Search

Substance abuse and addiction represent a significant public health problem that impacts multiple dimensions of society, including healthcare, the economy, and the workforce. In 2021, over 100,000 drug overdose deaths were reported in the US, with an alarming increase in fatalities related to opioids and psychostimulants. Understanding the fundamental gene regulatory mechanisms underlying addiction and related behaviors could facilitate more effective treatments. To explore how repeated drug exposure alters gene regulatory networks in the brain, we combined capped small (cs)RNA-seq, which accurately captures nascent-like initiating transcripts from total RNA, with Hi-C and single nuclei (sn)ATAC-seq. We profiled initiating transcripts in two addiction-related brain regions, the prefrontal cortex (PFC) and the nucleus accumbens (NAc), from rats that were never exposed to drugs or were subjected to prolonged abstinence after oxycodone or cocaine intravenous self-administration (IVSA). Interrogating over 100,000 active transcription start regions (TSRs) revealed that most TSRs had hallmarks of bonafide enhancers and highlighted the KLF/SP1, RFX, and AP1 transcription factors families as central to establishing brain-specific gene regulatory programs. Analysis of rats with addiction-like behaviors versus controls identified addiction-associated repression of transcription at regulatory enhancers recognized by nuclear receptor subfamily 3 group C (NR3C) factors, including glucocorticoid receptors. Cell-type deconvolution analysis using snATAC-seq uncovered a potential role of glial cells in driving the gene regulatory programs associated with addiction-related phenotypes. These findings highlight the power of advanced transcriptomics methods to provide insight into how addiction perturbs gene regulatory programs in the brain.

Breast cancer is the most frequently occurred cancer type and the second cause of death in women worldwide. Alternative splicing (AS) is the process that generates more than one mRNA isoform from a single gene, and it plays a major role in expanding the human protein diversity. Aberrant AS contributes to breast cancer metastasis and resistance to chemotherapeutic interventions. Therefore, identifying cancer-specific isoforms is the prerequisite for therapeutic interventions intended to correct aberrantly expressed AS events. Here, we performed RNA-mediated oligonucleotide annealing, selection, and ligation coupled with next-generation sequencing (RASL-seq) in breast cancer cells, to identify global breast cancer-specific AS defects. By RT-PCR validation, we demonstrate the high accuracy of RASL-seq results. In addition, we analyzed identified AS events using the Cancer Genome Atlas (TCGA) database in a large number of non-pathological and breast tumor specimens and validated them in normal and breast cancer samples. Interestingly, aberrantly regulated AS cassette exons in cancer tissues do not encode for known functional domains but instead encode for amino acids constituting regions of intrinsically disordered protein portions characterized by high flexibility and prone to be subjected to post-translational modifications. Collectively, our results reveal novel AS errors occurring in human breast cancer, potentially affecting breast cancer-related biological processes.

Aberrant alternative splicing (AS) is a hallmark of cancer and a potential target for novel anti-cancer therapeutics. Breast cancer-associated AS events are known to be linked to disease progression, metastasis, and survival of breast cancer patients. To identify altered AS programs occurring in metastatic breast cancer, we perform a global analysis of AS events by using RNA-mediated oligonucleotide annealing, selection, and ligation coupled with next-generation sequencing (RASL-seq). We demonstrate that, relative to low-metastatic, high-metastatic breast cancer cells show different AS choices in genes related to cancer progression. Supporting a global reshape of cancer-related splicing profiles in metastatic breast cancer we found an enrichment of RNA-binding motifs recognized by several splicing regulators, which have aberrant expression levels or activity during breast cancer progression, including SRSF1. Among SRSF1-regulated targets we found DCUN1D5, a gene for which skipping of exon 4 in its pre-mRNA introduces a premature termination codon (PTC), thus generating an unstable transcript degraded by nonsense-mediated mRNA decay (NMD). Significantly, distinct breast cancer subtypes show different DCUN1D5 isoform ratios with metastatic breast cancer expressing the highest level of the NMD-insensitive DCUN1D5 mRNA, thus showing high DCUN1D5 expression levels, which are ultimately associated with poor overall and relapse-free survival in breast cancer patients. Collectively, our results reveal global AS features of metastatic breast tumors, which open new possibilities for the treatment of these aggressive tumor types.

Many proteins regulate the expression of genes by binding to specific regions encoded in the genome1. Here we introduce a new data set of RNA elements in the human genome that are recognized by RNA-binding proteins (RBPs), generated as part of the Encyclopedia of DNA Elements (ENCODE) project phase III. This class of regulatory elements functions only when transcribed into RNA, as they serve as the binding sites for RBPs that control post-transcriptional processes such as splicing, cleavage and polyadenylation, and the editing, localization, stability and translation of mRNAs. We describe the mapping and characterization of RNA elements recognized by a large collection of human RBPs in K562 and HepG2 cells. Integrative analyses using five assays identify RBP binding sites on RNA and chromatin in vivo, the in vitro binding preferences of RBPs, the function of RBP binding sites and the subcellular localization of RBPs, producing 1,223 replicated data sets for 356 RBPs. We describe the spectrum of RBP binding throughout the transcriptome and the connections between these interactions and various aspects of RNA biology, including RNA stability, splicing regulation and RNA localization. These data expand the catalogue of functional elements encoded in the human genome by the addition of a large set of elements that function at the RNA level by interacting with RBPs.

The paternal genome undergoes a massive exchange of histone with protamine for compaction into sperm during spermiogenesis. Upon fertilization, this process is potently reversed, which is essential for parental genome reprogramming and subsequent activation; however, it remains poorly understood how this fundamental process is initiated and regulated. Here, we report that the previously characterized splicing kinase SRPK1 initiates this life-beginning event by catalyzing site-specific phosphorylation of protamine, thereby triggering protamine-to-histone exchange in the fertilized oocyte. Interestingly, protamine undergoes a DNA-dependent phase transition to gel-like condensates and SRPK1-mediated phosphorylation likely helps open up such structures to enhance protamine dismissal by nucleoplasmin (NPM2) and enable the recruitment of HIRA for H3.3 deposition. Remarkably, genome-wide assay for transposase-accessible chromatin sequencing (ATAC-seq) analysis reveals that selective chromatin accessibility in both sperm and MII oocytes is largely erased in early pronuclei in a protamine phosphorylation-dependent manner, suggesting that SRPK1-catalyzed phosphorylation initiates a highly synchronized reorganization program in both parental genomes.

Primary liver cancer develops from multifactorial etiologies, resulting in extensive genomic heterogeneity. To probe the common mechanism of hepatocarcinogenesis, we interrogated temporal gene expression profiles in a group of mouse models with hepatic steatosis, fibrosis, inflammation, and, consequently, tumorigenesis. Instead of anticipated progressive changes, we observed a sudden molecular switch at a critical precancer stage, by developing analytical platform that focuses on transcription factor (TF) clusters. Coarse-grained network modeling demonstrated that an abrupt transcriptomic transition occurred once changes were accumulated to reach a threshold. Based on the experimental and bioinformatic data analyses as well as mathematical modeling, we derived a tumorigenic index (TI) to quantify tumorigenic signal strengths. The TI is powerful in predicting the disease status of patients with metabolic disorders and also the tumor stages and prognosis of liver cancer patients with diverse backgrounds. This work establishes a quantitative tool for triage of liver cancer patients and also for cancer risk assessment of chronic liver disease patients.

Both activating and inactivating mutations in catenin β1 (ctnnb1), which encodes β-catenin, have been implicated in liver tumorigenesis in humans and mice, although the underlying mechanisms are not fully understood. Herein, we show that deletion of endogenous β-catenin in hepatocytes aggravated hepatocellular carcinoma (HCC) development driven by an oncogenic version of β-catenin (CAT) in combination with the hepatocyte growth factor receptor MET proto-oncogene receptor tyrosine kinase (MET). Although the mitogenic signaling and cell cycle progression was modestly impaired after CAT/MET transfection, the β-catenin-deficient livers displayed changes in transcriptomes, increased DNA damage response, expanded Sox9+ cells, and up-regulation of protumorigenic cytokines, including interleukin-6 and transforming growth factor β1. These events eventually exacerbated CAT/MET-driven hepatocarcinogenesis in β-catenin-deficient livers, featured by up-regulation of extracellular signal-regulated kinase (Erk), protein kinase B (Akt), and Wnt/β-catenin signaling and cyclin D1 expression. The resultant mouse tumors showed similar transcriptomes to human HCC samples with concomitant CTNNB1 mutations and MET overexpression.ConclusionThese data argue that while dominantly activating mutants of β-catenin are oncogenic, inhibiting the oncogenic signaling pathway generates a pro-oncogenic microenvironment that may facilitate HCC recurrence following a targeted therapy of the primary tumor. An effective therapeutic strategy must require disruption of the oncogenic signaling in tumor cells and suppression of the secondary tumor-promoting stromal effects in the liver microenvironment. (Hepatology 2018;67:1807-1822).

Mutations in several general pre-mRNA splicing factors have been linked to myelodysplastic syndromes (MDSs) and solid tumors. These mutations have generally been assumed to cause disease by the resultant splicing defects, but different mutations appear to induce distinct splicing defects, raising the possibility that an alternative common mechanism is involved. Here we report a chain of events triggered by multiple splicing factor mutations, especially high-risk alleles in SRSF2 and U2AF1, including elevated R-loops, replication stress, and activation of the ataxia telangiectasia and Rad3-related protein (ATR)-Chk1 pathway. We further demonstrate that enhanced R-loops, opposite to the expectation from gained RNA binding with mutant SRSF2, result from impaired transcription pause release because the mutant protein loses its ability to extract the RNA polymerase II (Pol II) C-terminal domain (CTD) kinase-the positive transcription elongation factor complex (P-TEFb)-from the 7SK complex. Enhanced R-loops are linked to compromised proliferation of bone-marrow-derived blood progenitors, which can be partially rescued by RNase H overexpression, suggesting a direct contribution of augmented R-loops to the MDS phenotype.

The Ewing Sarcoma protein (EWS) is a multifaceted RNA binding protein (RBP) with established roles in transcription, pre-mRNA processing and DNA damage response. By generating high quality EWS-RNA interactome, we uncovered its specific and prevalent interaction with a large subset of primary microRNAs (pri-miRNAs) in mammalian cells. Knockdown of EWS reduced, whereas overexpression enhanced, the expression of its target miRNAs. Biochemical analysis revealed that multiple elements in target pri-miRNAs, including the sequences flanking the stem-loop region, contributed to high affinity EWS binding and sequence swap experiments between target and non-target demonstrated that the flanking sequences provided the specificity for enhanced pri-miRNA processing by the Microprocessor Drosha/DGCR8. Interestingly, while repressing Drosha expression, as reported earlier, we found that EWS was able to enhance the recruitment of Drosha to chromatin. Together, these findings suggest that EWS may positively and negatively regulate miRNA biogenesis via distinct mechanisms, thus providing a new foundation to understand the function of EWS in development and disease.

R-loop, a three-stranded RNA/DNA structure, has been linked to induced genome instability and regulated gene expression. To enable precision analysis of R-loops in vivo, we develop an RNase-H-based approach; this reveals predominant R-loop formation near gene promoters with strong G/C skew and propensity to form G-quadruplex in non-template DNA, corroborating with all biochemically established properties of R-loops. Transcription perturbation experiments further indicate that R-loop induction correlates to transcriptional pausing. Interestingly, we note that most mapped R-loops are each linked to a nearby free RNA end; by using a ribozyme to co-transcriptionally cleave nascent RNA, we demonstrate that such a free RNA end coupled with a G/C-skewed sequence is necessary and sufficient to induce R-loop. These findings provide a topological solution for RNA invasion into duplex DNA and suggest an order for R-loop initiation and elongation in an opposite direction to that previously proposed.

MicroRNA (miRNA) biogenesis is known to be modulated by a variety of RNA-binding proteins (RBPs), but in most cases, individual RBPs appear to influence the processing of a small subset of target miRNAs. Here, we report that the RNA-binding NONO-PSF heterodimer binds a large number of expressed pri-miRNAs in HeLa cells to globally enhance pri-miRNA processing by the Drosha-DGCR8 Microprocessor. NONO and PSF are key components of paraspeckles organized by the long noncoding RNA (lncRNA) NEAT1. We further demonstrate that NEAT1 also has a profound effect on global pri-miRNA processing. Mechanistic dissection reveals that NEAT1 broadly interacts with the NONO-PSF heterodimer as well as many other RBPs and that multiple RNA segments in NEAT1, including a 'pseudo pri-miRNA' near its 3' end, help attract the Microprocessor. These findings suggest a 'bird nest' model in which an lncRNA orchestrates efficient processing of potentially an entire class of small noncoding RNAs in the nucleus.

Higher eukaryotic genomes are bound by a large number of coding and non-coding RNAs, but approaches to comprehensively map the identity and binding sites of these RNAs are lacking. Here we report a method to capture in situ global RNA interactions with DNA by deep sequencing (GRID-seq), which enables the comprehensive identification of the entire repertoire of chromatin-interacting RNAs and their respective binding sites. In human, mouse, and Drosophila cells, we detected a large set of tissue-specific coding and non-coding RNAs that are bound to active promoters and enhancers, especially super-enhancers. Assuming that most mRNA-chromatin interactions indicate the physical proximity of a promoter and an enhancer, we constructed a three-dimensional global connectivity map of promoters and enhancers, revealing transcription-activity-linked genomic interactions in the nucleus.

Myelodysplastic syndromes (MDS) are heterogeneous myeloid disorders with prevalent mutations in several splicing factors, but the splicing programs linked to specific mutations or MDS in general remain to be systematically defined. We applied RASL-seq, a sensitive and cost-effective platform, to interrogate 5502 annotated splicing events in 169 samples from MDS patients or healthy individuals. We found that splicing signatures associated with normal hematopoietic lineages are largely related to cell signaling and differentiation programs, whereas MDS-linked signatures are primarily involved in cell cycle control and DNA damage responses. Despite the shared roles of affected splicing factors in the 3 splice site definition, mutations in U2AF1, SRSF2, and SF3B1 affect divergent splicing programs, and interestingly, the affected genes fall into converging cancer-related pathways. A risk score derived from 11 splicing events appears to be independently associated with an MDS prognosis and AML transformation, suggesting potential clinical relevance of altered splicing patterns in MDS.

FUS is an RNA-binding protein involved in amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Cytoplasmic FUS-containing aggregates are often associated with concomitant loss of nuclear FUS Whether loss of nuclear FUS function, gain of a cytoplasmic function, or a combination of both lead to neurodegeneration remains elusive. To address this question, we generated knockin mice expressing mislocalized cytoplasmic FUS and complete FUS knockout mice. Both mouse models display similar perinatal lethality with respiratory insufficiency, reduced body weight and length, and largely similar alterations in gene expression and mRNA splicing patterns, indicating that mislocalized FUS results in loss of its normal function. However, FUS knockin mice, but not FUS knockout mice, display reduced motor neuron numbers at birth, associated with enhanced motor neuron apoptosis, which can be rescued by cell-specific CRE-mediated expression of wild-type FUS within motor neurons. Together, our findings indicate that cytoplasmic FUS mislocalization not only leads to nuclear loss of function, but also triggers motor neuron death through a toxic gain of function within motor neurons.

Alternative polyadenylation (APA) is widespread in neuronal development and activity-mediated neural plasticity. However, the underlying molecular mechanisms are largely unknown. We used systematic genetic studies and genome-wide surveys of the transcriptional landscape to identify a context-dependent regulatory pathway controlling APA in the Caenorhabditis elegans nervous system. Loss of function in ssup-72, a Ser5 phosphatase for the RNA polymerase II (Pol II) C-terminal domain (CTD), dampens transcription termination at a strong intronic polyadenylation site (PAS) in unc-44/ankyrin yet promotes termination at the weak intronic PAS of the MAP kinase dlk-1. A nuclear protein, SYDN-1, which regulates neuronal development, antagonizes the function of SSUP-72 and several nuclear polyadenylation factors. This regulatory pathway allows the production of a neuron-specific isoform of unc-44 and an inhibitory isoform of dlk-1. Dysregulation of the unc-44 and dlk-1 mRNA isoforms in sydn-1 mutants impairs neuronal development. Deleting the intronic PAS of unc-44 results in increased pre-mRNA processing of neuronal ankyrin and suppresses sydn-1 mutants. These results reveal a mechanism by which regulation of CTD phosphorylation controls coding region APA in the nervous system.

Myelodysplastic syndromes (MDS) are a group of neoplasms characterized by ineffective myeloid hematopoiesis and various risks for leukemia. SRSF2, a member of the serine/arginine-rich (SR) family of splicing factors, is one of the mutation targets associated with poor survival in patients suffering from myelodysplastic syndromes. Here we report the biological function of SRSF2 in hematopoiesis by using conditional knockout mouse models. Ablation of SRSF2 in the hematopoietic lineage caused embryonic lethality, and Srsf2-deficient fetal liver cells showed significantly enhanced apoptosis and decreased levels of hematopoietic stem/progenitor cells. Induced ablation of SRSF2 in adult Mx1-Cre Srsf2(flox/flox) mice upon poly(I):poly(C) injection demonstrated a significant decrease in lineage(-) Sca(+) c-Kit(+) cells in bone marrow. To reveal the functional impact of myelodysplastic syndromes-associated mutations in SRSF2, we analyzed splicing responses on the MSD-L cell line and found that the missense mutation of proline 95 to histidine (P95H) and a P95-to-R102 in-frame 8-amino-acid deletion caused significant changes in alternative splicing. The affected genes were enriched in cancer development and apoptosis. These findings suggest that intact SRSF2 is essential for the functional integrity of the hematopoietic system and that its mutations likely contribute to development of myelodysplastic syndromes.

DNA methylation at selective cytosine residues (5-methylcytosine (5mC)) and their removal by TET-mediated DNA demethylation are critical for setting up pluripotent states in early embryonic development. TET enzymes successively convert 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC), with 5fC and 5caC subject to removal by thymine DNA glycosylase (TDG) in conjunction with base excision repair. Early reports indicate that 5fC and 5caC could be stably detected on enhancers, promoters and gene bodies, with distinct effects on gene expression, but the mechanisms have remained elusive. Here we determined the X-ray crystal structure of yeast elongating RNA polymerase II (Pol II) in complex with a DNA template containing oxidized 5mCs, revealing specific hydrogen bonds between the 5-carboxyl group of 5caC and the conserved epi-DNA recognition loop in the polymerase. This causes a positional shift for incoming nucleoside 5'-triphosphate (NTP), thus compromising nucleotide addition. To test the implication of this structural insight in vivo, we determined the global effect of increased 5fC/5caC levels on transcription, finding that such DNA modifications indeed retarded Pol II elongation on gene bodies. These results demonstrate the functional impact of oxidized 5mCs on gene expression and suggest a novel role for Pol II as a specific and direct epigenetic sensor during transcription elongation.

Heart failure is characterized by the transition from an initial compensatory response to decompensation, which can be partially mimicked by transverse aortic constriction (TAC) in rodent models. Numerous signaling molecules have been shown to be part of the compensatory program, but relatively little is known about the transition to decompensation that leads to heart failure. Here, we show that TAC potently decreases the RBFox2 protein in the mouse heart, and cardiac ablation of this critical splicing regulator generates many phenotypes resembling those associated with decompensation in the failing heart. Global analysis reveals that RBFox2 regulates splicing of many genes implicated in heart function and disease. A subset of these genes undergoes developmental regulation during postnatal heart remodeling, which is reversed in TAC-treated and RBFox2 knockout mice. These findings suggest that RBFox2 may be a critical stress sensor during pressure overload-induced heart failure.

The U2AF heterodimer has been well studied for its role in defining functional 3' splice sites in pre-mRNA splicing, but many fundamental questions still remain unaddressed regarding the function of U2AF in mammalian genomes. Through genome-wide analysis of U2AF-RNA interactions, we report that U2AF has the capacity to directly define ~88% of functional 3' splice sites in the human genome, but numerous U2AF binding events also occur in intronic locations. Mechanistic dissection reveals that upstream intronic binding events interfere with the immediate downstream 3' splice site associated either with the alternative exon, to cause exon skipping, or with the competing constitutive exon, to induce exon inclusion. We further demonstrate partial functional impairment with leukemia-associated mutations in U2AF35, but not U2AF65, in regulated splicing. These findings reveal the genomic function and regulatory mechanism of U2AF in both normal and disease states.

Spermatogenesis in mammals is characterized by two waves of piRNA expression: one corresponds to classic piRNAs responsible for silencing retrotransponsons and the second wave is predominantly derived from nontransposon intergenic regions in pachytene spermatocytes, but the function of these pachytene piRNAs is largely unknown. Here, we report the involvement of pachytene piRNAs in instructing massive mRNA elimination in mouse elongating spermatids (ES). We demonstrate that a piRNA-induced silencing complex (pi-RISC) containing murine PIWI (MIWI) and deadenylase CAF1 is selectively assembled in ES, which is responsible for inducing mRNA deadenylation and decay via a mechanism that resembles the action of miRNAs in somatic cells. Such a highly orchestrated program appears to take full advantage of the enormous repertoire of diversified targeting capacity of pachytene piRNAs derived from nontransposon intergenic regions. These findings suggest that pachytene piRNAs are responsible for inactivating vast cellular programs in preparation for sperm production from ES.

Corneal and skin epithelium share many similarities, including a typical morphology of stratified epithelium and maintenance of their stem cells by p63 in the keratin 5/keratin [14.sup.+] (K5/K14)-expressing basal cell [...], The surface of the cornea consists of a unique type of non-keratinized epithelial cells arranged in an orderly fashion, and this is essential for vision by maintaining transparency for light transmission. Cornea epithelial cells (CECs) undergo continuous renewal from limbal stem or progenitor cells (LSCs) (1,2), and deficiency in LSCs or corneal epithelium--which turns cornea into a non-transparent, keratinized skin-like epithelium--causes corneal surface disease that leads to blindness in millions of people worldwide (3). How LSCs are maintained and differentiated into corneal epithelium in healthy individuals and which key molecular events are defective in patients have been largely unknown. Here we report establishment of an in vitro feeder-cell-free LSC expansion and three-dimensional corneal differentiation protocol in which we found that the transcription factors p63 (tumour protein 63) and PAX6 (paired box protein PAX6) act together to specify LSCs, and WNT7A controls corneal epithelium differentiation through PAX6. Loss of WNT7A or PAX6 induces LSCs into skin-like epithelium, a critical defect tightly linked to common human corneal diseases. Notably, transduction of PAX6 in skin epithelial stem cells is sufficient to convert them to LSC-like cells, and upon transplantation onto eyes in a rabbit corneal injury model, these reprogrammed cells are able to replenish CECs and repair damaged corneal surface. These findings suggest a central role of the WNT7A-PAX6 axis in corneal epithelial cell fate determination, and point to a new strategy for treating corneal surface diseases. GGATGCTGCCAAACTTGTTCTC

The life cycles of biotrophic pathogens of plants are intimately linked with host metabolism controlled by the cycle of day and night. Hence, their interactions with the host may be [...], The principal immune mechanism against biotrophic pathogens in plants is the resistance (R)-gene-mediated defence (1). It was proposed to share components with the broad-spectrum basal defence machinery (2). However, the underlying molecular mechanism is largely unknown. Here we report the identification of novel genes involved in R-gene-mediated resistance against downy mildew in Arabidopsis and their regulatory control by the circadian regulator, CIRCADIAN CLOCK-ASSOCIATED 1 (CCA1). Numerical clustering based on phenotypes of these gene mutants revealed that programmed cell death (PCD) is the major contributor to resistance. Mutants compromised in the R-gene-mediated PCD were also defective in basal resistance, establishing an interconnection between these two distinct defence mechanisms. Surprisingly, we found that these new defence genes are under circadian control by CCA1, allowing plants to 'anticipate' infection at dawn when the pathogen normally disperses the spores and time immune responses according to the perception of different pathogenic signals upon infection. Temporal control of the defence genes by CCA1 differentiates their involvement in basal and R-gene-mediated defence. Our study has revealed a key functional link between the circadian clock and plant immunity.