Search

Deer antlers are unique because they are cast and regenerate each year. They are the fastest-growing structure, reaching an astonishing growth rate of up to 2.75 cm/day in length and more than 20 cm2/day of skin. Surprisingly, no study so far has assessed the metabolic rate of the antler. High metabolic rate needs highly efficient (or large) mitochondria, and it involves a high creation or reactive oxygen species (ROS), origin of oxidative stress. The speed of creation of ROS and the oxidative stress are inversely related to ageing and many diseases such as cancer or age-related diseases. However, antler must have the most efficient anti-oxidant system, as it rarely shows any departure from a perfect growth. This paper examines recent studies showing surprising applications in medicine of growing-antler extracts, or the information regarding its physiology. A recent study (Wang et al. (2019), Science 364, eaav6335) has shown that antlers have evolved a speed of growth faster than cancer, based on high expression of proto-oncogenes. As a result, deer has evolved tumour-suppression genes to control the high risk of developing cancer. This may explain why several studies have found in vitro and in vivo anti-cancer effects of deer velvet-antler extract in human tumours, such as cell cultures and animal models of cancers such as brain cancer (glioblastoma), prostate cancer, and others. We will also discuss findings in the study of the cyclic osteoporosis of the deer, with unexpected similarities in their proteomics and gene expression with that of the human pathological osteoporosis. Last, we will examine potential applications based on having the highest metabolic rate. If the future studies establish the antler as the tissue having the fastest metabolism and the best antioxidant system, this may have implications for understanding how to fight oxidative stress, which, in turn, will have direct implications for aging and age-related diseases (and others, from cancer to osteoporosis and Alzheimer’s for example). It may also show that velvet-antler extract is a general anti-cancer compound, and this may show the path to find an anti-cancer medicine that has no secondary toxic effects in healthy cells.

[EN] Antlers are unique structures because they grow rapidly and are cast annually, representing an important energetic and mineral cost for deer. Variables related to the timing of antler growth, such as date of antler casting and length of growth period, therefore, should be affected by somatic resources and availability of food. We examined the effects of body and antler weight, age, and climatic variables, on antler casting date and the period of time antlers were grown as well as possible random effects of individual, year, cohort, and pedigree, based on 244 antlers in a population of 109 males of Iberian red deer (Cervus elaphus) over a 17-year study from 1999 to 2016. Body weight affected casting date, with heavier males casting antlers earlier than lighter males. Antlers also grew faster and were cast earlier among older males than young males. Antler weight influenced casting date and the duration of the growth period: males with heavier antlers cast them earlier and grow them faster than males with light antlers. Nevertheless, age and antler weight interacted; as such, older males grew their antlers slower and delay casting date because they produce heavier antlers, in contrast to younger males, where those with the heaviest antlers grow them faster and cast first. The date of the end of antler growth also influenced casting date, so that antlers that took the longest to develop were cast later than those that finished growing early. We conclude that older and heavier males cast their antlers earlier and grow them faster than younger and lighter males, likely to correlate the subsequent antler growth with the spring peak in plant nutrients, but that this early development is limited physiologically by the size of the antlers., [ES] Las cuernas son estructuras únicas porque crecen rápidamente y desmogan cada año, representando así un coste importante para los ciervos. Por lo tanto, las variables relacionadas con la cronología de su crecimiento, tales como la fecha de desmogue o la duración del periodo de crecimiento, deberían verse afectadas por los recursos corporales del macho, así como por la cantidad de alimento disponible. Examinamos los efectos de la masa corporal y de las cuernas, la edad y las variables climáticas sobre la fecha de desmogue y la duración del crecimiento de las cuernas, así como los posibles efectos aleatorios del individuo, año, cohorte y pedigrí utilizando 244 cuernas en una población de 109 machos de ciervo ibérico (Cervus elaphus) a lo largo de 17 años de estudio desde 1999 hasta 2016. El peso corporal afectó a la fecha de desmogue, siendo los machos más pesados los que desmogan antes en relación a los más ligeros. Las cuernas también crecieron más rápido y fueron desmogadas antes entre los machos más viejos en comparación con los más jóvenes. El peso de la cuerna afectó a la fecha de desmogue y el periodo de crecimiento de la misma; machos con cuernas más pesadas desmogaron antes y las desarrollaron más rápido que machos con cuernas ligeras. En cualquier caso, la edad y peso de las cuernas interaccionaron y así, los machos de más edad ralentizan el crecimiento de las cuernas y retrasan la fecha de desmogue conforme desarrollan cuernas más pesadas, al contrario de los machos más jóvenes, los cuales desarrollan sus cuernas más rápido y desmogan antes cuanto más pesadas son las mismas. La fecha de final de crecimiento de las cuernas también afectó a la fecha de desmogue, de modo que los machos cuyas cuernas tardaron más tiempo en desarrollarse fueron los que más tarde desmogaron. Concluimos que los machos de más edad y más peso desmogan sus cuernas antes y las hacen crecer más rápido, posiblemente para correlacionar el crecimiento de la siguiente cuerna con el pico primaveral en nutrientes de las plantas, pero este desarrollo temprano está fisiológicamente limitado por el tamaño de la cuerna., Part of the original work by the authors of this study was supported by the Spanish Ministry of Economy (Ministerio de Economía, Industria y Competitividad) within the Estate Program of Research, Innovation, and Development oriented towards Challenges of Society, within the Framework Plan of Scientific, Technical Research, and Innovation 2013-2016 and co-funded by the European Union (reference number RTC-2016-5327-2). The study also was funded partly by project PIC of regional government of Castilla-La Mancha (Consejería de Educación, Cultura y Deportes, project ref. SBPLY/19/180501/000115).

This article belongs to the Special Issue New Insights into the Milk., This study describes chemical, physical, microbiological and technological characteristics of red deer milk and the effect of lactation on these parameters in order to know their potential aptitude to elaborate dairy products. During 18 weeks, milk from five hinds was monitored for composition, bacteriology, somatic cell count (SCC), physical properties and rennet coagulation. Mean values (g/100 g) for fat, protein, lactose and dry matter were 10.4, 7.1, 4.3 and 24.2, respectively, and for urea, 265 mg/100 mL. Except for lactose, a significant increase in these components was observed (p < 0.01) as lactation progressed. The average values for bacteriology and SCC were 5.3 log cfu/mL and 4.7 log cells/mL, respectively. Regarding physical properties, conductivity (mean: 2.8 ms/cm), viscosity (3.1 Cp), coordinates L* (89.9) and a* (−3.1) and milk fat globule diameter (D4,3: 6.1 µm) increased along with lactation while density (1.038 g/mL) decreased (p < 0.01). The pH (6.7), acidity (22.9° Dornic), coordinate b* (8.4) and ethanol stability (66.6% v/v) were stable during the study period. The stage of lactation also has a significant impact on milk coagulation properties and mean curd yield was 3.29 g/10 mL. These results suggest that red deer milk could be a potential innovative source of milk for the dairy industry., This work was supported by the Junta de Comunidades de Castilla-La Mancha and the European Union Fund for Regional Development (SBPLY/19/180501/000115 project and funds from the “Plan Propio” of the University of Castilla-La Mancha).

A recent study showed that antlers have evolved a high rate of growth due to the expression of proto-oncogenes and that they have also evolved to express several tumour suppressor genes to control the risk of cancer. This may explain why deer antler velvet (DAV) extract shows anti-tumour activity. The fast growth of antler innervation through the velvet in close association to blood vessels provides a unique environment to study the fast but non-cancerous proliferation of heterogeneous cell populations. We set out to study the anti-cancer effect of DAV in glioblastoma (GB) cell lines in comparison with temozolomide, a chemotherapeutic drug used to treat high-grade brain tumours. Here we report, for the first time, that DAV extract from the tip, but not from mid-parts of the antler, exhibits an anti-tumour effect in GB cell lines (T98G and A172) while being non-toxic in non-cancerous cell lines (HEK293 and HACAT). In T98G cells, DAV treatment showed reduced proliferation (37.5%) and colony-formation capacity (84%), inhibited migration (39%), induced changes in cell cycle progression, and promoted apoptosis. The anticancer activity of DAV extract as demonstrated by these results may provide a new therapeutic strategy for GB treatment., The authors are thankful to the Fundación del Hospital Nacional de Parapléjicos (Toledo, Spain) and the Spanish Ministry of Economy (Ministerio de Economía, Industria y Competitividad, Madrid, Spain) for financial support. L. C. is thankful to FNHP for the research fellowship (398764, 2018/6003). T. L. C., M. P., J. P., and A. G. are co-funded by the Estate program of Research, Innovation, and Development oriented towards Challenges of Society, by the European Union (reference number RTC-2016-5327-2) and by Counselling of Education, Culture, and Sports of Castilla-La Mancha [project no. SBPLY/19/180501/000115)].

The objective of European Union legislation on agriculture, livestock, and food production is to protect the human health. Several studies have shown the benefits of Mediterranean diet on human health. Some basic foods of the Mediterranean diet are produced in Spain. It is the case of bread (soft wheat), olive oil, Iberian cured products or wine, whose legislation is reviewed in the next chapter. It should be noted that, as an EU Member State, Spanish food legislation can be divided into community provisions, state provisions, and autonomic provisions.

This article belongs to the Section Proteomics., Antlers are the only organ in the mammalian body that regenerates each year. They can reach growth rates of 1–3 cm/day in length and create more than 20 cm2/day of skin in the antler tips (their growth centers). Previous proteomic studies regarding antlers have focused on antler growth centers (tips) compared to the standard bone to detect the proteins involved in tissue growth. However, proteins of cell differentiation and regeneration will be more accurately detected considering more growing tissues. Thus, we set out to compare proteins expressed in antler tips (the highest metabolism rate and cell differentiation) vs. middle sections (moderate cell growth involving bone calcification), using ribs as controls. Samples were obtained in mid-June with antlers’ phenology corresponding to the middle of their growth period. Quantitative proteomic analysis identified 259 differentially abundant proteins mainly associated with antioxidant metabolic mechanisms, protein formation and Wnt signalling pathway, meanwhile, the mid antler section was linked to blood proteins. The high metabolic rate and subsequent risk of oxidative stress also seem to have resulted in strong antioxidant mechanisms. These results suggest that redox regulation of proteins is a key factor in the model of deer antler regeneration., This research was funded by the project SBPLY/19/180501/000115 from Conserjería de Educación, Cultura, y Deportes de Castilla-La Mancha awarded to T.L.-C., F.J.P.-B.,was supported by Plan Estatal de Política Científica y Técnica y de Innovación CNU/692/2019. J.M.L. and D.F. belong to the competitive reference research group, FunMeat (Axencia Galega de Innovación, GAIN-IN607A2019/01) and they are members of the HealthyMeat network, funded by CYTED (Ref. 119RT0568).

Raveen Parboosing,1,2 Louis Chonco,1,2 Francisco Javier de la Mata,3,4 Thavendran Govender,5 Glenn EM Maguire,5 Hendrik G Kruger5 1Department of Virology, University of KwaZulu-Natal, 2National Health Laboratory Service, Durban, South Africa; 3Organic and Inorganic Chemistry Department, University of Alcalá, Alcalá de Henares, 4Networking Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Madrid, Spain; 5Catalysis and Peptide Research Unit, University of KwaZulu-Natal, Durban, South Africa Background: Encapsidation, the process during which the genomic RNA of HIV is packaged into viral particles, is an attractive target for antiviral therapy. This study explores a novel nanotechnology-based strategy to inhibit HIV encapsidation by an RNA decoy mechanism. The design of the 16-mer oligoribonucleotide (RNA) decoy is based on the sequence of stem loop 3 (SL3) of the HIV packaging signal (Ψ). Recognition of the packaging signal is essential to the encapsidation process. It is theorized that the decoy RNA, by mimicking the packaging signal, will disrupt HIV packaging if efficiently delivered into lymphocytes by complexation with a carbosilane dendrimer. The aim of the study is to measure the uptake, toxicity, and antiviral activity of the dendrimer–RNA nanocomplex. Materials and methods: A dendriplex was formed between cationic carbosilane dendrimers and the RNA decoy. Uptake of the fluorescein-labeled RNA into MT4 lymphocytes was determined by flow cytometry and confocal microscopy. The cytoprotective effect (50% effective concentration [EC50]) and the effect on HIV replication were determined in vitro by the methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay and viral load measurements, respectively. Results: Flow cytometry and confocal imaging demonstrated efficient transfection of lymphocytes. The dendriplex containing the Ψ decoy showed some activity (EC50 =3.20µM, selectivity index =8.4). However, there was no significant suppression of HIV viral load. Conclusion: Oligoribonucleotide decoys containing SL3 of the packaging sequence are efficiently delivered into lymphocytes by carbosilane dendrimers where they exhibit a modest cytoprotective effect against HIV infection. Keywords: packaging signal, dendrimers, transfection, antiretroviral, HIV packaging

Assessment of toxicity is an important component of the drug discovery process. Cellbased assays are a popular choice for assessing cytotoxicity. However, these assays are complex because of the wide variety of formats and methods that are available, lack of standardization, confusing terminology and the inherent variability of biological systems and measurement. This review is intended as a guide on how to take these factors into account when planning, conducting and/or interpreting cell based toxicity assays.

The chemokine (C-C motif) ligand 21 (CCL21) is a cytokine that attracts CCR7-positive cells to the T cell (paracortical) zone of lymph nodes by directional migration of these cells along the CCL21 gradient. In this article, we sought to mimic this chemotactic mechanism, by identifying a novel aptamer that binds CCL21 with high affinity. In vitro selection of DNA aptamers was performed by the Systematic Evolution of Ligands by Exponential Enrichment. Quantitative polymerase chain reaction (qPCR) and enzyme-linked oligonucleotide assay were used to screen for high-affinity aptamers against human and mouse CCL21 protein, respectively. Three such aptamers were identified. Surface plasmon resonance showed equilibrium dissociation constant (Kd) for these three aptamers in the nano to picomolar range. Cytotoxicity assays showed

Catalysis and Peptide Research Unit, School of Health Sciences, University of KwaZulu-Natal, Durban, South Africa; Antimicrobial Research Unit, School of Health Sciences, University of KwaZulu-Natal, Durban, South Africa; Biomedical Resource Unit, Westville Campus, University of KwaZulu-Natal, Durban, South Africa; Department of Virology, National Health Laboratory Service/University of KwaZulu-Natal, c/o Inkosi Albert Luthuli Central Hospital, Durban, South Africa; Science for Life Laboratory, Drug Discovery and Development Platform, and Division of Translational Medicine and Chemical Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institute, Stockholm, Sweden

Researchers have been working hard for more than 20 years to develop safe and effective microbicides to empower women to better control their own sexual life and to protect themselves against HIV and other sexually transmitted infections (STIs). Microbicide classes include moderately specific macromolecular anionic polymers that block HIV and other STIs, and HIV specific drugs that inhibit viral entry and reverse transcription. Based on innovative nanotechnology design, we showed a novel water-soluble anionic carbosilane dendrimer (2G-S16) as a propitious molecule against HIV-infection. A state-of-the-art research was accomplished that focused on biomedical cutting-edge techniques such as in vitro and in vivo cytotoxicity assays performed on female rabbit genital tracts, simulate in vitro model of vaginal epithelium in order to evaluate HIV transmission blockade through the monolayer, complete gene expression profiling experiment to study deregulated genes after 2G-S16 exposition, molecular dynamics simulation of 2G-S16 molecule against principal proteins of HIV particles and pro- and anti-inflammatory cytokine profile study. Therefore, a high-throughput study and detailed analysis of the results were achieved in this article. We provided promising outcomes to encourage 2G-S16 as a hopeful microbicide.

We developed a NOD-Scid IL2rγ(null) mouse model transplanted with human skin that brings fundamental insight on in vivo cellular mechanisms of intradermal immunization and antigen presentation by dermal dendritic and epidermal Langerhans cells for skin T-cell immunity. Indeed, T-cell immunity is a crucial checkpoint for the induction of in vivo rapid control of skin infection. With the long-term preservation of a complete human skin immune system, this model offers the unique opportunity not only to better understand mechanisms of skin immune response but also to test new compounds and devices for cutaneous routes of vaccination, as well as new therapeutics approach for skin diseases, allergies or infections.

The ability of dendrimer 2G-[Si{O(CH(2))(2)N(Me)(2) (+)(CH(2))(2)NMe(3) (+)(I(-))(2)}](8) (NN16) to transfect a wide range of cell types, as well as the possible biomedical application in direct or indirect inhibition of HIV replication, was investigated. Cells implicated in HIV infection such as primary peripheral blood mononuclear cells (PBMC) and immortalized suspension cells (lymphocytes), primary macrophages and dendritic cells, and immortalized adherent cells (astrocytes and trophoblasts) were analyzed. Dendrimer toxicity was evaluated by mitochondrial activity, cell membrane rupture, release of lactate dehydrogenase, erythrocyte hemolysis, and the effect on global gene expression profiles using whole-genome human microarrays. Cellular uptake of genetic material was determined using flow cytometry and confocal microscopy. Transfection efficiency and gene knockdown was investigated using dendrimer-delivered antisense oligonucleotides and small interfering RNA (siRNA). Very little cytotoxicity was detected in a variety of cells relevant to HIV infection and erythrocytes after NN16 dendrimer treatment. Imaging of cellular uptake showed high transfection efficiency of genetic material in all cells tested. Interestingly, NN16 further enhanced the reduction of HIV protein 24 antigen release by antisense oligonucleotides due to improved transfection efficiency. Finally, the dendrimer complexed with siRNA exhibited therapeutic potential by specifically inhibiting cyclooxygenase-2 gene expression in HIV-infected nervous system cells. NN16 dendrimers demonstrated the ability to transfect genetic material into a vast array of cells relevant to HIV pathology, combining high efficacy with low toxicity. These results suggest that NN16 dendrimers have the potential to be used as a versatile non-viral vector for gene therapy against HIV infection.

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.

A synthetic strategy has been developed for the preparation of new peripheral amine- or ammonium-terminated carbosilane dendrimers of type nG-[Si(OCH2CH2NMe2)y]x or nG-[Si(OCH2CH2NMe3+I–)y]x, respectively. It consists of the alcoholysis of well-known chlorosilane-terminated dendrimers with N,N-dimethylethanolamine and the subsequent quaternization with MeI. All these systems are susceptible to hydrolysis, although the decomposition depends on concentration and dendrimer generation. Evaluation of dendrimer toxicities by phase-contrast light microscopy and MTT assay were carried out, and evidence of dendrimer/oligonucleotide complex formation was carried out by gel electrophoresis. (© Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2006)

Corona discharges are commonly utilized for numerous practical applications, including bio-technological ones. The corona induced transfer of normally impermeant molecules into the interior of biological cells has recently been successfully demonstrated. The exact nature of the interaction of the corona discharge with a cell membrane is still unknown, however, previous studies have suggested that it is either the electric fields produced by ions or the chemical interaction of the reactive species that result in the disruption of the cell membrane. This disruption of the cell membrane allows molecules to permeate into the cell. Corona discharge current constitutes a series of pulses, and it is during these pulses that the ions and reactive species are produced. It stands to reason, therefore, that the nature of these corona pulses would have an influence on the level of cell permeabilization and cell destruction. In this investigation, an analysis of the width, rise-time, characteristic frequencies, magnitude, and repetition rate of the nanosecond pulses was carried out in order to establish the relationship between these factors and the levels of cell membrane permeabilization and cell destruction. Results obtained are presented and discussed.

Dendrimers have been proposed as new carriers for drug delivery. They have distinctive characteristics, such as uniform and controlled size, monodispersity and modifiable surface group functionality, which make them extremely useful for biomedical applications. In this study, the binding capacity of water-soluble carbosilane dendrimers was examined. A double fluorimetric titration method with 1-anilinonaphthalene-8-sulphonic acid (ANS) was used to estimate the binding constant and the number of binding centers per dendrimer molecule. The data obtained suggest that ANS interacts non-covalently with the dendrimers. Second generation dendrimers have an open, asymmetric structure that allows them to encapsulate ANS. The ability of the polymers to interact with DNA was assessed by an ethidium bromide (EB) displacement assay. All the dendrimers studied bound to DNA in competition with EB, though the strength of binding varied. Dendrimer interactions with a protein (BSA) were tested using fluorescence quenchers. The dendrimers caused no conformation change in the protein, indicating that interactions between carbosilane dendrimers and BSA are weak and occur preferentially at the protein surface.

8 pages, 10 figures.-- PMID: 17551637 [PubMed].-- Printed version published Jun 21, 2007., Treatment of dendriplexes formed between water-soluble carbosilane dendrimers and phosphorothioate oligodeoxynucleotides (ODN) with the anionic detergent sodium dodecyl sulfate disrupted the complexes indicating that the nature of the union in such dendriplexes is merely electrostatic. However, dendriplexes were not dissociated by serum proteins like bovine or human serum albumins, as assessed by gel electrophoresis and fluorescence experiments. This would imply a dendrimer-mediated protective effect able to prevent ODN interactions with serum proteins and additionally could translate into a reduction of the ODN doses needed to achieve the biological effects. The employment of carbosilane dendrimers as carriers may solve the problem of ODN kidnapping by plasmatic proteins as a key drawback for therapeutics involving ODNs. As examples, transfection processes on normal primary peripheral blood cells and diagnosis of HIV infection in the presence of serum have been assayed., We thank the Ministerio de Ciencia y Tecnología (project CTQ2005-00795/BQU), the Plan Nacional de Salud (grant SAF- 2004-06778, SAF-2003-09209), Red temática de Investigación Cooperativa Sanitaria ISCIII(REDRISRD06/0006),Fundación Caja Navarra, FIPSE (36514/05), the Dirección General de Investigación Científica y T´ecnica (grant BQU2004-02048), and Fundació LA CAIXA (BM04-52-0) for financial support. J. F. B.-M. is supported by a grant of Fondos de Investigación Sanitaria (CD05/00153). Dr Dzmitry Shcharbin is a beneficiary of a Marie Curie International Incoming Fellowship within the 6th EU Framework Programme (grant 510018).

Novel amine- or ammonium-terminated carbosilane dendrimers of type nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe2)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe2}]x and nG-[Si{(CH2)3NH2}]x or nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe3 +I-)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe3 +I-}]x, and nG-[Si{(CH2)3NH3 +Cl-}]x have been synthesized and characterized up to the third generation by two strategies: 1) alcoholysis of Si--Cl bonds with amino alcohols and subsequent quaternization with MeI, and 2) hydrosilylation of allylamine with Si--H bonds of the dendritic systems and subsequent quaternization with HCl. Quaternized carbosilane dendrimers are soluble in water, although degradation is apparent due to hydrolysis of Si--O bonds. However, dendrimers containing Si--C bonds are water-stable. The biocompatibility of the second-generation dendrimers in primary cell cultures of peripheral blood mononuclear cells (PBMCs) and erythrocytes have been analyzed, and they show good toxicity profiles over extended periods. In addition, we describe a study on the interactions between the different carbosilane dendrimers and DNA oligodeoxynucleotides (ODNs) and plasmids along with a comparative analysis of their toxicity. They can form complexes with DNA ODNs and plasmids at biocompatible doses via electrostatic interaction. Also a preliminary transfection assay has been accomplished. These results demonstrate that the new ammonium-terminated carbosilane dendrimers are good base molecules to be considered for biomedical applications.

Anionic carbosilane dendrimers of generations 1-3 have been synthesized containing carboxylate G(n)X(C(2)H(4)CO(2)Na)(m) and sulfonate G(n)X(C(2)H(4)SO(3)Na)(m) peripheral groups and derived from two different cores, 1,3,5-(HO)(3)C(6)H(3) (X = O(3)) and Si(C(3)H(5))(4) (X = Si). The peripheral anionic groups make these dendrimers water soluble, despite their highly hydrophobic framework. These dendrimers present a net negative charge in water, which was influenced by the pH of the medium. This characteristic was studied by pH titration. Also molecular modeling calculations have been performed to study differences in an aqueous medium between carboxylate and sulfonate dendrimers of different cores. The results obtained were also compared with those obtained from DOSY NMR experiments and zeta-potential measurements.