection of low level HCMV antigens and nucleic acids in human glioblastoma specimens. Using these techniques, HCMV is frequently detected in frozen and formalin fixed paraffin-embedded tissue specimens. Furthermore, we demonstrate how human primary glioblastoma cells can be cultured in vitro, and how these cells can be used for detection of HCMV by immunofluorescence, in situ hybridization, western blot, and RT-PCR.

Introduction: CD3+ γδ+ T cells comprise 2% to 5% of circulating T cells with Vγ9Vδ2+ cells the dominant circulating subtype. Vγ9Vδ2+ cells recognize non-peptide phosphoantigens and stress-associated NKG2D ligands expressed on malignant cells. Strategies that incorporate the tumoricidal properties of γδ T cells represent a promising immunotherapeutic strategy for treatment of solid malignancies including neuroblastoma (NB). In this prospective, non-randomized Phase I trial, we assessed whether circulating Vγ9Vδ2+ cells could be safely expanded using intravenous ZOL (Zoledronate [Zometa®]) and subcutaneous Interleukin-2 (IL-2) in patients with refractory NB. Methods: Patients 2 to 21 years of age with refractory neuroblastoma with no known curative therapeutic options received ZOL on day 1, and IL-2 on days 1 to 5 and 15 to 19 of each 28-day cycle (n = 4). Lymphocyte immunophenotyping was assessed weekly. Immunophenotyping studies from the treatment group were compared with healthy pediatric controls (n = 16; range, 5y–15y) and of untreated NB disease controls (n = 9; range, 4m–18y). Results: Treatment was well tolerated with no unexpected grade 3 and 4 toxicities. Lymphocyte subset counts did not differ significantly between volunteers and disease controls with the exception of γδ+ T cell counts that were significantly higher in healthy volunteers (212 + 93 vs. 89 + 42, P = 0.05). Study patients showed increases in circulating γδ+ T cell count (3–10 fold) after the first week, increasing into the range seen in healthy volunteers (125 + 37, P = 0.1940). Interestingly, all ZOL + IL-2 treated patients showed significant increases in CD3+CD4+CD27hiCD127dim T cells that rose weekly in 2 patients throughout the 4 weeks of observation (maximum 41% and 24% of total CD3+CD4+ T cells, respectively). Conclusions: In summary, combined ZOL and IL-2 is well tolerated and restored γδ+ T cell counts to the normal range with a moderate expansion of Natural Killer cells. Progressive increases in circulating CD4+ T cells with a regulatory phenotype cells may offset beneficial effects of this therapy.

Udgivelsesdato: 2008-Aug-26 The activity of HCO(3)(-) transporters contributes to the acid-base environment of the nervous system. In the present study, we used in situ hybridization, immunoblotting, immunohistochemistry, and immunogold electron microscopy to localize electrogenic Na/bicarbonate cotransporter NBCe1 splice variants (-A, -B, and -C) in rat brain. The in situ hybridization data are consistent with NBCe1-B and -C, but not -A, being the predominant NBCe1 variants in brain, particularly in the cerebellum, hippocampus, piriform cortex, and olfactory bulb. An antisense probe to the B and C variants strongly labeled granule neurons in the dentate gyrus of the hippocampus, and cells in the granule layer and Purkinje layer (e.g. Bergmann glia) of the cerebellum. Weaker labeling was observed in the pyramidal layer of the hippocampus and in astrocytes throughout the brain. Similar, but weaker labeling was obtained with an antisense probe to the A and B variants. In immunoblot studies, antibodies to the A and B variants (alphaA/B) and C variant (alphaC) labeled approximately 130-kDa proteins in various brain regions. From immunohistochemistry data, both alphaA/B and alphaC exhibited diffuse labeling throughout brain, but alphaA/B labeling was more intracellular and punctate. Based on co-localization studies with antibodies to neuronal or astrocytic markers, alphaA/B labeled neurons in the pyramidal layer and dentate gyrus of the hippocampus, as well as cortex. alphaC labeled glia surrounding neurons (and possibly neurons) in the neuropil of the Purkinje cell layer of the cerebellum, the pyramidal cell layer and dentate gyrus of the hippocampus, and the cortex. According to electron microscopy data from the cerebellum, alphaA/B primarily labeled neurons intracellularly and alphaC labeled astrocytes at the plasma membrane. In summary, the B and C variants are the predominant NBCe1 variants in rat brain and exhibit different localization profiles.

Introduction: Colorectal cancer (CRC) and other solid tumors rely on production of pro-inflammatory cytokines and growth factors to support their rapid growth. Posttranscriptional control of these factors involves interplay between RNA stabilizing and destabilizing factors. We have observed that the protein tristetraprolin (TTP), a RNA destabilizer, is down-regulated in CRCs and that interleukin (IL)-8, a proinflammatory cytokine, is up-regulated. We hypothesized that loss of negative regulation by TTP selectively favors expression of growth factors and protooncogenes that promote tumor progression. Furthermore, new evidence suggests that TTP is associated estrogen receptor-α (ERα) and functions as a co-repressor of ERα activation interaction with histone deacetylases on the gene promoter; nuclear TTP is linked to this tumor suppressor function. Since CRCs of African Americans (AAs) often present worse outcomes relative to those of Caucasian Americans (CAs), we analyzed the expression of TTP and its targets and assessed its subcellular localization in primary CRCs of AA and CA patients and in cultured colon cancer cells. Its effects on disease progression were also determined. Methods: Paired normal and CRC tissues from 45 patients (AA = 26 and CA = 19), were evaluated by qPCR for mRNA expression levels of TTP, IL-8, and VEGF. Tissue sections were also assayed for immunophenotypic expression by immunohistochemistry, and the staining patterns (nuclear and cytoplasmic) were assessed. To determine TTP effects on the NF-kB pathway, colon cancer cells (CCL235, HCT116 and LoVo) were stimulated with TNF-α, and total RNA was analyzed for TTP, IL-8, VEGF, and cIAP2 expression; interaction of TTP and ERα was also assessed. Results: In 31 of 45 CRCs, there was down-regulated expression of TTP mRNA, and low TTP levels correlated with advanced tumor stage. Low levels of TTP were present in 21 of 26 AAs and in 12 of 19 CAs. There was an inverse correlation between TTP and IL-8 expression in relation to tumor stage. There was an agreement between mRNA expression and immunophenotypic profiles for TTP and IL-8. Furthermore, there was reduced or a lack of nuclear staining of TTP in malignant cells relative to normal/benign epithelial cells. In cultured colon cancer cells, TTP mRNA levels inversely correlated with levels of IL-8, VEGF, and cIAP2 mRNAs, suggesting interactions of TTP with these cell survival factors. Conclusions: Reduced expression of TTP was noted in tumors, especially in CRCs of AAs, and a loss or decreased nuclear expression of TTP was observed in malignant cells. Lower TTP levels correlated with advanced tumor stage. These preliminary findings suggest that TTP negatively regulates the expression of cell survival factors in the NF-kB pathway. This work was supported by funds from the NIH/NCI (a career development supplement to grant U54-CA118948). Citation Format: Esther A. Suswam, Balananda-Dhurjati K. Putcha, Amit K. Tiwari, Trafina Jadhav, Kiera D. Walker, Lualhati Harkins, Samir Amer, Isam-Eldin Eltoum, Sejong Bae, Upender Manne. Molecular and cellular localization profiles of tristetraprolin in colorectal cancer: Implications for tumor progression in diverse patient populations. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 4953. doi:10.1158/1538-7445.AM2015-4953

Human γδ T cells are potent effectors against glioma cell lines in vitro and in human/mouse xenograft models of glioblastoma, however, this effect has not been investigated in an immunocompetent mouse model. In this report, we established GL261 intracranial gliomas in syngeneic WT C57BL/6 mice and measured circulating γδ T cell count, phenotype, Vγ/Vδ repertoire, tumor histopathology, NKG2D ligands expression, and T cell invasion at day 10-12 post-injection and at end stage. Circulating γδ T cells transiently increased and upregulated Annexin V expression at post-tumor day 10-12 followed by a dramatic decline in γδ T cell count at end stage. T cell receptor repertoire showed no changes in Vγ1, Vγ4, Vγ7 or Vδ1 subsets from controls at post-tumor day 10-12 or at end stage except for an end-stage increase in the Vδ4 population. Approximately 12% of γδ T cells produced IFN-γ. IL-17 and IL-4 producing γδ T cells were not detected. Tumor progression was the same in TCRδ-/- C57BL/6 mice as that observed in WT mice, suggesting that γδ T cells exerted neither a regulatory nor a sustainable cytotoxic effect on the tumor. WT mice that received an intracranial injection of γδ T cells 15m following tumor placement showed evidence of local tumor growth inhibition but this was insufficient to confer a survival advantage over untreated controls. Taken together, our findings suggest that an early nonspecific proliferation of γδ T cells followed by their depletion occurs in mice implanted with syngeneic GL261 gliomas. The mechanism by which γδ T cell expansion occurs remains a subject for further investigation of the mechanisms responsible for this immune response in the setting of high-grade glioma.

Recent epidemiological data indicate that a history of increased exposure to sexually transmitted diseases is associated with an increased risk of prostate cancer. Human cytomegalovirus (HCMV) is a member of the herpesvirus family, is sexually transmitted in adults and can persistently infect prostatic epithelium in non-immunocompromised hosts. Based on increased awareness of the oncogenic potential of this virus, we decided to reexplore the issue of whether HCMV might be involved in prostate cancer pathogenesis.Paraffin embedded biopsy specimens from 22 randomly selected patients with prostatic intraepithelial neoplasia (PIN) lesions and prostatic carcinoma were analyzed by immunohistochemistry, in situ hybridization, polymerase chain reaction and DNA sequencing to detect HCMV nucleic acids and determine whether HCMV gene products were specifically associated with neoplastic cells.We detected HCMV proteins and/or nucleic acids in all 22 of the 22 preneoplastic and neoplastic prostate lesions evaluated. HCMV proteins were specifically and often highly expressed in basal cell hyperplasia and PIN lesions, and to a lesser degree in carcinoma cells.To our knowledge these data demonstrate for the first time the specific localization of HCMV nucleic acids and proteins in a high percent of PIN and prostate carcinoma lesions, and raise the possibility that HCMV might contribute to the natural history of prostatic cancer.

Malignant gliomas are the most common primary brain tumors in adults, have no known etiology, and are generally rapidly fatal despite current therapies. Human cytomegalovirus (HCMV) is beta-herpesvirus trophic for glial cells that persistently infects 50-90% of the adult human population. HCMV can be reactivated under conditions of inflammation and immunosuppression, and HCMV gene products can dysregulate multiple cellular pathways involved in oncogenesis. Here we show that a high percentage of malignant gliomas are infected by HCMV and multiple HCMV gene products are expressed in these tumors. These data are the first to show an association between HCMV and malignant gliomas and suggest that HCMV may play an active role in glioma pathogenesis.

Despite not being considered oncogenic, cytomegalovirus (CMV) has been detected in an increasing number of malignancies. However, recent studies have suggested mechanisms through which CMV may modulate the tumor environment, encouraging its study as a positive modifier of tumorigenesis. In this study, we investigated the effects of CMV infection in Trp53 heterozygous mice. Animals were infected with murine CMV (MCMV) after birth at 2 days (P2) or 4 weeks of age via intraperitoneal injection and then monitored for tumor formation. Additional control cohorts were mock-infected (saline vehicle) or infected with HSV-1, a similar herpes virus. Following MCMV infection, widespread systemic infection ensued followed by immune clearance of the virus resulting in seroconversion. Mice infected at P2 developed tumors at a high frequency (43%) by 9 months of age. In contrast, only 3% of mock-infected or mice infected at 4 weeks developed tumors. The majority of tumors from P2 MCMV-infected mice were pleomorphic rhabdomyosarcomas (RMS) as evidenced by MyoD1, Desmin, and Myogenin staining. Importantly, MCMV-infected tumors contained MCMV DNA, RNA, and protein. An examination of clinical cases revealed that human RMS (embryonal, alveolar, and pleomorphic) harbored human CMV IE1 and pp65 protein as well as viral RNA. All of the cases (n=18) tested positive for CMV genetic material. CMV protein was found throughout the tumor including pleomorphic cells. Additionally, perivascular areas demonstrated intense staining consistent with other reports of linking CMV with angiogenesis. To confirm the selective presence of HCMV DNA in human RMS, quantitative PCR analysis showed that tumors expressed an average of 81.1 copies/ng of HCMV-UL83 and of 22.2 copies/ng of HCMV-UL146 compared to 0 and 0.49 copies/ng in normal muscle, respectively. The amplified products’ nucleotide sequence was greater than 95% identical to that of a clinical strain Taken together, our findings offer support for the hypothesis that CMV contributes to the development of pleomorphic RMS in the context of Trp53 mutation, a situation which occurs with high frequency in human RMS. Citation Format: Richard L. Price, Katherine Bingmer, Lualhati Harkins, Hans Iwenofu, Chang-Hyuk Kwon, Charles Cook, Christopher Pelloski, E Antonio Chiocca. Cytomegalovirus infection leads to pleomorphic rhabdomyosarcomas in Trp53 +/- mice. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 4777. doi:10.1158/1538-7445.AM2013-4777

Glioblastoma multiforme (GBM) remains frustratingly impervious to any existing therapy. We have previously shown that GBM is sensitive to recognition and lysis by ex vivo activated γδ T cells, a minor subset of lymphocytes that innately recognize autologous stress-associated target antigens via the T cell receptor and/or NKG2D. However, circulating γδ T cell counts and function are significantly reduced in patients with GBM. We sought to determine the role of γδ T cells in the immune response to high-grade gliomas in C57BL/6 mice bearing GL261 cell line-derived intracranial gliomas. Examination of mice 15 days after intracranial tumor placement and prior to development of neurologic symptoms revealed small infiltrating high-grade gliomas near the injection site. Concurrently, the peripheral blood γδ T cell count was significantly increased when compared to control mice that received only the methylcellulose vehicle (p=0.0003). T cell expansion was confined to the γδ T cell compartment, and a substantial proportion of γδ T cells in tumor-bearing mice expressed Annexin-V (20%-45%) indicating progression to apoptosis. Annexin-V expression in control mice was confined to 2-5% of γδ T cells, significantly less than tumor-bearing mice (p Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 530. doi:1538-7445.AM2012-530

In the April 2006 issue of the Journal of NeuroVirology, Poltermann et al (2006) report a lack of association between human cytomegalovirus (HCMV) and glioma. This subject is highly controversial, and the debate over the role of HCMV in glioma pathogenesis is ongoing. Given the fatal nature of these tumors, and the fact that very little is known about their etiology, extreme technical proficiency and scientific scrutiny must be used when examining potential causes. Several technical issues described in the article should be addressed to allowmore accurate evaluation of the findings. With regards to the immunohistochemistry protocol: First, the authors report using brain tumor sections 8 μm thick. Such thickness is typically used for surface staining and is known to be too thick for antigen-antibody binding. For optimal staining, a thickness of 6 μm is suggested (Cobbs et al, 2002). This allows complete deparaffinization,which is critical for proper enzyme digestion and antigen retrieval. Second, the authors fail to describe any postfixation of tissue sections with formalin prior to digestion, as well as any pepsin digestion before antigen retrieval. Formalin treatment (which stabilizes the antigen) is critical for epitope conditioning, and pepsin digestion is critical for HCMV detection because pepsin cleaves specific peptide residues that interfere with antigen-antibody binding. Third, the authors describe antigen retrieval using Citra buffer. This approach results in false-negative staining that could be overcome by combining both pepsin digestion and antigen retrieval (Polak et al, 2003) at 45◦C to 50◦C for 2.5 h; false-negative staining may result

Introduction Human cytomegalovirus (HCMV) establishes a persistent life-long infection, and can cause severe pathology in the fetus and the immunocompromised host[1]. Breast milk is the primary route of transmission in humans worldwide, and breast epithelium is thus a likely site of persistent infection and/or reactivation, though this phenomenon has not previously been demonstrated. Increasing evidence indicates HCMV infection can modulate signaling pathways associated with oncogenesis. We hypothesized that persistent HCMV infection occurs in normal adult breast epithelium and that persistent viral expression might be associated with normal and neoplastic ductal epithelium. Methods Surgical biopsy specimens of normal breast (n = 38) breast carcinoma (n = 39) and paired normal breast from breast cancer patients (n = 21) were obtained. Specimens were evaluated by immunohistochemistry, in situ hybridization, PCR and DNA sequencing for evidence of HCMV antigens and nucleic acids. Results We detected HCMV expression specifically in glandular epithelium in 17/27 (63%) of normal adult breast cases evaluated. In contrast, HCMV expression was evident in the neoplastic epithelium of 31/32 (97%) patients with ductal carcinoma in situ (DCIS) and infiltrating ductal carcinoma (IDC) cases evaluated (p = 0.0009). Conclusions These findings are the first to demonstrate that persistent HCMV infection occurs in breast epithelium in a significant percentage of normal adult females. HCMV expression was also evident in neoplastic breast epithelium in a high percentage of normal and neoplastic breast tissues obtained from breast cancer patients, raising the possibility that viral infection may be involved in the neoplastic process.