Search

Background: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known.Aims: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy.Methods: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis.Results: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9).Conclusions: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight. [ABSTRACT FROM AUTHOR]

For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:• Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.• BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:• BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old. [ABSTRACT FROM AUTHOR]

Objective: To report Peutz-Jeghers syndrome (PJS) cases with non-definitive clues in the family or personal history and finally diagnosed through pathological examination and STK11 gene mutation test.Clinical Presentation and Intervention: PJS was suspected in 3 families with tortuous medical courses. Two of them had relatives departed due to polyposis or colon cancer without pathological results, and the other one had been diagnosed as hyperplastic polyposis before. Diagnosis of PJS was confirmed by endoscopy and repeated pathological examinations, and the STK11 mutation test finally confirmed the diagnosis at genetic level, during which 3 novel mutation were detected (536C > A, 373_374insA, 454_455insGGAGAAGCGTTTCCCAGTGTGCC).Conclusion: Early diagnosis of PJS is important and may be based on a family history with selective features among family members, and the pathological information is the key. The novel mutations also expand the STK11 variant spectrum. [ABSTRACT FROM AUTHOR]

Background: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication.Case Presentation: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases.Conclusions: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up. [ABSTRACT FROM AUTHOR]

A letter to the editor in response to the article "New diagnosis of chronic pancreatitis: risk of missing an underlying pancreatic cancer" by S. Munigala and others, published in a 2014 issue of the journal, is presented.

Highlights • We validated that the combined usage of direct sequencing and MLPA can achieve a high detection rate in Chinese Han PJS patients. • We found significantly more splice mutations in Chinese Han PJS patients. • We suggest that wide usage of enteroscopy would be helpful in PJS surveillance. Abstract Background The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. Aims To test the efficacy of the combination in Chinese patients with PJS. Methods PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. Results We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. Conclusion The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance. [ABSTRACT FROM AUTHOR]

Background and Aims: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.Methods and Results: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.Conclusions: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing. [ABSTRACT FROM AUTHOR]

Background: Pancreatic stones are pathognomonic of chronic pancreatitis (CP). This study aimed to determine the incidence, identify risk factors, and develop a nomogram for pancreatic stones in CP patients. Methods: Patients with CP admitted to our center from January 2000 to December 2013 were enrolled. Cumulative rates of pancreatic stones after the onset of CP and after the diagnosis of CP were calculated. Patients were randomly assigned, in a 2:1 ratio, to the training and validation cohort. Based on the training cohort, risk factors were identified through Cox proportional hazards regression model, and nomogram was developed. Internal and external validations were performed based on the training and validation cohort, respectively. Results: With a total of 2,153 CP patients, pancreatic stones were detected in 1,626 (75.5%) patients, with a median follow-up of 7.8 years. Age at the onset of CP, body mass index, smoking, diabetes mellitus, pancreatic pseudocyst, biliary stricture, severe acute pancreatitis, and type of pain were identified risk factors for pancreatic stones development. The nomogram with these 8 factors achieved good accuracy. Conclusions: The nomogram achieved an individualized prediction of pancreatic stones development in CP. It may help the management of pancreatic stones. [ABSTRACT FROM AUTHOR]

Background and Aim: Pancreatic extracorporeal shock wave lithotripsy (P‐ESWL) is a first‐line treatment for chronic pancreatitis (CP) patients with pancreatic stones. However, the performance of P‐EWSL in geriatric patients remains unclear. We aimed to evaluate the safety and efficacy of P‐ESWL for them. Methods: This prospective study was conducted in painful CP patients who underwent P‐ESWL. Patients aged over 65 years were included in geriatric group; patients aged under 65 years were assigned to control group. For the long‐term follow‐up investigation, geriatric patients were matched with patients from the control group in a 1:1 ratio. Primary outcomes were complications of P‐ESWL and pain relief. Secondary outcomes included stone clearance, physical and mental health, quality of life score, changes in exocrine and endocrine pancreatic function, and survival. Results: From March 2011 to March 2016, P‐ESWL was performed in 1404 patients (72 in the geriatric group and 1332 in the control group). No significant differences were observed in complications of P‐ESWL between the two groups (P = 0.364). Among the 67 (67/72, 93.1%) geriatric patients who underwent follow up for 4.02 years, complete pain relief was achieved in 53 patients, which was not significantly different from that of matched controls (54/70; P = 0.920). The death in the geriatrics was significantly higher (P = 0.007), but none of them were correlated with P‐ESWL. Conclusions: P‐ESWL is safe and effective for geriatric CP patients with pancreatic stones. It can promote significant pain relief and stone clearance and improve quality of life and mental and physical health. [ABSTRACT FROM AUTHOR]

Background: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. Methods: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. Results: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. Conclusions: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice. [ABSTRACT FROM AUTHOR]

Background: Chronic pancreatitis (CP) is a chronic inflammatory disease of the pancreas. This study aimed to compare the natural course of alcoholic chronic pancreatitis (ACP) and idiopathic chronic pancreatitis (ICP). Methods: CP patients admitted to our center from January 2000 to December 2013 were enrolled. Characteristics were compared between ACP and ICP patients. Cumulative rates of diabetes mellitus (DM), steatorrhea, pancreatic stone, pancreatic pseudocyst, biliary stricture, and pancreatic cancer after the onset and the diagnosis of CP were calculated, respectively. The cumulative rates of DM and steatorrhea after diagnosis of pancreatic stone were also calculated. Results: A total of 2,037 patients were enrolled. Among them, 19.8% (404/2,037) were ACP and 80.2% (1,633/2,037) were ICP patients. ACP and ICP differs in many aspects, especially in gender, age, smoking, complications, morphology of pancreatic duct, and type of pain. The development of DM, steatorrhea, PPC, pancreatic stone, and biliary stricture were significantly earlier and more common in ACP patients. No significant difference was observed for pancreatic cancer development. There was a rather close correlation between exocrine/endocrine insufficiency and pancreatic stone in ACP patients, which was much less correlated in ICP patients. Conclusion: The long-term profile of ACP and ICP differs in some important aspects. ACP patients usually have a more severe course of CP. These differences should be recognized in the diagnosis and treatment of CP. [ABSTRACT FROM AUTHOR]

Background and Aim Pancreatic pseudocyst is a common complication of chronic pancreatitis. The identification of risk factors and development of a nomogram for pancreatic pseudocysts in chronic pancreatitis patients may contribute to the early diagnosis and intervention of pancreatic pseudocysts. Methods Patients with chronic pancreatitis admitted to our center from January 2000 to December 2013 were enrolled. Cumulative rates of pancreatic pseudocysts after the onset of chronic pancreatitis and after the diagnosis of chronic pancreatitis were calculated. Patients were randomly assigned, in a 2:1 ratio, to the training and validation cohort. Based on the training cohort, risk factors were identified through Cox proportional hazards regression model, and nomogram was developed. Internal and external validations were performed based on the training and validation cohort, respectively. Results With a total of 1998 patients, pancreatic pseudocysts were detected in 228 (11.41%) patients. Age at the onset of chronic pancreatitis, smoking, and severe acute pancreatitis were identified risk factors for pancreatic pseudocysts development while steatorrhea and pancreatic stones were protective factors. Incorporating these five factors, the nomogram achieved good concordance indexes of 0.735 and 0.628 in the training and validation cohorts, respectively, with well-fitted calibration curves. Conclusion The nomogram achieved an individualized prediction of pancreatic pseudocysts development in chronic pancreatitis. It may help the early diagnosis and management of pancreatic pseudocysts. [ABSTRACT FROM AUTHOR]

Background: Autoimmune factor was regarded as one of the risk factors in the pathogenesis of chronic pancreatitis (CP), especially for autoimmune pancreatitis (AIP). However, whether autoimmune factor plays a role in non-AIP CP or not was unknown.Methods: Hospitalized patients with non-AIP CP from January 2010 to October 2016 were detected for 22 autoantibodies at the time of hospital admission. Autoantibodies with frequency > 0.5% were enrolled to calculate the frequency in historial healthy controls through literature search in PubMed. Differentially expressed autoantibodies were determined between patients and historial healthy controls, and related factors were identified by multivariate logistic regression analysis.Results: In a total of 557 patients, 113 cases were detected with 19 kinds of positive autoantibodies, among them anti-β2-glycoprotein I (β2-GPI) antibody was most frequent (9.16%). Compared with historial healthy controls, the frequencies of serum β2-GPI and anti SS-B antibody in patients were significantly higher, while frequencies of anti-smooth muscle antibody and anticardiolipin antibody were significantly lower (all P < 0.05). Multivariate logistic regression analysis result showed that diabetes mellitus (OR = 2.515) and common bile duct stricture (OR = 2.844) were the risk factors of positive β2-GPI antibody in patients while diabetes mellitus in first-/second-/third-degree relatives (OR = 0.266) was the protective factor. There were no related factors for other three differentially expressed autoantibodies.Conclusions: Four autoantibodies were expressed differentially between patients with non-AIP CP and historial healthy controls. Due to limited significance for diagnosis and treatment of chronic pancreatitis, autoantibodies detection is not recommended conventionally unless suspected of AIP. [ABSTRACT FROM AUTHOR]

Background: Pediatric patients always suffer from chronic pancreatitis (CP), especially those with steatorrhea. This study aimed to identify the incidence of and risk factors for steatorrhea in pediatric CP. To our best knowledge, there is no pediatric study to document the natural history of steatorrhea in CP.Methods: CP patients admitted to our center from January 2000 to December 2013 were enrolled. Patients were assigned to the pediatric (< 18 years old) and adult group according to their age at onset of CP. Cumulative rates of steatorrhea in both groups were calculated. Risk factors for both groups were identified, respectively.Results: The median follow-up duration for the whole cohort was 7.6 years. In a total of 2153 patients, 13.5% of them were pediatrics. The mean age at the onset and the diagnosis of CP in pediatrics were 11.622 and 19.727, respectively. Steatorrhea was detected in 46 patients (46/291, 15.8%) in the pediatric group and in 447 patients (447/1862, 24.0%) in the adult group. Age at the onset of CP (hazard ratio [HR], 1.121), diabetes mellitus (DM, HR, 51.140), and severe acute pancreatitis (SAP, HR, 13.946) was identified risk factor for steatorrhea in the pediatric group.Conclusions: Age at the onset of CP, DM and SAP were identified risk factors for the development of steatorrhea in pediatric CP patients. The high-risk populations were suggested to be followed up closely. They may benefit from a full adequate pancreatic exocrine replacement therapy. [ABSTRACT FROM AUTHOR]