Search

The proteins present in gas vesicles of the cyanobacteria Anabaena flos-aquae and Microcystis sp. were separated by SDS-polyacrylamide gel electrophoresis. Each contained a protein of Mr 22 K whose N-terminal amino acid sequences showed homology with that of the Calothrix sp. PCC 7601 gvpC gene product. The gvpC gene from A. flos-aquae was cloned and sequenced. The derived amino acid sequence for the gene product indicated a protein, GVPc, of 193 residues and Mr 21985 containing five highly conserved 33 amino acid repeats. The sequence was identical at the N-terminus to that of the Mr 22K protein present in gas vesicles and showed correspondence to seven tryptic peptides isolated from gas vesicles. This establishes that GVPc forms a second protein component of the gas vesicle, in addition to the main constituent, the 70 residue GVPa. Quantitative amino acid analysis of entire gas vesicles reveals that GVPc accounts for only 2.9% of the protein molecules and 8.2% of the mass present: this is insufficient to form the conical end caps of the gas vesicles. It is suggested that GVPc provides the hydrophilic outer surface of the gas vesicle wall; the 33 amino acid repeats may interact with the periodic structure provided by GVPa. [ABSTRACT FROM AUTHOR]

Background: Recent advances in the molecular biology of polyketide biosynthesis have allowed the engineering of polyketide synthases and the biological ('combinatorial') synthesis of novel polyketides. Additional structural diversity in these compounds could be expected if more diverse polyketide synthases (PKS) could be utilised. Fungal polyketides are highly variable in structure, reflecting a potentially wide range of differences in the structure and function of fungal PKS complexes. Relatively few fungal synthases have been investigated, perhaps because of a lack of suitable genetic techniques available for the isolation and manipulation of gene clusters from diverse hosts. We set out to devise a general method for the detection of specific PKS genes from fungi., Results: We examined sequence data from known fungal and bacterial polyketide synthases as well as sequence data from bacterial, fungal and vertebrate fatty acid synthases in order to determine regions of high sequence conservation. Using individual domains such as beta-ketoacylsynthases (KS), beta-ketoreductases (KR) and methyltransferases (MeT) we determined specific short (ca 7 amino acid) sequences showing high conservation for particular functional domains (e.g. fungal KR domains involved in producing partially reduced metabolites; fungal KS domains involved in the production of highly reduced metabolites etc.). Degenerate PCR primers were designed matching these regions of specific homology and the primers were used in PCR reactions with fungal genomic DNA from a number of known polyketide producing species. Products obtained from these reactions were sequenced and shown to be fragments from as-yet undiscovered PKS gene clusters. The fragments could be used in blotting experiments with either homologous or heterologous fungal genomic DNA., Conclusions: A number of sequences are presented which have high utility for the discovery of novel fungal PKS gene clusters. The sequences appear to be specific for particular types of fungal polyketide (i.e. non-reduced, partially reduced or highly reduced KS domains). We have also developed primers suitable for amplifying segments of fungal genes encoding polyketide C-methyltransferase domains. Genomic fragments amplified using these specific primer sequences can be used in blotting experiments and have high potential as aids for the eventual cloning of new fungal PKS gene clusters.

Genes encoding two distinct fatty acid delta9-desaturases were isolated from strains of the oleaginous fungus Mortierella alpina. Two genomic sequences, delta9-1 and delta9-2, each containing a single intron, were cloned from strain CBS 528.72 while one cDNA clone, LM9, was isolated from strain CBS 210.32. The delta9-1 gene encoded a protein of 445 aa which shared 99% identity with the LM9 gene product. These proteins also showed 40-60% identity to the delta9-desaturases (Ole1p) of other fungi and contained the three conserved histidine boxes, C-terminal cytochrome b5 fusion and transmembrane domains characteristic of endoplasmic reticulum membrane-bound delta9-desaturases. LM9 and delta9-1 are therefore considered to represent the same gene (ole1). The ole1 gene was transcriptionally active in all M. alpina strains tested and its function was confirmed by complementation of the Saccharomyces cerevisiae ole1 mutation. Fatty acid analysis of yeast transformants expressing the CBS 210.32 ole1 gene showed an elevated level of oleic acid (18:1) compared to palmitoleic acid (16:1), the major fatty acid component of wild-type S. cerevisiae. This indicated that the M. alpina delta9-desaturase had a substrate preference for stearic acid (18:0) rather than palmitic acid (16:0). Genomic clone delta9-2 (ole2) also encoded a protein of 445 aa which had 86% identity to the delta9-1 and LM9 proteins and whose ORF also complemented the yeast ole1 mutation. The transcript from this gene could only be detected in one of the six M. alpina strains tested, suggesting that its expression may be strain-specific or induced under certain physiological conditions.

Analysis of fungal polyketide synthase gene sequences suggested that these might be divided into two subclasses, designated WA-type and MSAS-type. Two pairs of degenerate PCR primers (LC1 and LC2c, LC3 and LC5c) were designed for the amplification of ketosynthase domain fragments from fungal PKS genes in each of these subclasses. Both primer pairs were shown to amplify one or more PCR products from the genomes of a range of ascomycetous Deuteromycetes and Southern blot analysis confirmed that the products obtained with each pair of primers emanated from distinct genomic loci. PCR products obtained from Penicillium patulum and Aspergillus parasiticus with the LC1/2c primer pair and from Phoma sp. C2932 with both primer pairs were cloned and sequenced; the deduced protein sequences were highly homologous to the ketosynthase domains of other fungal PKS genes. Genes from which LC1/2c fragments were amplified (WA-type) were shown by a phylogenetic analysis to be closely related to fungal PKS genes involved in pigment and aflatoxin biosynthetic pathways, whereas the gene from which the LC3/5c fragment was amplified (MSAS-type) was shown to be closely related to genes encoding 6-methylsalicylic acid synthase (MSAS). The phylogenetic tree strongly supported the division of fungal PKS genes into two subclasses. The LC-series primers may be useful molecular tools to facilitate the cloning of novel fungal polyketide synthase genes., (Copyright 1999 Academic Press.)

We have identified a cDNA from the nematode worm Caenorhabditis elegans that encodes a fatty acid delta5 desaturase. Saccharomyces cerevisiae expressing the full-length cDNA was able to convert di-homo-gamma-linolenic acid to arachidonic acid, thus confirming delta5 desaturation. The 1341 bp delta5 desaturase sequence contained an N-terminal cytochrome b5 domain and was located within a kilobase of the C. elegans delta6 desaturase on chromosome IV. With an amino acid identity of 45% it is possible that one of these genes arose from the other by gene duplication. This is the first example of a delta5 desaturase gene isolated from an animal.

To elucidate the mechanisms by which alpha-amylase genes are expressed in wild oat aleurone, two genes, alpha-Amy2/A and alpha-Amy2/D, were isolated. Both were shown to be positively regulated by gibberellin (GA) during germination and both contain the conserved cis-acting elements Box 2, GA-response element (TAACAGA) and TATCSATSS (where S is C or G). In addition, they possess a conserved initiator element (CATCA) that is present in both alpha-Amy2 and alpha-Amy1 genes, and also in a number of other plant TATA-containing and TATA-less promoters. DNase 1 footprint analysis showed the alpha-Amy2/A promoter to be a complex array of binding sites for a number of different classes of DNA-binding proteins. Our data suggest that the area around the initiator element (Inr) is bound by a large complex of general transcription factors, that the TATA box is bound by the TFIID complex, that Box 2 is bound by one or more WRKY proteins and that the GA-response element is bound by one or more MYBs. Two other elements containing the core sequence CCATGG/C are bound by nuclear protein and this sequence is the core of the Sph element. The regulation of alpha-Amy2 genes by GA therefore involves an interplay of at least three different types of transcription factor.

High level expression of the major auxin-binding protein (ABP1) from maize (Zea mays L.) has been used to demonstrate that the machinery for retaining proteins in the endoplasmic reticulum (ER) of insect cells functions efficiently throughout the baculovirus infection cycle. Immunolocalization showed wild-type ABP1 (ABP1-KDEL) to be targeted to the lumen of the ER, in accordance with its signal peptide and carboxyterminal KDEL ER-retention signal. The protein accumulated in dilations of the ER, and none was detected at the cell surface. Immunoblotting of concentrated culture medium confirmed that ABP1-KDEL was not secreted at a detectable level. In contrast, when the carboxyterminus was mutated to KEQL, secretion of the baculovirus-expressed protein was readily detected. Immunolocalization and immunoblotting demonstrated that a high proportion of the ABP1-KEQL protein was secreted at the cell surface and into the culture medium. The data demonstrate that the ER of insect cells has a great capacity to retain proteins and that this property is largely unaffected by the cellular disruption caused by baculovirus replication.

A gene encoding an auxin-binding protein (ABP1) was isolated from strawberry by screening a genomic library with an ABP1 cDNA from maize. It resembles ABP1 genes from other sources both in structure (four introns) and in the high level of homology of the deduced amino acid sequence of the mature protein encoded in exons 2-5. Exon 1, encoding mainly the non-conserved signal peptide, was identified by a reverse transcriptase-polymerase chain reaction (RT-PCR) technique. Northern analysis indicated that ABP1 transcript levels were low during fruit development, but transcripts were detected by RT PCR at all stages of receptacle swelling (auxin-dependent) and ripening (inhibited by auxin), consistent with a role for ABP1 in auxin perception. Southern blot analysis indicated a small ABP1 gene family in octoploid cultivated strawberry, and four genes were identified by comparison of genomic and cDNA sequences. RT PCR was used to amplify the complete coding region for cloning as cDNA, and a recombinant baculovirus was constructed for the expression of strawberry ABP1 in insect cells. The coding region contains three consensus glycosylation sites, and multiple bands representing a range of glycoforms of the protein were detected on western blots of insect cell extracts. Only a single band was observed in extracts of tunicamycin-treated cells, and glycosylated protein yielded a unique N-terminal amino acid sequence, allowing determination of the signal peptide cleavage site.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

To achieve continuous expression of the major maize auxin-binding protein (ABP1) in insect cells, the ABP1 gene coding region was placed under control of a baculovirus immediate-early gene promoter and transfected into Spodoptera frugiperda Sf9 cells. The ABP1 gene was detected in twelve cell lines, one of which was selected for detailed analysis. Immunolocalisation demonstrated that ABP1 was targeted to and retained in the endoplasmic reticulum (ER), in accordance with its signal peptide and carboxy-terminal KDEL ER-retention signal. We discuss the advantages of stable-transformation over transient expression systems for characterising proteins targeted to the secretory system of insect cells.

Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes.

The plant hormones GA, ABA, and auxin differ from the majority of animal hormones in that they are hydrophobic weak acids. They are soluble in the inter- and intra-cellular environments of plant tissues and their neutral species can cross the plasma membrane by passive diffusion. Auxin transport is mediated by specific uptake and efflux carriers in plasma membranes, and there is some evidence for carrier-mediated uptake of GA and ABA. Because these plant hormones can cross the plasma membrane it is not a prerequisite that receptors for them should be at the protoplast surface. Nevertheless, there is substantial evidence that auxin acts at the plasma membrane, and evidence suggesting that GA may be perceived at the plasma membrane of A. fatua aleurone protoplasts has been reviewed here. It is conceivable that the plant plasma membrane might provide the means to integrate, transduce, and amplify these signals, and that such properties of the plasma membrane, rather than the permeability characteristics of these ligands, may determine the site of perception. Further progress in our understanding of signal transduction pathways that may be involved in the actions of plant hormones is likely to shed light on these questions. It has been proposed that GA receptors involved in cell elongation may be soluble rather than membrane bound. The soluble 50 kDa GA-binding protein observed in aleurone by GA4 photoaffinity labelling may be a good candidate for a soluble GA receptor.(ABSTRACT TRUNCATED AT 250 WORDS)

Of several auxin-binding systems that have been characterised the auxin-binding protein (ABP) of maize coleoptile membranes is the best candidate for a true auxin receptor. ABP, which exists as a homodimer of 22 x 10(3) M(r) glycosylated subunits, has been purified, and monoclonal and polyclonal antibodies raised against it. Electrophysiological studies with antibodies indicated the presence of a functional population of auxin receptors on the exterior face of the plasmalemma; electrophysiological experiments with impermeant auxin analogues now reinforce this conclusion. An epitope mapping kit has been used to identify the major epitopes recognised by antibody preparations. Three major epitopes, bracketing the glycosylation site, have been identified in the polyclonal serum. They are also represented in antisera produced in other laboratories and are conserved in ABP prepared from other plants. One monoclonal antibody recognises an epitope close to the amino terminus of ABP and two others recognise the carboxy terminus. The latter antibodies have been used in a sandwich ELISA to demonstrate that auxin binding induces a conformational change in ABP. Maize ABP is encoded by a small gene family and cDNA and genomic clones have been isolated. With a single exception, predicted amino acid sequences indicate remarkably little heterogeneity. The exceptional cDNA sequence predicts 87% amino acid homology with the major class of proteins. Four introns are apparent in the sequence of a complete ABP gene; their sequences are very highly conserved in an incompletely-cloned second gene lacking the first exon. The major difference between the two genes lies in the length of the first intron, which has been estimated to exceed 5.2 kb in the incomplete gene. The site of initiation of transcription has not been unambiguously identified in the complete gene, and some evidence suggests that there may be an additional intron. Homology to maize ABP cDNA has been detected in the genomes of Arabidopsis, spinach and strawberry but not in that of tobacco. A sequence located within the 3'-half of the maize cDNA is highly repeated in the strawberry genome, from which clones with homology to both halves of the maize cDNA (i.e. putative ABP genes) have been isolated.

The mitochondrial genome of Aspergillus nidulans var. echinulatus is approximately 20% larger than that of the closely related species Aspergillus nidulans (Eidam) Winter. Restriction enzyme mapping and electron microscopy has revealed that the size difference is due to the presence of six inserted sequences in the former. With the exception of a small number of species specific restriction sites and the six insertions/deletions, the two mitochondrial genomes appear identical. Protoplast fusion between the two species followed by selection of extranuclear drug resistance markers resulted in the isolation of recombinant mitochondrial genomes in an A. nid. var. echinulatus background. Restriction maps of the hybrid genomes indicated that three of the additional sequences found in A. nid. var. echinulatus could be transferred to the A. nidulans nuclear background without loss or detectable alteration. The nature of the additional mitochondrial DNA and high frequency transfer of certain species specific sequences is discussed with reference to studies in yeast and Neurospora crassa.

A nuclear, chloramphenicol-sensitive mutant cas-1 has been isolated which is cross sensitive to a number of drugs, including oligomycin and cycloheximide. Approximately one-third of the chloramphenicol-resistant mutants isolated from mutagenized conidia of this strain were found to be extranuclear, and exhibited a variety of phenotypes. One of these mutants, designated (camB51), was slow growing on drug-free medium and recombined at low frequency with the previously described mutant (camA112) (Gunatilleke et al., 1975). The majority of extranuclear oligomycin-resistant mutants isolated from cas-1 were indistinguishable from (oliA1) (Rowlands and Turner, 1973). Two mutants, (oliB322) and (oliB332), with similar but not identical phenotypes to (oli A1), recombined with the latter at low frequency but not with each other, thus representing a new class of extranuclear mutants.

The extranuclearly-inherited ragged growth phenotype (Rgd) of Aspergillus amstelodami is always accompanied by excision and head-to-tail amplification of mtDNA sequences. In one mutant strain (Rgd1) the amplified mtDNA segment (rgd1 DNA, monomeric length 0.9 kb) maps downstream of the large subunit ribosomal RNA gene (Region 1), whereas in all other strains analyzed the amplified sequences (rdg3-7DNA) are located in Region 2 between genes coding for cytochrome b and ATPase subunit 6. The various region 2 sequences differ in lengths (1.5 to 2.7 kb) but have in common a 215 bp sequence mapping between an. unidentified protein gene (corresponding to URF4 of human mtDNA) and an arginine tRNA gene. This common sequence may contain an origin of replication, because a looped-out hairpin structure similar to that of yeast and human mitochondrial origin sequences can be formed. Furthermore, Region 2 DNA suppresses replication of Region 1 DNA, indicating that the former group of molecules contains the more efficient origin. The nucleotide sequence of the rgd6 repeat unit starts and ends within protein genes of mtDNA, and no homologies were found between heads and tails or their flanking sequences.

A wheat alpha-amylase cDNA clone has been fused to the phosphoglycerate kinase initiator methionine to enable synthesis in the yeast Saccharomyces cerevisiae of an alpha-amylase enzyme that is identical in size to the wild-type alpha-amylase. The alpha-amylase is synthesized with an N-terminal plant signal peptide which is recognized in the yeast host, leading to efficient processing and secretion into the medium. The secretion of alpha-amylase into the medium is quite efficient in rich medium, but barely detectable in a minimal medium.

The α-Amy1 and α-Amy2 genes of wheat produce distinct subsets of α-amylase isozymes which show different patterns of expression in wheat aleurone cells and in developing grain. In order to characterise the organisation and expression of these genes, clones of α-Amy1 and α-Amy2 cDNA have been isolated. The two types of cDNA clone were distinguished within a small library of α-amylase cDNA clones (Baulcombe and Buffard, Planta 157 493-501 [1983]) by restriction endonuclease mapping and by cross hybridisation. The identity of α-Amy1 or α-Amy2 type was assigned from the results of hybrid selected translation analysis in which small subfragments of the cDNA clones were used. These subfragments were derived from the 3' ends of the cDNA and did not cross hybridise between the different types of cDNA. Hybridisation of α-Amy1 and α-Amy2 cDNA probes to restriction enzyme digests of wheat nuclear DNA revealed that these are multigene families located on the group 6 (α-Amy1) and group 7 (α-Amy2) chromosomes. Studies on the levels of α-Amy1 and α-Amy2 mRNA in developing grain and in aleurone tissue indicated that the differences in isozyme expression are due to the patterns of mRNA accumulation. In aleurone tissue the α-Amy1 transcripts accumulate in parallel with other genes which are regulated by gibberellic acid, while the accumulation of α-Amy2 genes is sustained for 36 h longer.

A detailed map of the 32 kb mitochondrial genome of Aspergillus nidulans has been obtained by locating the cleavage sites for restriction endonucleases Pst I, Bam H I, Hha I, Pvu II, Hpa II and Hae III relative to the previously determined sites for Eco R I, Hind II and Hind III. The genes for the small and large ribosomal subunit RNAs were mapped by gel transfer hybridization of in vitro labelled rRNA to restriction fragments of mitochondrial DNA and its cloned Eco R I fragment E3, and by electron microscopy of RNA/DNA hybrids. The gene for the large rRNA (2.9 kb) is interrupted by a 1.8 kb insert, and the main segment of this gene (2.4 kb) is separated from the small rRNA gene (1.4 kb) by a spacer sequence of 2.8 kb length. This rRNA gene organization is very similar to that of the two-times larger mitochondrial genome of Neurospora crassa, except that in A. nidulans the spacer and intervening sequences are considerably shorter.

The 60 kb circular mitochondrial genome of N. crassa has previously been shown to contain a single transcription unit for 17S and 24S rRNA mapping within the largest Eco RI fragment E1 (19.6 kb). This fragment was isolated from uncloned mitochondrial DNA and further analyzed by cleavage with restriction endonucleases Hind II, Hind III, Bam HI, Pvu II and BgI I, and by electron microscopy of rRNA/DNA hybrids. The resulting map shows a 2.3 kb intervening sequence interrupting the gene for 24S rRNA. The main part (2.7 kb) of this gene is separated from the 17S rRNA gene by a 5 kb segment which contains several transfer RNA genes. This segment is much longer than the putative 1 kb spacer sequence within the 32S precursor molecule for both rRNAs, suggesting a second splicing event in that region.

A comparison has been made between mtDNA of the cytoplasmically inherited 'ragged' mutant of Aspergillus amstelodami and that of the wild-type strain. Ragged mitochondria contain both the wild-type mitochondrial genome and several large DNA molecules which are not cleaved by the restriction endonucleases BamHI, HaeIII, HhaI, HindII, HindIII, PstI and MboI, but are converted by either EcoRI or HpaII into a single 820-840 base-pair fragment. Restriction analysis and molecular hybridization data indicate that this fragment contains sequences of wild-type mtDNA located within a 1200-base-pair segment of the 40,500-base-pair genome, for which a basic restriction map has been deduced. It is concluded that in the ragged mutant a small segment of wild-type mtDNA has been amplified as tandem repeats, which is reminiscent of the Rho- petite phenotype of yeast. The results are discussed in relation to the phenomenon of senescence in Podospora anserina.