Search

Fungal genus

Human activity impacts the evolutionary trajectories of many species worldwide. Global trade of agricultural goods contributes to the dispersal of pathogens reshaping their genetic makeup and providing opportunities for virulence gains. Understanding how pathogens surmount control strategies and cope with new climates is crucial to predicting the future impact of crop pathogens. Here, we address this by assembling a global thousand-genome panel of Zymoseptoria tritici, a major fungal pathogen of wheat reported in all production areas worldwide. We identify the global invasion routes and ongoing genetic exchange of the pathogen among wheat-growing regions. We find that the global expansion was accompanied by increased activity of transposable elements and weakened genomic defenses. Finally, we find significant standing variation for adaptation to new climates encountered during the global spread. Our work shows how large population genomic panels enable deep insights into the evolutionary trajectory of a major crop pathogen.

OPEN ACCESS; International audience; Introduction: Septoria nodorum blotch (SNB) is a complex fungal disease of wheat caused by the Dothideomycete fungal pathogen Parastagonospora nodorum. The fungus infects through the use of necrotrophic effectors (NEs) that cause necrosis on hosts carrying matching dominant susceptibility genes. The Western Australia (WA) wheatbelt is a SNB “hot spot” and experiences significant under favorable conditions. Consequently, SNB has been a major target for breeders in WA for many years.Materials and Methods: In this study, we assembled a panel of 155 WA P. nodorum isolates collected over a 44-year period and compared them to 23 isolates from France and the USA using 28 SSR loci.Results: The WA P. nodorum population was clustered into five groups with contrasting properties. 80% of the studied isolates were assigned to two core groups found throughout the collection location and time. The other three non-core groups that encompassed transient and emergent populations were found in restricted locations and time. Changes in group genotypes occurred during periods that coincided with the mass adoption of a single or a small group of widely planted wheat cultivars. When introduced, these cultivars had high scores for SNB resistance. However, the field resistance of these new cultivars often declined over subsequent seasons prompting their replacement with new, more resistant varieties. Pathogenicity assays showed that newly emerged isolates non-core are more pathogenic than old isolates. It is likely that the non-core groups were repeatedly selected for increased virulence on the contemporary popular cultivars.Discussion: The low level of genetic diversity within the non-core groups, difference in virulence, low abundance, and restriction to limited locations suggest that these populations more vulnerable to a population crash when the cultivar was replaced by one that was genetically different and more resistant. We characterize the observed pattern as a low-amplitude boom-and-bust cycle in contrast with the classical high amplitude boom-and-bust cycles seen for biotrophic pathogens where the contrast between resistance and susceptibility is typically much greater. Implications of the results are discussed relating to breeding strategies for more sustainable SNB resistance and more generally for pathogens with NEs.

National audience

One of the main goal in phytopathology is to better understand the molecular basis of plant–pathogen co-evolution through the identification of effectors and effector targets that play a role in natural phenotypic variation. Fortunately, next generation sequencing (NGS)—which can measure genetic variation at hundreds of thousands of markers across a genome, including for non-model organisms—is now helping to reach this goal. Among all possible strategies using NGS data, we expect that genome-wide association studies (GWAS) have the most potential to revolutionize the field of phytopathology. In contrast to QTL mapping, GWAS use outbred populations to capture the standing genetic variation, thus characterizing the raw material for evolution. By examining the natural phenotypic and genetic variation, association mapping can elucidate the genetic basis underlying complex traits. In the two decades since association mapping successfully detected common variants for human complex diseases (Risch and Merikangas, 1996) and with the publication of the first successful GWAS in humans in 2005 (Klein et al., 2005), the number of published GWAS keeps increasing. Researchers in the field of plant pathogens are now embarking on GWAS, with the promise to open new frontiers of research.

The race structure and genotypic diversity of four Leptosphaeria maculans populations isolated from Brassica oleracea (broccoli, cauliflower, cabbage, etc.) in central Mexico (Aguascalientes, Guanajuato and Zacatecas states) were analysed. Race structure was characterized by an unusually low diversity at three locations out of four. Fourteen minisatellite markers revealed a high proportion of repeated multilocus genotypes in these populations, combined with a significant linkage disequilibrium and strong clonal fraction (65‐87%). The occurrence of the mating-type idiomorphs always significantly departed from the 1:1 proportion expected in the case of random mating. Each population thus consists of a few (four to nine) multilocus genotypes which are specific to each location. These data strongly support the hypothesis of exclusive, or a high rate of, clonal multiplication. Comparison of cropping practices between B. oleracea and B. napus indicate that the shift in reproductive behaviour of the fungus is chiefly man-mediated.

Pathogen introductions into novel areas can lead to the emergence of new fungal diseases of plants. Understanding the origin, introduction pathways, possible changes in reproductive system and population size of fungal pathogens is essential in devising an integrated strategy for the control of these diseases. We used minisatellite markers to infer the worldwide invasion history of the fungal plant pathogen Leptosphaeria maculans, which causes stem canker (blackleg) of oilseed and vegetable brassicas. Clustering analyses partitioned genotypes into distinct populations corresponding to major geographic regions, along with two differentiated populations in Western Canada. Comparison of invasion scenarios using Approximate Bayesian Computation suggested an origin of the pathogen in the USA, the region where epidemics were first recorded, and independent introductions from there over the last few decades into Eastern Canada (Ontario), Europe and Australia. The population in Western Canada appeared to be founded from a source in Ontario and the population in Chile resulted from an admixture between multiple sources. A bottleneck was inferred for the introduction into Western Canada but not into Europe, Ontario or Australia. Clonality appeared high in Western Canada, possibly because environmental conditions there were less conducive to sexual reproduction. Leptosphaeria maculans is a model invasive pathogen with contrasting features in different regions: shallow population structure, high genetic variability and regular sexual recombination in some regions, by comparison with reduced genetic variability, high rates of asexual multiplication, strong population structure or admixture in others.

International audience; Stem canker of oilseed rape (canola, Brassica napus) is associated with a species complex of two closely related fungal species, Leptosphaeria maculans and L. biglobosa. Of these, L. maculans is the most damaging and develops gene-for-gene relationships with the host. Here, a wide scale analysis of the L. maculans - L. biglobosa species complex was performed throughout the American continent (23 locations from Chile to Canada) plus several locations inWestern Australia for comparison purposes, based on a collection of 1132 isolates from infected tissues of a susceptible cultivar. Fungal species were discriminated on the basis of morphological, phytopathological and molecular criteria and showed that L. biglobosa was closely associated with L. maculans in most of the locations. Multiple gene phylogeny using sequences of ITS, actin and b-tubulin confirmed the prevalence of the L. biglobosa ‘canadensis’ sub-clade in Canada, whereas up to three different sub-clades of L. biglobosa were found in Georgia (USA). Race structure of L. maculans was investigated using a combination of pathogenicity tests and PCR amplification of avirulence alleles AvrLm1, AvrLm4 and AvrLm6. Three contrasting situations were observed: (i) race structure in Ontario, Chile and Georgia was related to that of European and Western Australian populations, with a low race diversity; (ii) only one race was found in Mexico, and not found outside of this country; (iii) a large diversity of races was observed in central Canada (Manitoba, Alberta and Saskatchewan) with very specific features including maintenance of avirulence alleles absent from Europe, absence of the AvrLm7 allele common in Europe (or eastern Canada) and wide location-to-location variability.

International audience; Blackleg disease (phoma stem canker) of Brassica napus (canola, oilseed rape) is caused by the fungus Leptosphaeria maculans. In some regions of Australia, resistance in oilseed rape cultivars derived from B. rapa subs. sylvestris (e.g. cv. Surpass 400) became ineffective within three years of commercial release. The genetic control of avirulence in L. maculans towards cv. Surpass 400 is described. When Australian field isolates were screened on this cultivar, three phenotypic classes were observed; virulent, intermediate and avirulent. Analysis of crosses between fungal isolates varying in their ability to infect cv. Surpass 400 demonstrated the presence of two unlinked avirulence genes, AvrLm1 and AvrLmS. Complementation of isolates (genotype avrLm1) with a functional copy of AvrLm1, and genotyping of field isolates using a molecular marker for AvrLm1 showed that virulence towards Rlm1 is necessary, but not sufficient, for expression of a virulent phenotype on cv. Surpass 400. Taken together, these data strongly suggest that cv. Surpass 400, with ‘sylvestris-derived’ resistance, contains at least two resistance genes, one of which is Rlm1.

International audience; Leptosphaeria maculans, a dothideomycete fungus causing stem canker on oilseed rape, develops gene-for-gene interactions with its host plants. It has the ability to rapidly adapt to selection pressure exerted by cultivars harbouring novel resistance genes as exemplified recently by the 3-year evolution towards virulence at the AvrLm1 locus in French populations. The AvrLm1 avirulence gene was recently cloned and shown to be a solo gene within a 269 kb non-coding, heterochromatin-like region. Here we describe the sequencing of the AvrLm1 genomic region in one avirulent and two virulent isolates to investigate the molecular basis of evolution towards virulence at the AvrLm1 locus. For these virulent isolates, the gain of virulence was linked to a 260 kb deletion of a chromosomal segment spanning AvrLm1 and deletion breakpoints were identical or similar. Among the 460 isolates analysed from France, Australia and Mexico, a similar large deletion was apparent in > 90% of the virulent isolates. Deletion breakpoints were also strongly conserved in most of the virulent isolates, which led to the hypothesis that a unique deletion event leading to the avrLm1 virulence has diffused in pathogen populations. These data finally suggest that retrotransposons are key drivers in genome evolution and adaptation to novel selection pressure in L. maculans.

The dothideomycete fungus, Leptosphaeria maculans, is poorly described at the genomic level. Two genomic regions have been analysed - one (55 kb) comprises a cluster of 18 genes encoding the biosynthetic enymes for a phytotoxin, sirodesmin, whilst the other (184 kb) is the pericentromeric region of a 2.80 Megabase chromosome. Transcription of all genes in the sirodesmin gene cluster is co-regulated with the production of sirodesmin in culture. Disruption of one of these genes (encoding a two-module non-ribosomal peptide synthetase) is essential for production of sirodesmin. The 184 kb sequence contains 6.980 kb repetitive element named Pholy bordered by two Long Terminal Repeats (LTRs), five Pholy-related sequences, mostly truncated at their 3′ ends; and five solo-LTRs. This element, Pholy, comprises a previously described element, LMR1. Structural features suggest that Pholy corresponds to an ancient copia-like retrotransposon, as it has high sequence similarity to the ELSA retrotransposon of the closely related fungus, Stagonospora nodorum. Comparative analysis of the structure of the Pholy-like sequences in the 184 kb contig and in other parts of the genome suggests that this family of repetitive elements has undergone extensive Repeat Induced Point (RIP) mutation.

Summary Leptosphaeria maculans, a Dothideomycete causing stem canker on oilseed rape (Brassica napus), develops gene-for-gene interactions with its host plants. To date, nine resistance genes (Rlm1–9) have been identified in Brassica spp. The corresponding nine avirulence genes (AvrLm1–9) in L. maculans have been mapped at four independent loci, thereby revealing two clusters of three and four linked avirulence genes. Here, we report the completion of map-based cloning of AvrLm1. AvrLm1 was genetically delineated within a 7.3 centimorgan interval corresponding to a 439 kb BAC contig. AvrLm1 is a single copy gene isolated within a 269 kb non-coding, heterochromatin-like region. The region comprised a number of degenerated, nested copies of four long-terminal repeat (LTR) retrotransposons, including Pholy and three novel Gypsy-like retrotransposons. AvrLm1 restored the avirulent phenotype on Rlm1 cultivars following functional complementation of virulent isolates. AvrLm1 homologues were not detected in other Leptosphaeria species or in known fungal genomes including the closely related species Stagonospora nodorum. The predicted AvrLm1 protein is composed of 205 amino acids, of which only one is a cysteine residue. It contains a peptide signal suggesting extracellular localization. Unlike most other fungal avirulence genes, AvrLm1 is constitutively expressed, with a probable increased level of expression upon plant infection, suggesting the absence of tight regulation of AvrLm1 expression.

Leptosphaeria maculans is the most ubiquitous fungal pathogen of Brassica crops and causes the devastating stem canker disease of oilseed rape worldwide. We used minisatellite markers to determine the genetic structure of L. maculans in four field populations from France. Isolates were collected at three different spatial scales (leaf, 2-m 2 field plot, and field) enabling the evaluation of spatial distribution of the mating type alleles and of genetic variability within and among field populations. Within each field population, no gametic disequilibrium between the minisatellite loci was detected and the mating type alleles were present at equal frequencies. Both sexual and asexual reproduction occur in the field, but the genetic structure of these populations is consistent with annual cycles of randomly mating sexual reproduction. All L. maculans field populations had a high level of gene diversity ( H = 0.68 to 0.75) and genotypic diversity. Within each field population, the number of genotypes often was very close to the number of isolates. Analysis of molecular variance indicated that >99.5% of the total genetic variability was distributed at a small spatial scale, i.e., within 2-m 2 field plots. Population differentiation among the four field populations was low ( G ST < 0.02), suggesting a high degree of gene exchange between these populations. The high gene flow evidenced here in French populations of L. maculans suggests a rapid countrywide diffusion of novel virulence alleles whenever novel resistance sources are used.

Leptosphaeria maculans, the causal agent of stem canker of oilseed rape, develops gene-for-gene interactions with its hosts. To date, eight L. maculans avirulence (Avr) genes, AvrLm1 to AvrLm8, have been genetically characterized. An additional Avr gene, AvrLm9, that interacts with the resistance gene Rlm9, was genetically characterized here following in vitro crosses of the pathogen. A worldwide collection of 63 isolates, including the International Blackleg of Crucifers Network collection, was genotyped at these nine Avr loci. In a first step, isolates were classified into pathogenicity groups (PGs) using two published differential sets. This analysis revealed geographical disparities as regards the proportion of each PG. Genotyping of isolates at all Avr loci confirmed the disparities between continents, in terms of Avr allele frequencies, particularly for AvrLm2, AvrLm3, AvrLm7, AvrLm8, and AvrLm9, or in terms of race structure, diversity, and complexity. Twenty-six distinct races were identified in the collection. A larger number of races (n = 18) was found in Australia than in Europe (n = 8). Mean number of virulence alleles per isolate was also higher in Australia (5.11 virulence alleles) than in Europe (4.33) and Canada (3.46). Due to the diversity of populations of L. maculans evidenced here at the race level, a new, open terminology is proposed for L. maculans race designation, indicating all Avr loci for which the isolate is avirulent.

The LMR1 5.2 kb interspersed repeat of Leptosphaeria maculans was described by Taylor and Borgmann [Mol. Plant Microbe Interact. 7 (1994) 181] as an uncharacterized repeated element sharing homologies with both LINEs and SINEs. Here, we used the LMR1 sequence as a template to identify the full-length element within a 184-kb genomic sequence corresponding to the pericentromeric region of the 2.80 Mb chromosome of isolate v23.1.3. This region comprises (i) one 6980-bp full-sized Pholy element bordered by two 275- to 280-bp long terminal repeats (LTRs), (ii) five Pholy-related sequences, usually truncated at their 3′ ends, and (iii) five solo-LTRs. Structural features strongly suggested that Pholy corresponds to an ancient copia-like retrotransposon, sharing strong homologies with the Elsa retrotransposon of Stagonospora nodorum. Pholy was also suggested to be specific to pericentromeric regions. Comparative analysis of the structure of the Pholy-like sequences occurring in the 184-kb contig and in other parts of the genome showed that this family of repeats is highly degenerated following extensive repeat induced point mutation (RIP).

Leptosphaeria maculans, the cause of stem canker of oilseed rape (OSR), exhibits gene-for-gene interactions with its host plant. The race structure of L. maculans was assessed on the basis of the analysis of 1011 isolates collected in France between 1990 and 2000, with regards to three AVR genes, AvrLm1, AvrLm2 and AvrLm4. The effect of selection pressure, due to large-scale cropping of Rlm1 cultivars, on the evolution of races of the fungus was also evaluated. The results revealed a scarcity or complete absence of isolates harbouring AvrLm2, whereas isolates harbouring AvrLm4 were present at a variable level, that was as high as 17.2–31.2% depending on the sample year and location. When obtained from rlm1 cultivars, isolates harbouring AvrLm1 always represented more than 83% of the populations until the 1997–1998 growing season. As a consequence, the Rlm1 cultivars had been highly efficient at controlling the disease and were grown on an estimated 43.7% of the total French acreage in OSR in 1998–1999. However, the increased commercial success of Rlm1 cultivars was paralleled by a decrease in the proportion of isolates harbouring AvrLm1 in 1997–1998 and 1998–1999. This resulted in less than 13% of isolates harbouring AvrLm1 in populations being collected from rlm1 cultivars in 1999 and 2000, and contributed to the loss of efficiency of the Rlm1 resistance in the field. The present study is an illustration of one round of a `boom and bust' cycle that occurred for a pathosystem where it has never been reported before. These data and the high evolutionary potential of L. maculans are fully supportive of one pathogen species with a high risk of breaking down resistance genes in OSR and suggest that the development of integrated strategies aiming at maximising the durability of novel resistance is now a priority for this pathosystem.

Map-based cloning of the avirulence gene AvrLm1 of Leptosphaeria maculans was initiated utilizing a genetic map of the fungus and a BAC library constructed from an AvrLm1 isolate. Seven polymorphic DNA markers closely linked to AvrLm1 were identified. Of these, two were shown to border the locus on its 5′ end and were present, with size polymorphism, in both the virulent and the avirulent isolates. In contrast, three markers, J19-1.1, J53-1.3 (in coupling phase with avirulence), and Vir1 (in repulsion phase with avirulence), cosegregated with AvrLm1 in 312 progeny from five in vitro crosses. J19-1.1 and J53-1.3 were never amplified in the virulent parents or progeny, whereas Vir1 was never amplified in the avirulent parents or progeny. J19-1.1 and J53-1.3 were shown to be separated by 40 kb within a 184-kb BAC contig. In addition, the 1.6-cM genetic distance between J53-1.3 and the nearest recombinant marker corresponded to a 121-kb physical distance. When analyzing a European Union-wide collection of 192 isolates, J53-1.3, J19-1.1, and Vir1 were found to be closely associated with the AvrLm1 locus. The results of polymerase chain reaction amplification with primers for the three markers were in accordance with the interaction phenotype for 92.2% (J53-1.3), 90.6% (J19-1.1), and 88.0% (Vir1) of the isolates. In addition, genome organization of the AvrLm1 region was highly conserved in field isolates, because 89.1% of the avirulent isolates and 79.0% of the virulent isolates showed the same association of markers as that of the parents of in vitro crosses. The large-scale analysis of field isolates with markers originating from the genetic map therefore confirms (i) the physical proximity between the markers and the target locus and (ii) that AvrLm1 is located in (or close to) a recombination-deficient genome region. As a consequence, map-based markers provided us with high-quality markers for an overview of the occurrence of race “AvrLm1” at the field scale. These data were used to propose hypotheses on evolution towards virulence in field isolates.

Les composantes (Tox+ et Tox0) du complexe implique dans la necrose du collet du colza ont ete suivies au cours du temps et dans la plante, a l’aide d’outils moleculaires (ITS, ISSR), afin de clarifier leurs roles respectifs dans les degâts de necrose, de preciser les relations entre les symptomes foliaires precoces et les necroses du collet tardives et d’evaluer l’etendue de la colonisation de la plante, en conditions naturelles, pendant deux cycles culturaux successifs. Les deux composantes, presentes en permanence, varient en proportion selon la periode de culture et l’organe consideres. La composante Tox+, qui predomine aux deux extremes du cycle cultural, sur feuille en automne et au collet en fin de vegetation, est responsable des degâts de necrose. L’analyse topographique de la region du collet indique que tous les tissus, fortement colonises par de nombreuses souches Tox+ distinctes, constituent un site privilegie de confrontation entre souches differentes, favorable a la reproduction sexuee du champignon.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

Modern agriculture favours the selection and spread of novel plant diseases. Furthermore, crop genetic resistance against pathogens is often rendered ineffective within a few years of its commercial deployment. Leptosphaeria maculans, the cause of phoma stem canker of oilseed rape, develops gene-for-gene interactions with its host plant, and has a high evolutionary potential to render ineffective novel sources of resistance in crops. Here, we established a four-year field experiment to monitor the evolution of populations confronted with the newly released Rlm7 resistance and to investigate the nature of the mutations responsible for virulence against Rlm7. A total of 2551 fungal isolates were collected from experimental crops of a Rlm7 cultivar or a cultivar without Rlm7. All isolates were phenotyped for virulence and a subset was genotyped with neutral genetic markers. Virulent isolates were investigated for molecular events at the AvrLm4-7 locus. Whilst virulent isolates were not found in neighbouring crops, their frequency had reached 36% in the experimental field after four years. An extreme diversity of independent molecular events leading to virulence was identified in populations, with large-scale Repeat Induced Point mutations or complete deletion of AvrLm4-7 being the most frequent. Our data suggest that increased mutability of fungal genes involved in the interactions with plants is directly related to their genomic environment and reproductive system. Thus, rapid allelic diversification of avirulence genes can be generated in L. maculans populations in a single field provided that large population sizes and sexual reproduction are favoured by agricultural practices., Author Summary Plant disease resistance often relies on simple “gene-for-gene” systems and, in the pathogen, a mutation in a single “avirulence” gene matching the plant resistance gene is sufficient to render the resistance ineffective. In agricultural systems, breeding for resistance is challenged by both the high evolutionary potential of the pathogen and the large scale of crop production; together, these factors encourage “breakdown” of novel sources of resistance soon after their deployment. Here, we established a four-year field experiment to evaluate the mechanisms and speed with which a fungal pathogen of oilseed rape, Leptosphaeria maculans renders ineffective the novel resistance gene Rlm7. The pathogen showed a very high evolutionary potential; the proportion of isolates in the population that were virulent against Rlm7 increased from 0 to 36% in four years. The experiment demonstrated that an extremely diverse range of molecular events leading to virulence, from more or less extensive nucleotide mutations or deletions to complete gene deletion, can occur in a single field. These results suggest that the genomic environment of the avirulence gene and the reproductive regime of the pathogen promote mutability at a single locus to produce virulence. Cropping practices that promote large pathogen populations and encourage sexual reproduction therefore favour rapid adaptation of the pathogen to the novel resistance.

The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions.

Sclerotinia sclerotiorum and Botrytis cinerea are closely related necrotrophic plant pathogenic fungi notable for their wide host ranges and environmental persistence. These attributes have made these species models for understanding the complexity of necrotrophic, broad host-range pathogenicity. Despite their similarities, the two species differ in mating behaviour and the ability to produce asexual spores. We have sequenced the genomes of one strain of S. sclerotiorum and two strains of B. cinerea. The comparative analysis of these genomes relative to one another and to other sequenced fungal genomes is provided here. Their 38–39 Mb genomes include 11,860–14,270 predicted genes, which share 83% amino acid identity on average between the two species. We have mapped the S. sclerotiorum assembly to 16 chromosomes and found large-scale co-linearity with the B. cinerea genomes. Seven percent of the S. sclerotiorum genome comprises transposable elements compared to, Author Summary Sclerotinia sclerotiorum and Botrytis cinerea are notorious plant pathogenic fungi with very wide host ranges. They cause vast economic damage during crop cultivation as well as in harvested produce. These fungi are typical examples of necrotrophs: they first kill host plant cells and then colonize the dead tissue. The genome sequences of the two fungi were determined in order to examine commonalities in structure and content and in order to find unique features that may distinguish them from other pathogenic fungi and from saprotrophic fungi. The genomes show high sequence identity and a similar arrangement of genes. S. sclerotiorum and B. cinerea differ in their regulation of sexual reproduction, and the genetic basis and its evolution could be explained from the genome sequence. The genome sequence revealed a striking difference in the number and diversity of secondary metabolism gene clusters, which may be involved in the adaptation to different ecological niches. Altogether, there were no unique features in the genomes of S. sclerotiorum and B. cinerea that could be identified as “silver bullets,” which distinguish these aggressive pathogens from other pathogenic and non-pathogenic fungi. These findings reinforce the quantitative, multigenic nature of necrotrophic pathogenesis.

Fungi are of primary ecological, biotechnological and economic importance. Many fundamental biological processes that are shared by animals and fungi are studied in fungi due to their experimental tractability. Many fungi are pathogens or mutualists and are model systems to analyse effector genes and their mechanisms of diversification. In this study, we report the genome sequence of the phytopathogenic ascomycete Leptosphaeria maculans and characterize its repertoire of protein effectors. The L. maculans genome has an unusual bipartite structure with alternating distinct guanine and cytosine-equilibrated and adenine and thymine (AT)-rich blocks of homogenous nucleotide composition. The AT-rich blocks comprise one-third of the genome and contain effector genes and families of transposable elements, both of which are affected by repeat-induced point mutation, a fungal-specific genome defence mechanism. This genomic environment for effectors promotes rapid sequence diversification and underpins the evolutionary potential of the fungus to adapt rapidly to novel host-derived constraints., Leptosphaeria maculans is a plant pathogen that causes stem canker of oilseed rape. Rouxel et al. sequence and describe the key features of the L. maculans genome, including partitioning into AT-rich blocks that are enriched in effector genes and transposable elements affected by repeat-induced point mutation.

International audience; Stem canker of crucifers is caused by an ascomycete species complex comprising of two main species, Leptosphaeria maculans and L. biglobosa. These are composed of at least seven distinct subclades based on biochemical data or on sequences of internal transcribed spacer (ITS), the mating type MAT1-2 or fragments of actin or β-tubulin genes. In the course of a wide-scale characterization of the race structure of L. maculans from Western Australia, a few isolates from two locations failed to amplify specific sequences of L. maculans, i.e., the mating-type or minisatellite alleles. Based on both pathogenicity tests and ITS size, these isolates were classified as belonging to the L. biglobosa species. Parsimony and distance analyses performed on ITS, actin and β-tubulin sequences revealed that these isolates formed a new L. biglobosa subclade, more related to the Canadian L. biglobosa ‘canadensis’ subclade than to the L. biglobosa ‘australensis’ isolates previously described in Australia (Victoria). They are termed here as L. biglobosa ‘occiaustralensis’. These isolates were mainly recovered from resistant oilseed rape cultivars that included the Brassica rapa sp. sylvestris-derived resistance source, but not from the susceptible cv. Westar. The pathogenicity of L. biglobosa ‘occiaustralensis’ to cotyledons of most oilseed rape genotypes was higher than that of L. biglobosa ‘canadensis’ or L. biglobosa ‘australensis’ isolates.

Map-based cloning of avirulence genes of the AvrLm1-2-6 cluster was recently undertaken in Leptosphaeria maculans and led to the identification of AvrLm1. The ensuing chromosome walk toward AvrLm6 resulted in the delineation of a 562-kb bacterial artificial chromosome (BAC) clone contig in an avirulent isolate. Following sequencing of the contig and sequence comparison with a virulent isolate, four AvrLm6 candidate genes were identified. Complementation of the virulent isolate with the four candidates was performed and one gene was found to fully restore the avirulent phenotype on Rlm6 oilseed rape genotypes. AvrLm6 was found to be located in the same genome context as AvrLm1, because it is a solo gene surrounded by 85 and 48 kb of degenerated repeats on its 5′ and 3′ sides, respectively. AvrLm6 is an orphan gene encoding a small, potentially secreted, cysteine-rich protein. Comparison of AvrLm1 and AvrLm6 expressions by quantitative reverse-transcription polymerase chain reaction revealed that both genes are highly overexpressed during primary leaf infection. Using RNA interference, decreasing expression of AvrLm6 was shown to result in virulence toward Rlm6 genotypes whenever the expression was reduced by more than 60% compared with the wild-type isolate.

Leptosphaeria maculans is a haploid outcrossing ascomycete with a genome size of about 34 Megabases (Mb) which is predicted to have between 10,000 and 12,000 genes. The chromosomes of L. maculans are of a size range (0.7–3.5 Mb) and number (15–16) that can be readily resolved by pulsed field gel electrophoresis. Chromosome length polymorphisms are generated by meiosis giving rise to size differences as high as 57%, in the case of the ribosomal DNA-harbouring chromosome whose size varies between 1.8 and 4.2 Mb. Genetic maps are characterised by linkage groups comprising an accumulation of markers based on retrotransposon sequences. This, along with sequencing of pericentromeric regions and stretches of ORF-rich regions, suggest that the genome of L. maculans consists of a mosaic of GC-equilibrated coding regions with no or few transposons, and of stretches of highly degenerated and truncated retrotransposons, encompassing very few genes. Chromosome length polymorphisms are linked with the loss of dispensable regions. We suggest that the degree of length polymorphism for a particular chromosome correlates to the amount of dispensable retrotransposons, and that some gene-rich chromosomes may be less prone to undergo chromosome length polymorphisms than other chromosomes.

Leptosphaeria maculans causes phoma stem canker, the most serious disease of oilseed rape world-wide. Sexual recombination is important in the pathogen life cycle and increases the risk of plant resistance genes being overcome rapidly. Thus, there is a need to develop easy-to-use molecular markers suitable for large-scale population genetic studies. The minisatellite MinLm1, showing six alleles in natural populations, has previously been used as a marker to survey populations. Here, we report the characterization of five new minisatellites (MinLm2–MinLm6), of which four were identified by a systematic search for tandemly repeated polymorphic regions in BAC-end sequencing data from L. maculans. Of 782 BAC-end sequences analysed, 43 possessed putative minisatellite-type repeats and four of these (MinLm3–MinLm6) displayed both consistent PCR amplification and size polymorphism in a collection of L. maculans isolates of diverse origins. Cloning and sequencing of each allele confirmed that polymorphism was due to variation in the repeat number of a core motif ranging from 11 bp (MinLm3) to 51 bp (MinLm4). The number of alleles found for each minisatellite ranged from three (MinLm4) to nine (MinLm2), with eight, five and six for MinLm3, MinLm5 and MinLm6, respectively. MinLm2–MinLm6 are all single locus markers specific to L. maculans and share some common features, such as conservation of core motifs and incomplete direct repeats in the flanking regions. To our knowledge, L. maculans is the first fungal species for which six polymorphic single locus minisatellite markers have been reported.

The LMR1 5.2 kb interspersed repeat of Leptosphaeria maculans was described by Taylor and Borgmann [Mol. Plant Microbe Interact. 7 (1994) 181] as an uncharacterized repeated element sharing homologies with both LINEs and SINEs. Here, we used the LMR1 sequence as a template to identify the full-length element within a 184-kb genomic sequence corresponding to the pericentromeric region of the 2.80 Mb chromosome of isolate v23.1.3. This region comprises (i) one 6980-bp full-sized Pholy element bordered by two 275- to 280-bp long terminal repeats (LTRs), (ii) five Pholy-related sequences, usually truncated at their 3' ends, and (iii) five solo-LTRs. Structural features strongly suggested that Pholy corresponds to an ancient copia-like retrotransposon, sharing strong homologies with the Elsa retrotransposon of Stagonospora nodorum. Pholy was also suggested to be specific to pericentromeric regions. Comparative analysis of the structure of the Pholy-like sequences occurring in the 184-kb contig and in other parts of the genome showed that this family of repeats is highly degenerated following extensive repeat induced point mutation (RIP).